Universal Primers ITS4 Research Articles

First Report of Citrus Root Rot Caused by Phytophthora palmivora in Egypt.

During spring-summer 2009, a survey was conducted to determine the species of Phytophthora present in citrus nurseries in Egypt. A total of 300 samples of soil and fibrous roots were collected from the rhizosphere of symptomatic Volkameriana lemon (Citrus volkameriana Tan. & Pasq.) plants growing in Delta (Benha-Qalyubia) and a desert (Cairo/Alexandria desert road) citrus nurseries. Plants showed various symptoms. Canopies of affected plants showed few and yellowish leaves, a general stunted growth, no new vegetation, and sometimes sudden desiccation; the root system showed few dark brown feeder roots, no new yellow-white apexes, and a fibrous appearance of the rootlets due to disintegration of the cortical bark but not of the xylem. Collected rootlets and soil were plated in Petri dishes containing a selective medium for the oomycete Phytophthora (2) and incubated for 3 to 6 days at 19 ± 1°C as described by Ippolito et al. (1). Pure cultures were obtained by single-hypha transfers and the isolates were identified as Phytophthora palmivora (Butler) Butler on the basis of morphological and cultural characteristics (3). Isolates formed stoloniferous colonies on potato dextrose agar (PDA) and grew between 10 and 30°C, with the optimum at 25°C. On V8 juice agar, they showed a highly fluffy pattern and produced terminal and intercalary globose chlamydospores. Sporangia were papillate, elliptical (45 to 51 × 29 to 35 μm; length/breadth ratio of 1.3:1.8), and were caducous with short pedicel. All isolates were A2 mating type, forming spherical oogonia and amphigynous antheridia in dual cultures with reference P. palmivora isolate of A1 mating type. Identification of the isolates was further confirmed by amplification and sequencing of the internal transcribed spacer (ITS) region using the universal primers ITS4 and ITS6. BLASTn analysis of ITS sequences (GenBank Accession No. HE583183) showed 99% homology with P. palmivora isolates available in GenBank. Pathogenicity tests for P. palmivora were conducted by inoculating three groups of ten 6-month-old Volkameriana lemon plants, transplanted into 1.4 liter pots with growing medium artificially inoculated at the rate of 1% (v/v) of P. palmivora inoculum produced according to Yaseen (4). Ten uninoculated plants served as a control. Two months after the inoculation, plants were analyzed for canopy symptoms and the presence of pathogen in feeder roots. More than 50% of inoculated plants showed foliage symptoms and extensive decay of feeder roots. Colonies of Phytophthora were recovered from necrotic rootlets and identified as P. palmivora, fulfilling Koch's postulates. To the best of our knowledge, this is the first report of P. palmivora as a pathogen to citrus plants in the Egyptian nurseries. P. palmivora should be considered a potential threat to the Egyptian citrus industry since it may negatively influence the nurseries and orchards production in the future.

First Record of Acremonium Wilt in Tomato from Pakistan.

During a survey in May 2011, tomato (Lycopersicon esculentum Mill.) plants were observed exhibiting wilt symptoms on the vegetable farm of the University of the Punjab Lahore (31°32'59″ N, 74°20'37″ E), Pakistan. Plants were pale yellow and stunted. Diseased plants were scattered in the field either singly or in groups of two or three. Lower leaves turned yellow following necrosis and shedding from the plants. Roots of diseased plants were dark brown in comparison to the healthy ones. Vascular browning was observed when infected stems were split longitudinally and sectioned transversely. Necrotic vascular strands were also observed in infected stems. With a stereoscope, white hyphae were noticed in the vascular region of infected plants. Stained cross sections of stems of wilted plants showed fungal hypha. A diseased plant sample was taken to the First Fungal Culture Bank of Pakistan (FCBP) for identification of the pathogen. Conidia appeared on potato dextrose agar after incubation in diurnal light, and were unicellular, smooth, thin-walled, and oval in shape (3 to 6 × 1 to 3 μm), forming aggregations on the tip of conidiophores. With the help of diagnostic keys and available literature, the isolated fungus was identified as Acremonium strictum W. Gams. The fungus formed whitish flat colonies with deposition of gum granules on its surface. Hyphae and phialides were hyaline and non-pigmented. Phialides with expanded bottoms were elongated measuring 25 to 40 μm and solitary in position at right angles to the filament. To further confirm identification, amplification of the ITS1 and ITS2 regions was performed with universal primers ITS1 and ITS4 (4). The ITS sequence obtained was submitted to NCBI as accession JQ916901. The culture was deposited in FCBP (1099), Institute of Agricultural Sciences, University of the Punjab, Pakistan. A pathogenicity test of the isolated fungus was performed by inoculating 15 healthy tomato plants cv. Rio Grande in three replicates. The spore suspension (2 × 105 conidia/ml of sterile distilled water) was prepared from 12-day-old cultures of the fungus grown from a single spore on PDA in continuous light. Control plants were treated with sterile distilled water. Tomato plants inoculated with the fungus started showing wilting symptoms within 2 weeks, while the control remained healthy. A. strictum was re-isolated from inoculated wilted plants, thus satisfying Koch's postulates. Previously, A. strictum was a reported cause of wilt in many plants including Chrysanthemum maximum (2), watermelon (1), and Gladiolous grandiflorus (3). To our knowledge, wilt in tomatoes has been reported only from Fusarium oxysporum and Pseudomonas solanacearum from Pakistan. To our knowledge, this is the first record of Acremonium wilt in this economically important crop.

First Report of Sclerotinia sclerotiorum Causing Sclerotinia Blight on Peanut (Arachis hypogaea) in Northeastern China.

Peanut, Arachis hypogaea L., is an important source of vegetable oil and protein in China with a planting area of 5 million ha and annual production of 16.2 million metric tons. In September of 2012, typical symptoms of Sclerotinia blight were first observed on peanut in Shuangcheng, Heilongjiang Province, China. Approximately 50% of the plants in a field were infected. Symptoms began as a chlorotic wilt on the foliage and developed into necrosis of basal stems and developed very quickly in the field. In advanced stages of the disease, stems and branches became bleached and eventually died. White, fluffy mycelium and black irregular sclerotia (3.5 to 5.4 mm diameter) were observed on the infected stems. Infected branches and pegs were shredded, and most pods dropped on the soil during harvest. To isolate the causal agent of the disease, sclerotia were collected from the field. Twenty sclerotia were surface disinfected in 1% NaOCl for 3 min, rinsed three times with sterile water, placed on potato sucrose agar (PSA) with 100 μg/ml streptomycin, and then incubated at 22°C in the dark for 10 days. Fungal DNA was extracted from mycelia with a TIANGEN DNAsecure Plant Kit (Beijing) and amplified by PCR with the universal fungal primer ITS1 and ITS4. PCR products of five replicates were sequenced and subjected to an NCBI BLAST search. The BLAST search revealed that our sequences (GenBank Accession No. KC935388) had 100% identity with reported sequences of Sclerotinia sclerotiorum. The isolates were identified as S. sclerotiorum (Lib.) de Bary based on mycelia, sclerotia, and rDNA sequence analysis. To conduct pathogenicity tests, nine potted peanut plants (1 month old) were each inoculated with a 5-mm-diameter disk of colonized PSA by placing the inoculum on the base of the stem. Plants were inoculated with a plug of non-colonized PSA as controls. All inoculated plants were covered with a plastic bag for 5 days to maintain high humidity and incubated at 22 to 24°C in the growth chamber with a 12-h photoperiod. After 2 days, the inoculated plants showed water-soaked brown symptoms on the stem base and whole plants wilted after 5 days under high moisture conditions. The symptoms were identical to those observed on peanut plants in Shuangcheng, Heilongjiang Province, whereas the control plants remained symptom-free. Re-isolation of the fungus from the inoculated plants confirmed that the causal agent was S. sclerotiorum. S. sclerotiorum has been reported on peanut in the United States and Argentina (1,2,3). To our knowledge, this is the first report of S. sclerotiorum as a pathogen causing Sclerotinia blight on peanut in northeastern China.

First Report of Leaf Spot in Farfugium japonicum Caused by Alternaria tenuissima in Korea.

Farfugium japonicum (L.) Kitam (common name: Leopard plant) is known as a medical herb and belongs to family Asteraceae (1). In June 2012, a leaf spot disease was observed on the leaf surface of F. japonicum at a forest research plot Jinju, Gyeongnam province, Korea. More than 95% of F. japonicum plants were infected and leaf spot symptom appeared in the regions under our investigation. Light brownish symptoms initially developed and the spot size gradually increased and turned dark brown with an irregular shape as the disease progressed (spot size 1 to 10 mm in diameter). At the late stage of disease, spots became hollow and completely dehydrated. The infected leaves were easily crumbled, possibly due to dryness. To isolate the causal agent, the infected leaves were surface disinfected and pieces of leaves were placed on water agar (WA). Nine isolates were isolated from 10 pieces of the infected leaves. Fungi mycelia from the WA were transferred on potato dextrose agar (PDA) and incubated at 28°C for 7 days. The colonies were purple navy to black and conidia spores developed on the media. The morphological characteristics of spores were multi-septate, dark brown, pyriform, and 6.7 to 12.8 × 22.2 to 38.4 μm. The spores had 1 to 4 transverse and 0 to 3 longitudinal septa. The morphological characteristics of the isolates showed considerably similar to well-known Alternaria tenuissima (2). The leaf spot disease caused by A. cinerariae of F. japonicum was reported from Japan (3). Spores of A. cinerariae are golden brown to brown with 3 to 9 transverse and 0 to 6 longitudinal septa and are 87.5 × 28.7 μm (avg.) (3). To verify pathogenicity of the isolate, the pure cultured fungi on the PDA medium was taken (4 mm in diameter) and placed on healthy leaves of Leopard plant. The artificially inoculated leaves were placed on wet filter paper in Petri dishes and incubated at 25°C and 80% humidity. At 7 days after inoculation, similar disease symptoms developed on 8 out of 10 infected Leopard plant leaves. The pathogen was reisolated from artificially infected leaves. To identify in molecular biology level, genomic DNA was extracted and the ITS-rDNA region was amplified using universal primers ITS1 and ITS4. The amplified PCR product was purified and sequenced (528 bp) with ITS1 and ITS4 primers for both directions and then deposited in GenBank (Accession No. KC415611.1). The BLAST search showed that it matched previously reported A. tenuissima with 100% identity. To the best of our knowledge, this is the first report of Leopard plant leaf spot disease in Korea.

First Report of Powdery Mildew Caused by Erysiphe cruciferarum on Brassica campestris var. pekinensis, B. carinata, Eruca sativa, E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia.

Inspection of field plantings of diverse cruciferous species, mainly oilseed varieties sown for agronomic assessment at Crawley, (31.99°S, 115.82°E), Western Australia, in September 2012, indicated the occurrence of extensive leaf and stem colonization by powdery mildew at the late flowering stage, with whitish patches 3 to 4 cm in length on stems of Brassica campestris var. pekinensis, B. carinata, B. oleracea var. capitata, B. rapa, Eruca sativa, and E. vesicaria. These patches coalesced to form a dense, white, powdery layer. Infected leaves showed signs of early senescence. Pathogenicity was demonstrated from transferring field inoculum from the most susceptible variety by pressing diseased leaves onto leaves of the six potted plant species, and incubating plants in a moist chamber for 48 hours post-inoculation (hpi) in an air-conditioned glasshouse approximating 25°C. Signs of powdery mildew were evident by 7 days post-inoculation (dpi), and well developed symptoms by 10 dpi and as observed in the field. Uninoculated control plants did not develop powdery mildew. On all inoculated species, abundant conidia typical of those produced by Erysiphe cruciferarum were observed, matching the descriptions of conidia given by Purnell and Sivanesan (3), with cylindrical conidia typically borne singly or in short chains. Mycelia were amphigenous, in patches, often spreading to become effused. Conidiophores were 3 to 4 cells, unbranched, and foot cells cylindrical. Across all host species, conidia were mostly produced singly with overall mean measured lengths 19.7 to 35.4 μm (mean 26.9 μm), and measured widths 7.1 to 12.9 μm (mean 9.7 μm), from measurements taken on 200 conidia for each of the six different species. Spore sizes measured approximated those found for E. cruciferarum by Kaur et al. (1) on B. juncea in Western Australia (viz. 21.2 to 35.4 × 8.8 to 15.9 μm), but were smaller than those reported by Purnell and Sivanesan (3) (viz. 30 to 40 × 12 to 16 μm) or by Koike and Saenz (1) (viz. 35 to 50 × 12 to 21 μm). We confirmed a length-to-width ratio >2 (mean range 2.7 to 2.8 across all six species) as found by both Purnell and Sivanesan (3) and Koike and Saenz (2). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene was carried out with universal primers ITS1 and ITS4 and PCR products from E. cruciferarum from B. oleracea var. capitata and B. rapa sequenced. BLAST analyses to compare sequences with those in GenBank showed a >99% nucleotide identity for E. cruciferarum. In Western Australia, E. cruciferarum has been recorded on B. napus var. napobrassica since 1971 (4), B. napus since 1986 (4), and on B. juncea since 2008 (1). In other regions of Australia, E. cruciferarum has been recorded on B. campestris, B. oleracea var. capitata, B. oleracea var. acephala, B. napus, B. napus var. naprobrassica, and B. rapa var. rapa. To the best of our knowledge, this is the first record of E. cruciferarum on B. campestris var. pekinensis, B. carinata, E. sativa, and E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia. Powdery mildew epidemics on other brassicas in Western Australia are generally sporadic and it remains to be seen what the impact of this disease will be on these new host species.

First Report of Cylindrocarpon sp. Associated with Root Rot Disease of Strawberry in North Carolina.

Strawberry (Fragaria × ananassa Duchesne) is an economically important fruit crop in North Carolina for domestic consumption and export. In April 2012, outbreaks of a destructive root disease were observed in strawberry cv. Chandler in Buncombe, New Hanover, and Roman counties, North Carolina. Samples from Rowan (ID 13175) and Buncombe (ID 13193) counties submitted to the Plant Disease and Insect Clinic of the Department of Plant Pathology, North Carolina State University, exhibited yellowing and wilting of leaves and extensive root necrosis, and disease severity based on field symptoms ranged from 20 to 30%. To identify the pathogen, five small pieces of necrotic crown and root tissues were taken from each sample, surface disinfested for 1 min in a 1.5% sodium hypochlorite solution, and plated onto potato dextrose agar (PDA) with 0.5 g liter-1 of streptomycin sulfate. Colonies developing from the tissue samples were transferred to PDA. Colonies from both samples were identical, grew relatively slowly, and gradually turned yellowish to partially brownish. After about 7 days, abundant conidia were formed. These were hyaline, mostly straight with both ends rounded, predominantly three septate, and 40 to 50 × 5 to 10 μm. Based on morphological characteristics, these isolates were identified as a species of Cylindrocarpon (1) To confirm the original identification of the fungus as a species of Cylindrocarpon, genomic DNA of both isolates was extracted from mycelia using DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA) and analyzed using PCR (2). The internal transcribed spacers (ITS)1 and (ITS)2 flanking the 5.8S rRNA regions were amplified and sequenced using universal primers ITS1 (forward) and ITS4 (reverse). The sequences of the 421 bp (GenBank KC847090 and KC847091) of both isolates were identical. Furthermore, a BLASTn search of these sequences showed homology of 99% with the sequences of Cylidrocarpon species (AB369421.1, AM419069.1, AM419074.1, AY295332.1, JN031017.1, JN253505.1, and JQ886422.1), To fulfill Koch's postulates, inoculum of each isolate was prepared and adjusted to 1.5 × 107 conidia/ml using a hemacytometer. 'Chandler' strawberry plants were grown in 25-cm diameter plastic pots (one seedling per pot) in the greenhouse and five 6-week-old plants were injected with conidia of each isolate into the base of crown using a 5-ml syringe. The plants were covered with clear plastic for 24 h and left on the greenhouse bench with a 16-h photoperiod and 25/20°C day/night temperatures and assessed for disease development 14 days after inoculation. The inoculated plants exhibited wilting and root necrosis, consistent with the symptoms observed on strawberry plants in the field. Control plants treated with distilled water remained healthy. Isolations were made from the inoculated plants and the fungus used for inoculation was recovered from all plants. The morphology of these isolates was in agreement with published descriptions of Cylindrocarpon (1). To our knowledge, this is the first report of a Cylindrocarpon sp. causing crown and root rot on strawberry in North Carolina and effective disease management strategies need to be explored.

First Report of Phytophthora palmivora Causing Fruit Rot of Fig (Ficus carica L.) in China

Fresh fig (Ficus carica L.) has been grown on a large scale in Beijing, China, since 2011. In late July 2012, a rot disease occurred on immature fruit of fig after a heavy rain (average daily rainfall 170 mm) in Fangshan District, Beijing, which caused about 30% incidence of green fruit on trees. The symptom first appeared as a water-soaked lesion that was covered with a white, fluffy mass of mycelia, followed by a soft, mushy rot of infected area on the fruit. To isolate the causal agent, mycelia and sporangia from 10 symptomatic fruits were suspended in sterile water, spread on potato dextrose agar (PDA) plates, and incubated at 25°C for 18 h. The isolates from each diseased fruit showed the same colonial characteristics. A single sporangium was isolated under a dissecting microscope and transferred onto PDA to obtain a pure culture. On carrot agar, the colony was white and homogeneous with tidy edge, with a few aerial hyphae. Sporangia were obpyriform with obvious papillae and measured 54.7 to 63.8 (59.3) × 26.5 to 36.3 (30.7) μm. The chlamydospores produced in culture were spherical. The pathogen was identified as Phytophthora palmivora based on the morphological characteristics (3) and confirmed with ITS sequences by PCR amplification using rDNA universal primers ITS1 and ITS4. The resulting sequence (Accession No. KC131229) had a 99% identity to that of P. palmivora (JQ354937) isolated from Pachira aquatica. Koch's postulates were conducted by inoculating six surface-sterilized figs with a PDA plug from a 7-day-old culture, with six noninoculated (PDA plugs only) fruits serving as controls. The inoculated fruits were incubated at room temperature in a plastic box covered with film. Symptoms similar to those on the naturally infected fruits began on wounded fruits 48 h after inoculation and on non-wounded fruits 60 h after inoculation, while the six control fruits remained healthy. P. palmivora was reisolated from the symptomatic fruit tissue. P. palmivora is one of the most severe pathogens on edible figs, being reported by Japanese in 1941 (2). Fruit rot of fig caused by the pathogen was reported in Florida in 1984 (1). To our knowledge, this is the first report of P. palmivora leading to fruit rot on fig in China.

English

The internal transcribed spacer (ITS) region of nuclear ribosomal DNA is the most frequently used marker for distinguishing plant species. Previously published polymerase chain reaction (PCR) primers available for amplifying the ITS region from environmental plant samples provide a high degrees of success while maintaining a broad range of compatibility difficult to discriminate against fungal DNA. Thus, the plant-specific ITS primer design is required to achieve the preferential amplification of plant DNA with discrimination against fungal DNA from environmental plant samples. In this study, two primers, ITS1-F2 and ITS4-R, were newly designed and the specificity of these primers were tested against 14 accessions of Pulsatilla tongkangensis and 2 accessions of Pulsatilla cernua. Our results showed that ITS4-R, when paired with either a universal primer ITS5 or the newly designed primer ITS1-F2, efficiently amplified DNA from environmental P. cernua samples and discriminated against parasitic fungal DNAs, while another newly designed primer ITS1-F2, when paired with either a universal primer ITS4 or ITS4-R, could not preferentially amplify plant DNA or discriminate against fungal DNA. For P. tongkangensis, the dismatch of ITS5 primer resulted in noneffective or wrong amplification when paired with either ITS4-R or ITS4, while ITS1-F2, when paired with ITS4-R and ITS4, efficiently amplified plant DNA and both plant and fungal DNAs, respectively. This result suggested that the combination with ITS1-F2 and ITS4-R were intended to be specific to Pulsatilla species. This study will be particularly useful for detection and analysis of plant sequences from environmental or fungus-associated materials. Key words: Pulsatilla, nrDNA ITS, plant-specific primer design, fungus-associated plant discrimination, molecular identification.

Leaf Spot on Lettuce (Lactuca sativa) Caused by Stemphylium solani, a New Disease in Malaysia.

In June 2011, lettuce (Lactuca sativa) plants cultivated in major lettuce growing areas in Malaysia, including the Pahang and Johor states, had extensive leaf spots. In severe cases, disease incidence was recorded more than 80%. Symptoms on 50 observed plants initially were as water soaked spots (1 to 2 mm in diameter) on leaves, and then became circular spots spreading over much of the leaves. In this research, main lettuce growing areas infected by the pathogen in the mentioned states were investigated and the pathogen was isolated onto potato dextrose agar (PDA). Colonies observed were greyish green to light brown. Single conidia were formed at the terminal end of conidiophores that were 28.8 to 40.8 μm long and 11.0 to 19.2 μm wide, and 2 to 7 transverse and 1 to 4 longitudinal septa. To produce conidia, the fungus was grown on potato carrot agar (PCA) and V8 juice agar media under 8-h/16-h light/dark photoperiod. Fourteen isolates were identified Stemphylium solani based on morphological criteria described by Kim et al. (1). To confirm morphological characterization, DNA of the fungus was extracted from mycelium and PCR was done using universal primers ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'), which amplified the internal transcribed spacer (ITS) region of rDNA (2). The sequencing result was subjected to BLAST analysis which was 99% identical to the other published sequences in the GenBank database (GenBank Accession Nos. AF203451 and HQ840713). The nucleotide sequence was deposited in GenBank under Accession No. JQ736022. Pathogenicity testing of representative isolate was done using 20 μl of conidial suspension with a concentration of 1 × 105/ml in droplets (three drops on each leaf) on four detached 45-day-old lettuce leaves cv. BBS012 (3). Fully expended leaves were placed on moist filter paper in petri dishes and were incubated in humid chambers at 25°C. The leaves inoculated with sterile water served as control. After 7 days, disease symptoms were observed, which were similar to those symptoms collected in infected fields and the fungus was reisolated and confirmed as S. solani based on morphological criteria (1) and molecular characterization (2). Control leaves remained healthy. Pathogenicity testing was completed twice. To our knowledge, this is the first report of S. solani on lettuce in Malaysia and it may become a serious problem because of its broad host range, variability in pathogenic isolates, and prolonged active phase of the disease cycle. Previous research has shown that S. solani is a causal agent of gray leaf spot on lettuce in China (4).

First Report of Stemphylium solani as the Causal Agent of a Leaf Spot on Greenhouse Cucumber.

During the 2011 to 2012 crop season, a severe leaf spot disease of cucumber (Cucumis sativus) cv. Cadiz was noticed on crops in some greenhouses in the Goudouras area, Lasithi, Crete, Greece. Symptoms appeared in late winter, mainly on the leaves of the middle and upper part of the plants. Initially, small necrotic pinpoint lesions with white centers, surrounded by chlorotic halos, 1 to 3 mm in diameter, appeared on the upper leaf surfaces, and these progressively enlarged to spots that could coalesce to form nearly circular lesions up to 2 cm or more in diameter. Stemphylium-like fructifications appeared on necrotic tissue of older lesions. Severely affected leaves became chlorotic and died. No other part of the plant was affected. Small tissue pieces from the edges of lesions were surface disinfected in 0.5% NaClO for 5 min, rinsed in sterile distilled water, plated on acidified potato dextrose agar and incubated at 22 ± 0.5°C with a 12-h photoperiod. Stemphylium sp. was consistently isolated from diseased samples. Colonies showed a typical septate mycelium with the young hyphae subhyaline and gradually became greyish green to dark brown with age. Conidiophores were subhyaline to light brown, 3- to 10-septate, up to 200 μm in length, and 4 to 7 μm in width, with apical cell slightly to distinctly swollen, bearing a single spore at the apex. Conidia were muriform, mostly oblong to ovoid, but occasionally nearly globose, subhyline to variant shades of brown, mostly constricted at the median septum, 22.6 ± 6.22 (11.9 to 36.9) μm in length, and 15.1 ± 2.85 (8.3 to 22.6) μm in width, with 1 to 8 transverse and 0 to 5 longitudinal septa. DNA from a representative single-spore isolate was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) was amplified using the universal primers ITS5 and ITS4. The PCR product was sequenced and deposited in GenBank (Accession No. JX481911). On the basis of morphological characteristics (3) and a BLAST search with 100% identity to the published ITS sequence of a S. solani isolate in GenBank (EF0767501), the fungus was identified as S. solani. Pathogenicity tests were performed by spraying a conidial suspension (105 conidia ml-1) on healthy cucumber (cv. Knossos), melon (C. melo, cv. Galia), watermelon (Citrullus lanatus cv. Crimson sweet), pumpkin (Cucurbita pepo, cv. Rigas), and sponge gourd (Luffa aegyptiaca, local variety) plants, at the 5-true-leaf stage. Disease symptoms appeared on cucumber and melon only, which were similar to those observed under natural infection conditions on cucumber. S. solani was consistently reisolated from artificially infected cucumber and melon tissues, thus confirming Koch's postulates. The pathogenicity test was repeated with similar results. In 1918, a report of a Stemphylium leaf spot of cucumber in Indiana and Ohio was attributed to Stemphylium cucurbitacearum Osner (4), but that pathogen has since been reclassified as Leandria momordicae Rangel (2). That disease was later reported from Florida (1) and net spot was suggested as a common name for that disease. For the disease reported here, we suggest the name Stemphylium leaf spot. This is the first report of a disease of cucumber caused by a species of Stemphylium.

A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc

Mango (Mangifera indica L.) a fruit of nutraceutical value is accepted as the most eatable fruit crop worldwide. Mango production has been severely affected by several biotic stress mainly diseases and anthracnose is the major post-harvest disease of mango results in heavy losses. The present investigation describes PCR based assay for rapid and sensitive detection of Colletotrichum gloeosporioides causing mango anthracnose. Genus specific universal primer pair ITS1 and ITS4 was employed to amplify Colletotrichum genus which shows 560 U bp amplicon. The Colletotrichum gloeosporioides species-specific sequences for conserved domains were retrieved from the NCBI Genbank (sequence HM10205) and specific primers were designed. In order to validate the speciesspecific designed primer, a sensitive nested PCR assay was carried out using designed primer-pair MKCgF 5` TTGCTTCGGCGGGTAGGGTC 3` (forward) and MKCgR 3`ACGCAAAGGAGGCTCCGGGA 5` (reverse) produced an amplicon size of 380 bp as specific. Our investigation revealed that C. gloeosporioides causal agent of mango anthracnose was discriminated on the basis of species as specific for mango in comparison to other Colletotrichum spp. viz. C. acutatum, C. falcatum and C. capsici causing anthracnose in other crops.

칠면초의 뿌리로부터 분리된 Fusarium solani에 의해 생산된 지베렐린 A4

Ten endophytic fungi with different colony morphologies were isolated from the roots of Suaeda japonica Makino growing naturally in Suncheon Bay. Plant growth promotion was verified by treating waito-c rice seedlings with culture filtrates from the endophytic fungi. The bioassays showed that the Sj/7/4 fungal strain induced effective growth promotion in the seedlings. The gibberellins (GA) produced by fungal strain Sj/7/4 were analyzed by gas chromatography /mass spectroscopy with selected ion monitoring (GC/MS SIM). The culture filtrate of Sj/7/4 fungal strain was confirmed to contain through quantitative analysis. The Sj/7/4 fungal strain was identified to determine the internal transcribed spacer (ITS) regions with universal primers ITS-1 and ITS-4 by using polymerase chain reactions (PCR). Molecular analysis of the Sj/7/4 fungal strain showed high similarity to Fusarium solani. The Sj/7/4 fungal strain isolated from the root of S. japonica was therefore designated as F. solani Sj/7/4.

Ethanol Production in Yeasts Isolated from Fermented Kitchen Waste

Microbial ethanol is a potential substitute for the non-renewable fossil fuel which is depleting. Yeasts have been long and extensively studied for ethanol production. The objectives of this study were to isolate yeasts from fermented kitchen waste and to determine their ethanol production performances. A number of fifteen yeasts were isolated from fermented kitchen waste. The yeastswere then grouped based on their ability to ferment different types of sugars. Three yeast isolates were selected for the analysis of ethanol production. Fermentation was carried out for 72 h in yeast extract peptone dextrose broth containing 18% glucose. Fourier transform infrared attenuated total reflection spectroscopy was used to monitor the ethanol production and glucose utilization. Isolate Y4 achieved the highest ethanol production at the level of 16%, while Y6 and Y8 demonstrated 12% and 11% ethanol yields, respectively. The isolates Y4, Y6 and Y8 were identified using universal fungal primers ITS1 and ITS4. The yeast isolates were closest to Saccharomyces cerevisiae (76%), Paracoccidioides brasiliensis (56%) and Saccharomyces boulardii (64%), respectively. This studyshowed that fermented kitchen waste could serve as a good source of yeasts for ethanol production.

FIRST REPORT OF BOTRYOSPHAERIA DOTHIDEA CAUSING FRUIT ROT OF QUINCE IN ITALY

In autumn 2011, a severe rot of fruits was observed in some quince (Cydonia oblonga Mill.) plants located in San Lorenzo Nuovo (province of Viterbo) and Frascati (province of Rome). Affected fruits showed rotting that evolved rapidly, covering their entire surface and causing mummification. Some mummified fruits dropped prematurely, although most of them persisted on the trees. No symptoms were observed on leaves or branches of the affected plants. A fungus consistently isolated from rotting fruits was identified as Fusicoccum aesculi Corda, the anamorph of Botryosphaeria dothidea Ces. et de Not., based on morphologi- cal characters (Sutton, 1980). The rDNA ITS regions of two fun- gal isolates, (ER1739, ER1757) one from each location, were am- plified by PCR using the universal primers ITS1 and ITS4. The sequences (GenBank accession No. JQ686227 and JQ686228) re- vealed 100% homology with those of 21 isolates of B. dothidea retrieved from GenBank, confirming the morphological identifi- cation. Koch’s postulates were verified on eight detached fruits from healthy C. oblonga trees. Seven days post inoculation with both fungal isolates, rotting initiated at the site of infection and expanded rapidly to the rest of the fruit. Non-inoculated controls remained healthy. Fruits rots and mummifications were similar to those observed in naturally infected trees in the field. The anamorph of B. dothidea was reisolated from all the inoculated fruits but not from the controls. B. dothidea is known to infect the fruits of several hosts, among which olive drupes (Lazzizzera et al., 2008), but this is the first time that it is identified as the ca- sual agent of fruit rot of quince in Italy.

First Report of Target Spot of Flue-cured Tobacco Caused by Rhizoctonia solani AG-3 in China.

In early August 2006, a disease caused severe losses in a 1,400-ha field of 5-month-old tobacco plants in Kuandian and Fengcheng Counties, Dandong City of Liaoning in northeast China. Symptoms were observed on almost every plant. Disease symptoms were subsequently observed at nearly 100% incidence in 2,000 ha of fields from three towns in Kaiyuan County and two towns in Xifeng County, Tieling City, Liaoning Province in the second half of August 2006. Symptoms first appeared on leaves as small (2 mm) water soaked spots, and developed into expanded, dark brown lesions (2 cm) on the middle to lower leaves. Each lesion exhibited concentric rings, a necrotic center, and a tear in the center and margin that often resulted in a shot-hole appearance. Fungal isolates were obtained from the margins of lesions that were surface-sterilized by dipping each leaf section into 75% ethyl alcohol for 3 sec, then in 0.1% HgCl2 for 15 sec, rinsing in sterilized distilled water three times, and plating the leaf section onto half-strength potato dextrose agar (PDA). Six isolates were identified as Rhizoctonia solani Kühn on the basis of mycelial characteristics: multinucleate cells, septate hyphae constricted at the junction of hyphae, and hyphal branching at approximately right angles (3). The sequence of the internal transcribed spacer (ITS) 1-5.8S-ITS2 region of rDNA from each of six isolates was amplified by PCR assay using universal primers ITS1 and ITS4. The sequences (GenBank Accession Nos. JQ219152 to JQ219157) matched 100% with the ITS sequence of an isolate of R. solani AG-3 (GQ885147). Koch's postulates were conducted for each of the six isolates by wound-inoculating six tobacco leaves (cv. NC89) detached from a total of three 8-week-old plants. Each tobacco leaf was first surface-sterilized in 0.5% NaOCl for 30 sec, rinsed in sterilized distilled water, and wounded at each of four locations by inserting a needle into the leaf. Each leaf was inoculated by depositing a PDA plug (0.5 cm diameter) colonized with R. solani onto each of the four wounds; wounded control leaves (six tobacco leaves from a total of three plants) were inoculated similarly with non-colonized PDA plugs. Inoculated leaves were incubated at 28°C in natural light within a plastic container covered with a hyaline cap to maintain high relative humidity. Symptoms similar to those observed on the original plants developed on inoculated leaves within 3 days, but not on the control leaves. The pathogen was reisolated from symptomatic leaves but not from control leaves and showed morphological characteristics consistent with those of R. solani. Tobacco target spot has been recorded in South America (1), South Africa (4), Argentina, and the USA (2). However, to our knowledge, this is the first report of target spot caused by R. solani AG-3 on flue-cured tobacco in China.

Canker on Bark of Populus spp. Caused by Cytospora tritici, a New Disease in China.

Species of Cytospora Ehrenb. and associated teleomorphs cause dieback and canker on over 85 species of angiosperm and gymnosperm plants throughout the world (2). Cytospora tritici Punith. was first observed on Triticum asetivum in Germany in 1980 but may also affect many hardwoods (3). During a survey of landscape trees in 2007, Populus spp. with cankers were found in Fushun, Baoxing, and Luding counties and Chengdu city in Sichuan Province. In these trees, bark canker pathogens discolored the sapwood. During damp weather, conidia were pushed out and formed orange spore horns. Conidiomatal stromata were immersed in bark, prominent, and 1.53 ± 0.33 mm in diameter (n = 10). Discs were white to grey, circular, oval, and 0.59 ± 0.14 mm in diameter (n = 10), with one ostiole per disc. Ostioles were dark grey. Locules were multi-chambered, chambers irregular. Conidia were lelongate-allantoid shaped, hyaline, aseptate, 5.04 ± 0.65 μm long (n = 50), and 1.22 ± 0.13 μm wide (n = 50). Fragments (5 × 5 mm2) of the junction of diseased and healthy tissues were surface sterilized with 1% NaOCl for 30 s and then rinsed twice in sterile distilled water. The pieces were placed on potato dextrose agar (PDA) plates and incubated at 25°C for 7 days. The obtained isolates were cultured on PDA at 25°C in diffuse fluorescent light for 30 days. Upon isolation, the mycelium grew at a rate of 3 to 5 mm per day at 25°C, forming pale white-to-pure white flat colonies. Conidiomata never formed on PDA. ITS1-5.8S-ITS2 sequences were amplified via PCR from genomic DNA obtained from mycelia using universal primers ITS1 and ITS4 (4). The amplification products showed 100% sequence homology with C. tritici isolate DQ243812 from the GenBank database. The ITS sequences were submitted to GenBank (Accession No. JQ277333 to JQ277336). Pathogenicity was confirmed by inoculating 20 disinfected (70% ethanol) Populus tomentosa cuttings. Cuttings were incubated at 25°C for 30 days. Another two cuttings were treated with water agar as controls. In 18 of the 20 cuttings, the cambium developed a brown color and appeared water soaked 15 days later, whereas controls did not develop any symptoms. C. tritici was reisolated from symptomatic tissues. To our knowledge, this is the first report of C. tritici in China causing canker on Populus spp. Cytospora canker is common in practically all countries where poplar are grown. Canker expansion increases when tree defenses are compromised, usually by seasonal dormancy but also by drought, cold injury of wood, sun scald of bark, flooding of root, hail, freezing, or other stress (1). Future spread of C. tritici to western China is considered highly likely.

First Report of Damping-off Caused by Alternaria japonica on Chinese Cabbage Seedlings in China.

In May 2011, samples of Chinese cabbage (Brassica campestris L. subsp. chinensis Markino) seedlings at the two-to four-leaf stage with damping-off symptoms were collected from greenhouses in the Tibet Autonomous Region of China. Infected stems of the seedlings were constricted at or near the soil surface. On diseased stems, a light to dark brown coloration was demarcated from healthy tissue. Damping-off and death of seedlings occurred as the lesions enlarged, resulting in a significant reduction of seedlings. Diseased stems were cut into 3-mm-long segments, surface-sterilized with 3.5% sodium hypochlorite for 1 min, and rinsed in sterilized water three times before being placed on water agar. A fungus frequently isolated from diseased plants was hyphal tipped under a dissecting microscope and transferred onto potato dextrose agar (PDA) to obtain a pure culture. The isolate grew slowly on PDA at 25°C with a 12-h photoperiod. The colony was white at first and gradually turned gray or grayish-green. No conidia or chlamydospores developed. However, conidia were produced on potato-carrot agar. Conidia were yellow-brown, obpyriform or obpyriform with beaks, had two to eight transverse septa, one to three vertical or oblique septa, and were produced solitarily or often in chains of two or three and measured 43.5 to 85.2 × 21.5 to 28.0 μm. A few conidia without beaks were also present and were nearly round and slightly smaller than the conidia with beaks. Several adjacent chlamydospores with thickened walls were often intercalary. The isolate was tentatively identified as Alternaria japonica based on its morphological characteristics (1,2). For molecular analyses, the internal transcribed spacer (ITS) regions of ribosomal DNA from the isolate were amplified with universal primers ITS1 and ITS4. The resulting sequence (Accession No. JN654465) submitted to GenBank had a 99% identity to that of A. japonica (Accession No. AY154703.1) isolated from leaves of Raphanus sativus. To confirm the pathogenicity of A. japonica, nine healthy 10-day-old Chinese cabbage seedlings were inoculated at the stem base with one PDA plug from a 6-day-old culture, with nine noninoculated (PDA plus only) seedlings serving as controls. Two days after inoculation, symptoms similar to those on the naturally infected plants developed on the inoculated seedlings. No symptoms developed on the controls. The pathogen was reisolated from the stems of inoculated and diseased seedlings. To our knowledge, this is the first report of A. japonica leading to damping off on Chinese cabbage seedlings in China.

First Report of Sarocladium oryzae Causing Sheath Rot on Rice (Oryza sativa) in Western Australia.

Rice (Oryza sativa L.) has been grown in the Ord River Irrigation Area (ORIA) in northern Western Australia since 1960. In 2011, a sheath rot of rice was observed in the ORIA. Symptoms were variable, appearing as either (i) oblong pale to dark brown lesions up to 3 cm length, (ii) lesions with pale grey/brown centers and with dark brown margins, or (iii) diffuse dark or reddish brown streaks along the sheath. Lesions enlarged and coalesced, often covering the majority of the leaf sheath, disrupting panicle emergence. Isolations from small pieces of infested tissues from plants showing sheath rot symptoms were made onto water agar, subcultured onto potato dextrose agar, cultures maintained at 20°C, and a representative culture lodged both in the Western Australian Culture Collection maintained at the Department of Agriculture and Food Western Australia (as WAC 13481) and in the culture collection located at the DAFF Plant Pathology Herbarium (as BRIP 54763). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to the published protocol (4). The DNA PCR products from a single isolate were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Sarocladium oryzae (Sawada) W. Gams & D. Hawksworth. Isolates showed morphological (e.g., conidiophore and conidia characteristics) (2) and molecular (1) similarities with S. oryzae as described in other reports. The relevant sequence information for a representative isolate was lodged in GenBank (GenBank Accession No. JQ965668). Spores of S. oryzae were produced on rice agar under "black light" at 22°C to induce sporulation over 4 weeks. Under conditions of 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest, grown for 11 weeks until plants reached the tillering stage, was inoculated by spraying a suspension 5 × 107 spores/ml of the same single isolate onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic cover for 72 h to maximize humidity levels around leaves and subsequently maintained under >90% relative humidity conditions. Symptoms of sheath rot as described in (i) and (ii) above appeared by 14 days after inoculation, with lesions up to 23 cm long by 15 days post-inoculation. Severe disease prevented young panicles from emerging. Infection studies were successfully repeated and S. oryzae was reisolated from leaf lesions 1 week after lesion appearance. No disease was observed on water-inoculated control rice plants. There have been records of S. oryzae on rice in New South Wales in the early 1980s (3) and in 2006 to 2007 (Australian Plant Pest Database), but to our knowledge, this is the first report of this pathogen in Western Australia.

First Report of Alternaria tenuissima Causing Leaf Spot on Eggplant in Malaysia.

A leaf spot on eggplant (Solanum melongena) was observed in major eggplant growing regions in Malaysia, including the Cameron Highlands and Johor State, during 2011. Disease incidence averaged approximately 30% in severely infected regions in about 150 ha of eggplant fields and greenhouses examined. Early symptoms consisted of small, circular, brown, necrotic spots uniformly distributed on leaves. The spots gradually enlarged and developed concentric rings. Eventually, the spots coalesced and caused extensive leaf senescence. A fungus was recovered consistently by plating surface-sterilized (1% NaOCl) sections of symptomatic leaf tissue onto potato dextrose agar (PDA). For conidial production, the fungus was grown on potato carrot agar (PCA) and V8 agar media under a 16-h/8-h dark/light photoperiod at 25°C (4). Fungal colonies were a dark olive color with loose, cottony mycelium. Simple conidiophores were ≤120 μm long and produced numerous conidia in long chains. Conidia averaged 20.0 × 7.5 μm and contained two to five transverse septa and the occasional longitudinal septum. Twelve isolates of the fungus were identified as Alternaria tenuissima on the basis of morphological characterization (4). Confirmation of the species identification was obtained by molecular characterization of the internal transcribed spacer (ITS) region of rDNA amplified from DNA extracted from a representative isolate using universal primers ITS4 and ITS5 (2). The 558 bp DNA band amplified was sent for direct sequencing. The sequence (GenBank Accession No. JQ736021) was subjected to BLAST analysis (1) and was 99% identical to published ITS rDNA sequences of isolates of A. tenuissima (GenBank Accession Nos. DQ323692 and AY154712). Pathogenicity tests were performed by inoculating four detached leaves from 45-day-old plants of the eggplant cv. 125066x with 20 μl drops (three drops/leaf) of a conidial suspension containing 105 conidia/ml in sterile distilled water. Four control leaves were inoculated with sterile water. Leaves inoculated with the fungus and those treated with sterile water were incubated in chambers at 25°C and 95% RH with a 12-h photoperiod/day (2). Leaf spot symptoms typical of those caused by A. tenuissima developed on leaves inoculated with the fungus 7 days after inoculation, and the fungus was consistently reisolated from these leaves. The control leaves remained asymptomatic and the pathogen was not reisolated from the leaves. The pathogenicity test was repeated with similar results. To our knowledge, this is the first report of A. tenuissima causing a leaf spot on eggplant in Malaysia. A. tenuissima has been reported to cause leaf spot and fruit rot on eggplant in India (3).

First Report of Rice Blast (Magnaporthe oryzae) on Rice (Oryza sativa) in Western Australia.

Commercial rice crops (Oryza sativa L.) have been recently reintroduced to the Ord River Irrigation Area in northern Western Australia. In early August 2011, unusual leaf spot symptoms were observed by a local rice grower on rice cultivar Quest. A leaf spot symptom initially appeared as grey-green and/or water soaked with a darker green border and then expanded rapidly to several centimeters in length and became light tan in color with a distinct necrotic border. Isolations from typical leaf lesions were made onto water agar, subcultured onto potato dextrose agar, and maintained at 20°C. A representative culture was lodged in the Western Australian Culture Collection Herbarium, Department of Agriculture and Food Western Australia (WAC 13466) and as a herbarium specimen in the Plant Pathology Herbarium, Plant Biosecurity Science (BRIP 54721). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 (4). The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae B.C. Couch, the causal agent of rice blast, the most important fungal disease of rice worldwide (1). Additional sequencing with the primers Bt1a/Bt1b for the β-tubulin gene, primers ACT-512F/ACT-783R for the actin gene, and primers CAL-228F/CAL-737R for the calmodulin gene showed 100% identity in each case with M. oryzae sequences in GenBank, confirming molecular similarity with other reports, e.g., (1). The relevant sequence information for a representative isolate has been lodged in GenBank (GenBank Accession Nos. JQ911754 for (ITS) 1 and 2; JX014265 for β-tubulin; JX035809 for actin; and JX035808 for calmodulin). Isolates also showed morphological similarity with M. oryzae as described in other reports, e.g., (3). Spores of M. oryzae were produced on rice agar under "black light" at 21°C for 4 weeks. Under 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest was grown for 7 weeks, and inoculated by spraying a suspension 5 × 105 spores/ml onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic covering for 72 h to maximize humidity levels around leaves, and subsequently maintained under >90% RH conditions. Typical symptoms of rice blast appeared within 14 days of inoculation and were as described above. Infection studies were successfully repeated and M. oryzae was readily reisolated from leaf lesions. No disease symptoms were observed nor was M. oryzae isolated from water-inoculated control rice plants. There have been previous records of rice blast in the Northern Territory (2) and Queensland, Australia (Australian Plant Pest Database), but this is the first report of M. oryzae in Western Australia, where it could potentially be destructive if conditions prove conducive.