Tyrosine tRNA Gene Research Articles

Molecular characterisation of the tyrosine tRNA genes of yeast

MANY of the tRNA genes of yeast are observable genetically as nonsense suppressors1. In particular, the set of unlinked suppressor loci SUP2 to SUP8 and SUP11 have been shown to insert tyrosine at nonsense codons in yeast iso-1-cytochrome c2,3. Direct biochemical evidence for the presence of suppressor tRNA in yeast strains bearing these suppressor genes has been obtained using in vitro translation systems4,5 and by the demonstration that a new minor tyrosine tRNA species with a suppressor anti-codon appears in a SUP5 strain6. Although these findings suggest that there are eight different loci in yeast which code for tRNAtyr, only a single nucleotide sequence has been observed for tyrosine tRNA in wild-type yeast strains7. Thus it seems that all eight genes may share a common base sequence, at least in their structural regions. Because the yeast tRNAtyr SUP genes occupy known positions on the genetic map8 and are complementary to a well characterised RNA molecule they are attractive candidates for molecular analysis. As a first step, we have labelled yeast tRNAtyr with 125I and have hybridised this probe to electrophoretically fractionated Eco RI fragments of yeast DNA; eight Eco RI fragments of different sizes hybridise to tRNAt yr.

Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends.

The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides.

The nucleotide sequence in the promoter region of the gene for an Escherichia coli tyrosine transfer ribonucleic acid.

The sequence of the first 29 nucleotides in the promoter region of a tyrosine tRNA gene has previously been determined (Sekiya, T., van Ormondt, H., and Khorana, H.G. (1975) J. Biol. Chem. 250, 1087-1098). This work has now been extended to give the sequence of a total of 59 nucleotides; the sequence is as follows: (see article). The general approach used in the determination of the sequence involved the DNA polymerase I-catalyzed elongation of synthetic deoxyribopolynucleotide primers hydridized to the l-strand of phi80psu+III DNA at the appropriate site. Sequencing of the newly added nucleotides was facilitated by the use of a number of techniques including (a) elongation of the primer with the use of all of the four nucleoside 5'-triphosphates but limiting the concentration of one of the triphosphates, (b) insertion of ribonucleotide units at appropriate sites so as to permit subsequent specific cleavages by pancreatic RNase, and (c) two-dimensional fingerprinting of the oligonucleotides in conjunction with partial exonucleolytic degradation, comprehensive nearest neighbor analyses, and the determination of pyrimidine tracts.

Promoter-dependent transcription of tRNAITyr genes using DNA fragments produced by restriction enzymes.

Two DNA fragments prepared from the transducing bacteriophage strains ø80psuIII+ and ø80hpsuIII+,- by digestion with restriction enzymes contain one tyrosine tRNA gene (suIII+) and two tyrosine tRNA genes (suIII+, su-) in tandem, respectively, a single promoter in both cases, and some additional DNA regions at the two ends of both. Using these fragments, we have studied characteristics of the promoter-dependent transcription of the tyrosine tRNA genes. The promoter-dependent transcripts were shown to correspond to the expected tRNA precursors. Exposure of the transcript from the single gene fragment to an S100 extract from Escherichia coli gave, via intermediates, 4S material which was active in enzymatically accepting tyrosine and contained some modified bases.

The nucleotide sequence in the promoter region of the fene for an Escherichia coli tyrosine transfer ribonucleic acid.

The sequence of 29 nucleotides in the region preceding the initiation of the transcription of the Escherichia coli tyrosine tRNA gene has been determined. This is: (5') ---GGGGCGCATCATATCAAATGACGCGCCGC--- (3') (3') ---CCCCGCGTAGTATAGTTTACTGCGGCGGCG--- (5'). The general approach used for the sequence determination involved the DNA polymerase I-catalyzed elongation of suitable deoxyribopolynucleotide primers when hybridized to the 1-strand of phi80psuIII plus DNA at the appropriate site. Sequences of the newly grown oligonucleotide chains were determined by a combination of two-dimensional fingerprinting following partial exonucleolytic degradation, nearst neighbor analyses, and determination of pyrimidine tracts. Primer elongations were carried out in a controlled and stepwise manner and the newly grown oligonucleotide chains were kept short by incorporating the following features into the method: (a) the insertion of a ribonucleotide unit at or near the 3' terminus of the primers; (b) the use of a maximum of three nucleoside 5'-triphosphates in the first stage of the elongation reaction isolation of the elongated primer, and its reuse in a second step together with different sets of deoxy-nucleoside triphosphates; and (c) elongation of the primer using all of the four nucleoside triphosphates with one of the triphosphates being supplied in a limiting concentration.

Phage phi80psu3+-directed tyrosine tRNA synthesis in Escherichia coli: effects of T4 phage superinfection on tyrosine suppressor-gene transcription.

Infection of Escherichia coli cells with the transducing phage φ80psu+3 causes phage‐dependent synthesis of su+3 tyrosine tRNA. This report describes the effect of superinfecting T4 phages on the expression of a single E. coli tRNA gene, namely the φ80 phage integrated su+3 tyrosine tRNA gene, and provides evidence that T4 phage‐induced alteration of the DNA‐dependent RNA polymerase is sufficient to stop E. coli gene transcription.1. The mutual effects of φ80psu+3 and T4 amN82 phages on their multiplication in E. coli BF266 are as follows: simultaneous infection results in a complete mutual inhibition of phage multiplication; T4 amN82 phage superinfection within 45 min after φ80psu+3 infection has the same result. T4 amN82 phage superinfection later than 45 min after φ80psu+3 phage infection does not affect φ80psu+3 phage multiplication. In all cases of superinfection no viable T4 amN82 phages could be detected, whereas the φ80psu+3 phages multiplied or survived without multiplication.2. The φ80psu+3‐dependent su+3 tyrosine tRNA synthesis is immediately and absolutely inhibited upon T4 amN82 phage superinfection. The cause of this inhibition is not a selective degradation of the φ80 phage‐incorporated su+3 tyrosine tRNA gene, since it could be demonstrated that φ80 phages isolated from lysates of φ80psu+3/T4 amN82 superinfected E. coli cells still carried the suppressor gene.3. The inhibition of φ80psu+3 phage‐dependent su+3 tyrosine tRNA synthesis upon T4 amN82 phage superinfection was also observed if the superinfection with T4 amN82 occurred during inhibition of protein biosynthesis.4. Superinfection of φ80psu+3 phage‐infected E. coli BF266 cells with T4 amN82 ghosts did not inhibit φ80psu+3 phage‐dependent su+3 tyrosine tRNA synthesis.5. The results described above provide evidence that the inhibition of φ80psu+3‐dependent su+3 tyrosine tRNA synthesis upon T4 amN82 phage superinfection is most likely caused by the T4 phage‐induced alteration of the E. coli DNA‐dependent RNA polymerase.

Nucleotide sequence in the promoter region of the Escherichia coli tyrosine tRNA gene.

The sequence of 29 nucleotides immediately preceding the starting point of transcription of the E. coli tyrosine tRNA gene has been determined. This is: [Formula: see text] The sequence contains regions of 2-fold symmetry. Transcription of the gene begins at the first nucleotide to the left of nucleotide 1 and is leftward.

Studies on Polynucleotides: THE LINKAGE OF DEOXYRIBOPOLYNUCLEOTIDE TEMPLATES TO CELLULOSE AND ITS USE IN THEIR REPLICATION

Abstract Poly(dT) with the average chain length of 80 nucleotides and containing 3'-phosphate end groups was condensed with cellulose by the use of a water soluble carbodiimide. The product, which contained free 5'-hydroxyl groups at the terminal thymidine residues, was phosphorylated using [γ-32P]ATP and the polynucleotide kinase. A synthetic deoxyribo-oligonucleotide segment corresponding to a portion of the Escherichia coli tyrosine tRNA gene (dC-C-C-CA-C-C) was extended at its 3'-OH end by growing a polythymidylate chain using deoxypolynucleotidyltransferase. The thymidine at the 3' end of this product was covalently linked to the 5'-phosphate end (32P-labeled) of the cellulose-linked polythymidylate by using polynucleotide ligase and poly(dA) as the template. Replication of the specific sequence dC-C-C-C-A-C-C in the above cellulose-linked polynucleotide was investigated by using a short (rA)n or poly(dA) as primers suitably hybridized to the poly(dT) region. The product of replication was readily separated from the template after denaturation and was characterized by nearest neighbor frequency analysis.

The Nucleotide Sequence Adjoining the CCA End of an Escherichia coli Tyrosine Transfer Ribonucleic Acid Gene

Abstract The sequence of 23 nucleotides beyond the C-C-A end of the Escherichia coli tyrosine tRNA gene has been determined. The previously deduced (Loewen, P. C., and Khorana, H. G. (1973) J. Biol. Chem. 248, 3489) sequence of the first 12 nucleotides (T-C-A-A-C-T-T-T-C-A-A-A) has been revised to T-C-A-C-T-T-T-C-A-A-A-A. The sequence of the next 11 nucleotides is G-T-C-C-C-T-G-A-A-C-T. The general approach used in the sequence work was the DNA polymerase-I-catalyzed elongation of suitable deoxyribopolynucleotides which served as primers when hybridized to the r-strand of φ80psuiii DNA. Five methods were used in the sequential analysis of the elongated primers: (a) the use of a restricted number of deoxyribonucleoside triphosphates; (b) timed incorporation of all of the four deoxyribonucleoside triphosphates and isolation of the pure radioactive products by polyacrylamide gel electrophoresis; (c) isolation of the products from timed incorporation of the dNTPs in which CTP replaced dCTP and Mn2+ replaced Mg2+; (d) separation of the fragments formed after alkaline hydrolysis by two-dimensional electrophoresis; (e) derivation of the nucleotide sequence after partial stepwise degradation by spleen and venom phosphodiesterases by two-dimensional finger-printing methods of Sanger and co-workers (Sanger, F., Donelson, J. E., Coulson, A. R., Kossel, H., and Fischer, D. (1973) Proc. Nat. Acad. Sci. U. S. A. 70, 1209).

A technique for mapping transfer RNA genes by electron microscopy of hybrids of ferritin-labeled transfer RNA and DNA: The- φ80hp su +,−III system

A method for mapping transfer RNA genes on single strands of DNA is described. tRNA is covalently coupled to the electron-opaque label, ferritin. The ferritinlabeled tRNA, Fer-tRNA, is hybridized to a single strand of DNA, or to a single- strand region of a DNA in a heteroduplex. The sites where the Fer-RNA binds to the complementary sequence on the DNA are then mapped by electron microscopy. Several alternative coupling procedures are described (see Fig. 1). In HzI a — COCH 2Br group is attached to ferritin by acylation. 3'-Oxidized tRNA is joined to HSRCONHNH 2 by hydrazone formation. Ferritin is then coupled to tRNA by reaction of the CBr and SH bonds. In the BI procedure a lysine amino group of ferritin is coupled by Schiff base formation with 3'-oxidized RNA. The conjugate is stabilized by borohydride reduction. In the BII procedure, a —COCH 2Br group is attached to ferritin. (H 2NCH 2CH 2S—) 2 is coupled to oxidized tRNA by Schiff base formation and borohydride reduction. An SH group is exposed by reduction. This HS-tRNA is coupled to a —COCH 2Br group attached to ferritin. All the procedures work but BII is recommended. Methods for purifying the Fer-tRNA and the Fer-tRNA-DNA hybrid are described. For the transducing phages, φ80hp su +,− III and φ80hp su − III, the DNA molecules each carry a piece of bacterial DNA of length 0·066±0·007 λ unit (3100 nucleotide pairs; we find the length of λ is 8·99 φX174 units) replacing a piece of phage DNA of φ80h of length 0·045±0·005 λ unit. The left junction of this bacterial DNA with phage DNA (referred to as P-B′) is at or close to the att site. The two tandem tyrosine genes of φ80hp su +,− III and the single tRNA gene of φ80hp su − III have been mapped at a position 1100 nucleotides to the right of the left ( P· B′) junction of phage DNA and bacterial DNA, by hybridizing Escherichia coli Fer-tRNA to φ80hp su III/φ80h heteroduplexes. The separation of the two ferritin labels in φ80hp su +,− III hybrids gives 140±20 nucleotides as the size of a single tyrosine tRNA gene.

Use of disomic strains to study the arrangement of ribosomal cistrons in saccharomyces of ribosomal cistrons inSaccharomyces cerevisiae

Disomic strains ofSaccharomyces cerevisiae were studied by DNA-rRNA hybridization to examine the arrangement of rRNA cistrons on yeast chromosomes as well as to identify a disomic strain which was enriched for rRNA cistrons. Four of the five disomic strains tested showed a per cent hybridization lower than wild type. Two of these strains were found to be disomic for more than one chromosome. A slight increase in the per cent hybridization was observed with DNA isolated from one disomic strain. It was concluded that some chromosomes inSaccharomyces cerevisiae had few if any rRNA cistrons suggesting that the rRNA cistrons are non randomly distributed over the genome. From DNA-tRNA hybridization experiments, evidence for the presence of tyrosine tRNA genes on chromosomes VI was obtained.

Duplicate genes for tyrosine transfer RNA in Escherichia coli

Genetic and biochemical studies of Escherichia coli and the new transducing phage φ80p su III + have been used to characterize the tRNA genes of E. coli. The transducing phage stimulates the production of both su III + and su III − tyrosine tRNA upon infection, and in hybridization experiments its DNA is saturated with 1.4 tyrosine tRNA molecules per genome. One of its derivatives, selected for its genetic properties, stimulates only su III + tyrosine tRNA, and its DNA is saturated by 0.6 tyrosine tRNA molecule per genome. We conclude that the original phage carries two tyrosine tRNA genes, one su III + and one su III −, while the derivative carries a single su III + gene. The single-gene derivative apparently arises by unequal recombination involving the two genes of the original phage; the reciprocal recombination product, carrying three tyrosine tRNA genes, is also detected. Entirely analogous single-gene and three-gene derivatives of E. coli are found, and we conclude that E. coli normally carries a pair of closely-linked genes specifying its minor, or su III tyrosine tRNA.