Typical Bacterial Blight Research Articles

First Report of Bacterial Blight of Pomegranate Caused by Xanthomonas axonopodis pv. punicae in Turkey.

Pomegranate (Punica granatum L.) is an increasingly important fruit crop that is widely cultivated in Turkey. Typical bacterial blight symptoms were observed since spring of 2011 in pomegranate orchards located in Antalya Province. Symptoms were characterized by dark brown, angular to irregularly shaped spots on leaves and fruit; cankers on stems, branches, and trunks; and split trunks. The pathogen was isolated from leaf spots on naturally infected plants showing typical symptoms onto yeast dextrose chalk agar. Bright yellow bacterial colonies were consistently isolated. Bacterial strains were characterized as gram negative, oxidase negative, catalase positive, tobacco hypersensitivity positive, and able to produce acid from L-arabinose, D-galactose, D-glucose, and D-mannitol but not from D-xylose. Pathogenicity of the representative bacterial strain Serik-4 was performed on 2-year-old pomegranate plants cv. Hicaz. Leaves were sprayed until runoff with bacterial cell suspensions containing 107 CFU/ml. Inoculated plants were covered with transparent plastic bags to maintain moisture for 48 h. Negative control plants were inoculated with sterile distilled water. Plants were then incubated in a greenhouse at 30°C for 14 days. Symptoms on leaves included dark brown, angular to irregularly shaped water soaked lesions along the veins of the inoculated plants 10 days after inoculation. No lesions developed on the control plants. The symptoms on inoculated plants were similar to those on naturally infected plants. Yellow bacterial colonies were re-isolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis, thus fulfilling Koch's postulates. Fatty acid methyl ester profiling of the representative strain Serik-4 using GC-MIDI (Microbial Identification Inc, Newark, DE) identified the genus of the bacterium as Xanthomonas. The identity of Serik-4 was further confirmed by amplifying the 16S rRNA gene with the universal primers 27F and 1492R (3) and sequence analysis (GenBank Accession No. KM007073). The 16S rRNA gene sequences of Serik-4 was 99% identical to the corresponding gene sequences of the Xanthomonas axonopodis pv. punicae strain present in the NCBI database (JQ067629.1). High incidence of bacterial blight caused by X. axonopodis pv. punicae on pomegranate has been previously reported in India (2), Pakistan (1), and South Africa (4). To our knowledge, this is the first report of bacterial blight on pomegranate caused by X. axonopodis pv. punicae in Turkey.

First Report of Bacterial Blight of Sugar Beet Caused by Pseudomonas syringae pv. aptata in Georgia, USA.

Sugar beet (Beta vulgaris L.) is not currently a commercial crop in Georgia, but experimental plantings as a winter rotational crop are promising in terms of yield and industrial sugar production (T. Brenneman, personal communication). A disease outbreak of suspected bacterial origin occurred in sugar beet plots (experimental lines Beta Seed energy beet 'BTS ENC115,' 'BTS EGC184,' 'BTS EGC195,' and 'BTS 1EN6702') in Tift Co., GA, in December 2012, at ~35% incidence. Foliar symptoms included circular to irregular spots, each with a tan center and dark margin. Ten leaves/experimental line with leaf spot symptoms were collected, and bacterial isolations made on King's B agar medium. After 48 h of incubation, cream-colored, fluorescent yellow, round colonies with smooth margins were isolated. The isolates were each gram negative, oxidase negative, non-pectolytic on potato, arginine dihydrolase negative, produced levan, and gave a hypersensitivity response (HR) on tobacco. These characteristics indicated that the isolates belonged to Pseudomonas syringae van Hall LOPAT group Ia (3). The 16S-23S rRNA (internal transcribed regions) (1) from four foliar isolates (SB-1, SB-2, SB-3, and SB-4), one/experimental line, was amplified, and the resultant PCR products were sequenced and BLAST searched in GenBank. The 16S-23S rRNA sequences matched those of P. syringae pv. syingae (Pss) (KF023189) and P. syringae pv. aptata (Psa) (AY342167.1) with 96 to 98% and 97 to 99% sequence identity, respectively. Also, the percent similarity of the 16S-23S rRNA sequences among the four isolates was >99% (KJ922021 to 24 for SB-1 to SB-4, respectively). The four test isolates also had ≤89 and ≤99% similarity with Pss and Psa, respectively, when tested with BIOLOG (Hayward, CA). In addition, four sugarbeet isolates along with a type strain of Psa (NCPPB 3539) were amplified using a PCR primer pair that detected the presence of the avrPphE gene, an avirulence gene present in Psa but absent in Pss (2). The type strain of Pss (NCPPB 1770) was not amplified using this primer pair. BOX-PCR analysis gave identical banding patterns for the four isolates as that of a type strain of Psa. In two independent experiments, 3-week-old seedlings of the sugar beet cv. Beta EGR099 (n = 10 seedlings/isolate/experiment) were spray-inoculated with a sterilized water suspension of 1 × 108 CFU/ml of each of the isolates. All of the inoculated seedlings developed symptoms (water-soaked lesions that developed into necrotic spots) 10 days after inoculation (DAI) in greenhouse conditions (~30°C and ~80% RH). All of the seedlings inoculated with the type strain of Psa also produced typical bacterial blight symptoms at 10 DAI. In contrast, five control seedlings inoculated with sterilized water remained asymptomatic, and target bacterial colonies were not re-isolated from the leaves of these plants. Bacterial colonies were re-isolated from symptomatic seedlings, and showed similar characteristics based on physiological tests, BIOLOG profile, BOX-PCR analysis, and positive amplification with the avrPphE PCR assay, which indicated that these strains were Psa. To our knowledge, this is the first report of Psa in sugarbeet in Georgia. The fact that a Psa strain was also isolated from a sugar beet seed lot (data not shown) suggested that the pathogen may have been introduced on contaminated seeds. Knowledge of the presence of Psa in the agro-ecosystem of Georgia may encourage scientists to implement integrated management practices for this pathogen.

Biochemical Approach for Virulence Factors’ Identification in Xanthomonas Oryzae Pv. Oryzae

Bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo) leads to a substantial yield reduction of up to 50% in most rice-growing regions. Host plant resistance is an effective control method, and more than 30 resistance genes have been identified in rice genotypes. To understand the interaction of the pathogen in a susceptible reaction of the host plant, Xoo culture filtrate and treated culture filtrates were used to treat two rice genotypes using four strains Mai1, PXO88, Dak1 and Dak16. The study revealed that Xoo culture filtrate, heated culture filtrate and proteinase K treated culture filtrate induced typical bacterial blight symptoms on rice genotypes IRBB4 and FKR14 with a maximum lesion length of about 23.1 cm for culture filtrate. Heated culture filtrate phytotoxicity effects on both rice genotypes was with highest lesion length of about 6.9 cm, while 13.4 cm was the maximum length induced by a proteinase K treated fraction. After ethyl acetate treatment of the culture filtrate, a considerable reduction of the phytotoxicity was observed. Therefore we suggest that a low molecular-weight toxin may be present in the ethyl acetate extract should not play a major role in Xoo virulence and speculate that EPS, Xylanase, polygalacturonase, proteinaceouse contribute to Xoo virulence.

Variation in disease development among persian walnut cultivars, selections and crosses when inoculated with Xanthomonas arboricola pv. juglandis in Greece.

A total of 27 walnut (Juglans regia) cultivars (14 lateral and 13 terminal fruit fullness cultivars), 12 selections and 12 crosses were evaluated for their resistance to the walnut blight bacterium Xanthomonas arboricola pv. juglandis. Healthy nuts were inoculated with pure bacterial cultures isolated from diseased nuts. Two weeks after inoculation, the frequency of successful infections, as well as the disease severity was recorded and the index of varietal susceptibility (IVS) was calculated for each treatment. Based on these results walnut cultivars, selections and crosses were ranked in five classes of susceptibility (A to E). The experiment was repeated for two consecutive years, 2007 and 2008. Results showed that all the artificially infected nuts showed typical bacterial blight symptoms as compared to the negative control. Among the cultivars tested Amigo, Asley, Eliana, Franquette and Spurgcan were the less susceptible with average IVS ranging from 13.1 to 24.4, therefore ranked as class A. Walnut selections EK1, EH29 and FM16, as well as crosses PZ-14 and FxH5 also showed low susceptibility. In contrast, the terminal fruit fullness cv. Milotai and the cross S3/1 were highly susceptible and ranked as class E.

English

Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host. Loss due to this disease was estimated for about 10 to 30% on Iranian native cultivars. During summer season, cotton leaves samples with typical bacterial blight symptoms were collected from cotton fields of Golestan province in 2004. Among different bacterial isolates, five distinct Xcm isolates were collected for further studies. Besides, 20 partially characterized Xcm strains were obtained from Iranian Plant Protection Organization for comparison purpose. Totally 25 strains were subcultured for further characterization based on morphological, biochemical, pathogenicity traits as well as genetic analyses. Among these, nine strains with distinct phenotypic characteristics were selected for complementary genetic studies. Sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) protein analysis did not show any differences among strains in number and size of protein bands. In plasmid analysis, using alkaline lysis method, a single plasmid was detected for all examined isolates with molecular weight of 23 kb. Repetitive sequence based PCR (rep-PCR) fingerprinting assay using primer BOX AIR (5' CTACGGCAAGGCGACGCTGAC 3') also failed to differentiate the Iranian isolates. It was therefore concluded the strains might have the same origin. Key words: Cotton bacterial blight, protein analysis, plasmid and repetitive sequence based PCR (rep-PCR).

First Report of Bacterial Blight of Crucifers Caused by Pseudomonas cannabina pv. alisalensis in Australia.

In 1978 and 1979, Pseudomonas syringae pv. maculicola strains DAR 33362, DAR 33363, and DAR 33406 were isolated from diseased Brassica hirta, B. nigra, and B. napus var. napus, respectively, in Wagga Wagga and Armatree, NSW, Australia (2). Peters et al. (2) demonstrated that these strains were similar to P. syringae pv. maculicola ICMP 4326 (CFBP 1637), which was recently transferred to Pseudomonas cannabina pv. alisalensis (1). We evaluated these Australian strains to determine if they might also be P. cannabina pv. alisalensis. Amplification of DNA using the BOXA1R primer and PCR resulted in identical DNA fragment banding patterns for Australian strains DAR 33362 and DAR 33363 and P. cannabina pv. alisalensis ICMP 4326 and CFBP 6875. The third Australian strain, DAR 33406, was 90% similar to P. cannabina pv. alisalensis; in contrast, it was only 77% similar to P. syringae pv. maculicola. All strains of P. cannabina pv. alisalensis, including the pathotype strain (CFBP 6866) and all three Australian strains, were lysed by bacteriophage PBS1, which is specific for P. cannabina pv. alisalensis strains (1). To complete Koch's postulates, pathogenicity was evaluated on B. hirta, B. nigra, and B. napus var. napus. In two independent experiments, two plants of each species were inoculated with each Australian strain or a phosphate buffer control treatment. In separate experiments, pathogenicity was evaluated on the differential hosts radish (Raphanus sativus cv. Comet) and broccoli raab (Brassica rapa cv. Sorrento), and plants inoculated with the pathotypes of P. cannabina pv. alisalensis and P. syringae pv. maculicola served as additional control treatments. Inoculum was prepared by growing the bacteria on nutrient agar for 48 h (27°C), suspending the bacteria in 0.01 M phosphate buffer (pH 7.0), and adjusting each suspension to 0.6 OD at 600 nm (approximately 108 CFU/ml). Treatments were applied by spraying until runoff. DAR 33362, DAR 33363, and DAR 33406 caused typical bacterial blight symptoms on B. hirta, B. nigra, and B. napus var. napus. Infected leaves became yellow, followed by the development of small (<2 mm in diameter), angular, water-soaked, and eventually, shot-holed spots. Bacteria isolated from symptomatic tissue following surface disinfestation of tissue with sodium hypochlorite (0.525%) had identical characteristics (rep-PCR DNA fragment banding patterns and phage sensitivity) to the strains used to inoculate the plants. Additionally, DAR 33362, DAR 33363, and DAR 33406, as well as P. cannabina pv. alisalensis, caused symptoms on radish and broccoli raab while P. syringae pv. maculicola and the buffer control did not. These data support the transfer of the Australian crucifer strains, originally identified as P. syringae pv. maculicola, to P. cannabina pv. alisalensis. To our knowledge, this is the first report of a bacterial disease of crucifers caused by P. cannabina pv. alisalensis in Australia. Differentiation of these pathogens will inform crop rotation strategies for disease management.

First Report in Mauritius of Bacterial Leaf Blight of Syngonium Caused by Xanthomonas campestris pv. syngonii

In November of 2006, necrotic leaf lesions with water-soaked margins were observed on Syngonium podophyllum in Floréal, Forest Side, and Réduit, Mauritius. Although not an economically important crop, the disease was of concern because syngonium is a host for Xanthomonas axonopodis pv. dieffenbachiae and the anthurium industry is of major economic importance in Mauritius. X. campestris pv. syngonii, described as the causal agent of bacterial leaf blight of syngonium (2), is genetically closely related to group 9.4 X. axonopodis pv. dieffenbachiae strains (3). In contrast to X. axonopodis pv. dieffenbachiae, X. campestris pv. syngonii strains are highly virulent on syngonium but are not pathogenic on anthurium or other Araceae, but both react similarly to the Xcd108 monoclonal antibody (Mab) (Agdia Inc., Elkhart, IN) and to a nested PCR assay designed for X. axonopodis pv. dieffenbachiae (4). X. axonopodis pv. dieffenbachiae and X. campestris pv. syngonii strains can be distinguished on the basis of restriction analysis of the amplicon of this PCR assay. Four pure cultures isolated from S. podophyllum were gram negative, yellow pigmented, and produced mucoid colonies on yeast peptone glucose agar (YPGA). One positive control strain of X. campestris pv. syngonii (LMG 9055 from the United States) and X. axonopodis pv. dieffenbachiae (LMG 695 from Brazil) were also used for all tests. All strains reacted positively with the Xcd108 MAb using indirect ELISA. DNA from all strains was amplified by the nested PCR assay, and the HincII restriction pattern of the amplicons identified strains from Mauritius as X. campestris pv. syngonii. Pathogenicity tests were performed on 8-month-old plants of Anthurium andreanum cv. Florida, Dieffenbachia maculata cv. Tropic Marianne, and S. podophyllum cv. Robusta by infiltrating suspensions containing ~1 × 105 CFU ml¯1 of each strain prepared from YPGA plates. Each strain was inoculated onto three young leaves (four inoculation sites per leaf) on two plants. Negative control plants received sterile Tris buffer solution (10 mM, pH 7.2). Plants were maintained in a growth chamber with day and night temperatures at 30 ± 1°C and 26 ± 1°C, respectively, 95 ± 5% relative humidity, 30 μmol·m¯2·s¯1 light intensity, and a photoperiod of 12 h (4). All strains caused typical water-soaked lesions 14 days after inoculation (dai) on syngonium. Lesions turned necrotic with chlorotic margins 27 to 34 dai. Typical bacterial blight lesions were observed on anthurium leaves inoculated with X. axonopodis pv. dieffenbachiae strain LMG 695, but no symptoms were observed 60 dai when strains from Mauritius and LMG 9055 were used. Amplified fragment length polymorphism analysis of four strains from Mauritius and additional reference, X. axonopodis pv. dieffenbachiae and X. campestris pv. syngonii strains, using SacI/MspI and four primer pairs (unlabeled MspI+1 [A, C, T, or G] primers and 5'-labeled-SacI+C primer for the selective amplification step) (1), showed that the strains from Mauritius could be distinguished from X. axonopodis pv. dieffenbachiae but were identical to X. campestris pv. syngonii strains from the United States and Réunion Island.

Occurrence of White Top of Pea Caused by a New Strain of Pseudomonas syringae pv. pisi.

A new bacterial disease has been observed on pea in Shizuoka prefecture, Japan, since 1981. The disease occurs in early autumn when pea plants grow vigorously. The disease is characterized by chlorosis and whitening of apical shoots, including leaflets, stipules, and young pods. Usually, these white top (WT) symptoms are associated with extensive water-soaked lesions on stems and on leaflets at the basal part of the diseased plants. Thirty-four bacterial isolates from WT plants were characterized and identified together with 16 strains of Pseudomonas syringae pv. pisi from common bacterial blight of pea. The bacteria were gram-negative rods, having one to six polar flagella. The results of LOPAT tests were + - - - +, showing that they belong to P. syringe. In stab inoculation on stems, the WT isolates produced WT symptoms with water-soaked spots 14 days after inoculation. The 16 P. syringae pv. pisi strains never induced WT symptoms and, on the contrary, caused the typical bacterial blight. WT isolates were not pathogenic on any other plants tested. Phenotypic properties differentiated WT isolates and P. syringae pv. pisi strains into two groups; one consists of WT isolates and P. syringae pv. pisi group A, the other is P. syringae pv. pisi group B. Two distinct fingerprint profiles were identified by repetitive sequence based-polymerase chain reaction. WT isolates and P. syringae pv. pisi group A belonged to the same fingerprint type in rep-PCR, whereas a distinct fingerprint was shown by strains of the P. syringae pv. pisi group B. We concluded that the WT isolates should be included in P. syringae pv. pisi as a distinct strain in symptom expression.

Interactions of Pseudomonas syringae pv. glycinea with host and nonhost plants in relation to temperature and phytotoxin synthesis.

Pseudomonas syringae pv. glycinea PG4180 causes bacterial blight of soybean and produces the phytotoxin coronatine (COR) in a temperature-dependent manner. COR consists of a polyketide, coronafacic acid (CFA), and an amino acid derivative, coronamic acid, and is produced optimally at 18 degrees C whereas no detectable synthesis occurs at 28 degrees C. We investigated the impact of temperature on PG4180 during compatible and incompatible interactions with soybean and tobacco plants, respectively. After spray inoculation, PG4180 caused typical bacterial blight symptoms on soybean plants when the bacteria were grown at 18 degrees C prior to inoculation but not when derived from cultures grown at 28 degrees C. The disease outcome was quantified by determination of bacterial populations in planta. The temperature effect was not observed when PG4180 was artificially infiltrated into soybean leaves, indicating that the pre-inoculation temperature and phytotoxin synthesis were important for bacterial invasion via natural plant openings. In the incompatible interaction, PG4180 elicited the hypersensitive response (HR) on tobacco plants regardless of the bacterial pre-inoculation temperature. However, the HR was significantly delayed when tobacco plants were treated with cells of the CFA-overproducing derivative, PG4180.N9, which were derived from cultures grown at 18 degrees C, compared with parallels incubated at 28 degrees C. CFA biosynthesis by PG4180.N9 was optimal at 18 degrees C and negligible at 28 degrees C. The impact of CFA synthesis on the HR was studied with different growth media, mutants, and transconjugants of PG4180, indicating that the amount of synthesized CFA but not that of COR influenced the outcome of the HR. Feeding experiments with purified coronafacoyl compounds suggested that the observed delay of the HR was mediated by CFA, shedding further light on CFA's putative role as a molecular mimic of the plant signaling molecule, jasmonic acid.

Multiplication of Xanthomonas campestris pv. Phaseoli and Intercellular Enzyme Activities in Resistant and Susceptible Beans

AbstractIn order to assess resistance to common bean blight, populations of two isolates of Xanthomonas campestris pv. phaseoli were monitored in leaves of two Phaseolus vulgaris breeding lines, BLT87‐2 (susceptible) and OAC88‐1 (partially resistant) and a resistant tepary bean accession, P. acutifolius P. I. 440795. The breeding line OAC88‐1 possesses resistance to common bacterial blight which was incorporated from P. acutifolius by an interspecific cross. In susceptible, leaves, bacterial populations increased to 108 CFU/g leaf at 3 wk after inoculation whereas, in resistant leaves, bacterial populations declined to 101 ‐ 103 CFU/g leaf. In partially resistant leaves the population first declined similar to that in resistant P. acutifolius but later increased, and typical bacterial blight symptoms appeared. Cellulase, protease and amylase activities were monitored in culture and intercellular leaf spaces. Only cellulase activity was, clearly related to bacterial growth in the susceptible host; other enzyme activities were variable in their relationship to host resistance and bacterial growth. Differences between strains in cellulase activity inside partially resistant leaves corresponded to their ability to secrete cellulase in culture. Measuring cellulase activity in intercellular wash fluids may be a simple and sensitive method for determining X. c. phaseoli populations in leaves.