Abstract
Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host. Loss due to this disease was estimated for about 10 to 30% on Iranian native cultivars. During summer season, cotton leaves samples with typical bacterial blight symptoms were collected from cotton fields of Golestan province in 2004. Among different bacterial isolates, five distinct Xcm isolates were collected for further studies. Besides, 20 partially characterized Xcm strains were obtained from Iranian Plant Protection Organization for comparison purpose. Totally 25 strains were subcultured for further characterization based on morphological, biochemical, pathogenicity traits as well as genetic analyses. Among these, nine strains with distinct phenotypic characteristics were selected for complementary genetic studies. Sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) protein analysis did not show any differences among strains in number and size of protein bands. In plasmid analysis, using alkaline lysis method, a single plasmid was detected for all examined isolates with molecular weight of 23 kb. Repetitive sequence based PCR (rep-PCR) fingerprinting assay using primer BOX AIR (5' CTACGGCAAGGCGACGCTGAC 3') also failed to differentiate the Iranian isolates. It was therefore concluded the strains might have the same origin. Key words: Cotton bacterial blight, protein analysis, plasmid and repetitive sequence based PCR (rep-PCR).
Highlights
Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host
Xanthomonas citri subsp. malvacearum (Xcm), the causal agent of bacterial blight of cotton (Gossypium spp.) is one of the most devastating bacterial diseases which starts as angular leaf spot followed by black canker on stems and boll rot that consequences in discolored lint and infested seeds which are the main source of pathogens transmission (Innes, 1983)
All yellow-colored colonies were isolated from cultured media and individual colonies were purified and stored on yeast dextrose chalk (YDC) medium
Summary
Xanthomonas citri subsp. malvacearum (Xcm), the causal agent of bacterial blight of cotton (Gossypium spp.) is one of the most devastating bacterial diseases which starts as angular leaf spot followed by black canker on stems and boll rot that consequences in discolored lint and infested seeds which are the main source of pathogens transmission (Innes, 1983). Malvacearum (Xcm), the causal agent of bacterial blight of cotton (Gossypium spp.) is one of the most devastating bacterial diseases which starts as angular leaf spot followed by black canker on stems and boll rot that consequences in discolored lint and infested seeds which are the main source of pathogens transmission (Innes, 1983). The genome diversity of bacterial plant pathogens including Xanthomonas is widely studied with PCR-based methods to point detection, genotypic characterization, ecological distribution and evolutionary process By analyzing these data, the control and management of the disease would be improved (Goncalves et al, 2000; Robertson et al, 2001). The high degree of preservation was observed among DNA plasmid sequence in some pathovars (Lazo and Gabriel, 1984)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
