Syndactyly Type Research Articles

Evaluation of hexagonal flap for Syndactyly repair

Background and objective: Syndactyly is among the most commonly treated hand anomalies by plastic surgeons. Since the 1800s,over 46 corrective procedures have been described. These techniques involve using different flap designs and full-thickness skin graft or depending on graftless techniques to achieve the goals. Some articles concluded that graftless techniques have shorter operative times and fewer postoperative complications. The aim of the study is to evaluate the use of a local "hexagonal" dorsal advancement flap (HDAF) for syndactyly repair without using a skin graft. Methods: Between March 2021 and March 2022, we operated on 18 subjects (25 web spaces) in Rizgary and Hawler teaching hospitals in Erbil. Our study subjects were children and adults with different types of syndactyly (congenital, recurrent, and post-burn). We studied the early outcomes of using HDAF and straight-line incision for syndactyly repair. Results: The patients' ages ranged from 1.5 to 50 years, and the mean follow-up period was 6.3 months (1-13 months). The mean operation time was 98.5 minutes (40-160 minutes). Wounds were closed primarily without skin graft in 96% of the cases. We encountered neither a flap loss nor recurrences of syndactyly. The mean abduction angle achieved was 36.5º. All patients and their caregivers were satisfied with the aesthetic outcome. Conclusion: Syndactyly repair using a hexagonal dorsal advancement flap and straight-line separation of the fingers is a safe and straightforward technique regardless of age and syndactyly class or type. It results in a relatively short procedure with good-looking and well-functioning fingers.

The pathogenic mechanism of syndactyly type V identified in a Hoxd13Q50R knock-in mice

Syndactyly type V (SDTY5) is an autosomal dominant extremity malformation characterized by fusion of the fourth and fifth metacarpals. In the previous publication, we first identified a heterozygous missense mutation Q50R in homeobox domain (HD) of HOXD13 in a large Chinese family with SDTY5. In order to substantiate the pathogenicity of the variant and elucidate the underlying pathogenic mechanism causing limb malformation, transcription-activator-like effector nucleases (TALEN) was employed to generate a Hoxd13Q50R mutant mouse. The mutant mice exhibited obvious limb malformations including slight brachydactyly and partial syndactyly between digits 2–4 in the heterozygotes, and severe syndactyly, brachydactyly and polydactyly in homozygotes. Focusing on BMP2 and SHH/GREM1/AER-FGF epithelial mesenchymal (e-m) feedback, a crucial signal pathway for limb development, we found the ectopically expressed Shh, Grem1 and Fgf8 and down-regulated Bmp2 in the embryonic limb bud at E10.5 to E12.5. A transcriptome sequencing analysis was conducted on limb buds (LBs) at E11.5, revealing 31 genes that exhibited notable disparities in mRNA level between the Hoxd13Q50R homozygotes and the wild-type. These genes are known to be involved in various processes such as limb development, cell proliferation, migration, and apoptosis. Our findings indicate that the ectopic expression of Shh and Fgf8, in conjunction with the down-regulation of Bmp2, results in a failure of patterning along both the anterior-posterior and proximal-distal axes, as well as a decrease in interdigital programmed cell death (PCD). This cascade ultimately leads to the development of syndactyly and brachydactyly in heterozygous mice, and severe limb malformations in homozygous mice. These findings suggest that abnormal expression of SHH, FGF8, and BMP2 induced by HOXD13Q50R may be responsible for the manifestation of human SDTY5.

Syndactyly in the Pediatric Population: A Review of the Literature.

Syndactyly is one of the most common congenital upper extremity deformities. Syndactyly can be described as either simple, involving just the skin and soft tissue, or complex, involving the phalanges. Additionally, syndactyly can be categorized as complete, involving the entire digit (including the nail fold), or incomplete, which does not involve the nail fold. Multiple familial or spontaneous genetic abnormalities can cause syndactyly, and these mutations typically involve the canonical wingless-type (WNT) pathway. Surgical repair of syndactyly is typically done between six to 18 months of age, depending on the type of syndactyly. Regardless of the classification of the syndactyly, the repair is performed before school-going age (except in the case of extremely mild or rare, extremely complex syndactyly). One or more imaging modalities are used to aid the surgeon in deciding the surgical approach for the syndactyly repair. The surgical plan must be clearly communicated with parents to manage expectations of aesthetics and function of the digits post-surgery. In brief, a syndactyly release surgery involves the creation of the web space using a geometrical design of the surgeon's choice, defatting of finger flaps, separation of the digits, and closure with absorbable sutures. However, the approach may vary depending on the patient. A "best" approach for rectifying the difference in surface area of separated versus fused digits has not yet been determined. While this was typically done using a skin graft, the use of alternative methods (most notably, using a synthetic dermal substitute or not using a graft at all and allowing the skin to heal with secondary intention) has been on the rise given the undesirable side effects of a graft. Less commonly, an external fixator can be used to expand soft tissue and skin. In the case of complete syndactyly, the Buck-Gramcko technique is most commonly used for nail flap reconstruction. Complications of the surgery include contracture, web creep, and the need for a second surgery. Thus, parents must be counseled in recognizing signs of complications.

Novel Heterozygous Sequence Variant in the HOXD13 Gene Underlie Non-syndromic Syndactyly

Background: The term "Syndactyly" referred to an inherited deformity of the hand or foot marked by persistence of the webbing between adjacent digits that are more or less completely attached and mostly inherited in an autosomal dominant manner. Pathogenic variants in the HOXD13 (Homeobox D13) gene, located on chromosome 2q31.1, have been associated with syndactyly type 5, brachydactyly type D, E and synpolydactyly type 1 phenotypes. Objectives: A Pakistani inbreed was recruited from the remote area of the country was added in the study and aimed to clinically and genetically characterize the syndactyly as marked abnormal feature observed. Methodology: Whole exome sequencing coupled with Sanger sequencing was carried out to uncover the disease associated variant/s followed by 3D protein modeling to check variant related effect on protein level. Results: WES data analysis revealed a novel-HOXD13 gene missense variant (c.969G>T; p.Trp323Cys) that might explain the disease phenogenesis. 3D protein modeling of the normal and mutant protein predicated high level changes that might compromise the ultimate function of the protein. Conclusion: Our findings extend the mutation spectrum of HOXD13 gene and also provided additional evidence that HOXD13 play an important role in limbs development.

New Notations for Better Morphological Distinction of Postaxial Polydactyly of the Foot.

We performed an analysis of 65 postaxial polydactyly cases from 2004 to 2021. Judgment criteria for deciding the surgical procedure were selected, and the points required for notation were decided. Based on them, we devised a new notation. The necessary points required for notation were decided based on the following criteria: (1) the presence and level of syndactyly, (2) bifurcation level of the phalanges, (3) the presence of other deformities, and (4) predominant toes. We came up with a new notation and description method. Different types of syndactyly were represented using a horizontal bar, and predominant toes were represented using equality or inequality symbols. The bifurcation level of the phalanges and accessory deformities were additionally recorded (eg, 4-5>-6, Middle, 5,6: External rotation). From this notation, it is obvious which toe should be resected. Furthermore, syndactyly, accessory deformities, and the condition of the phalanges are also easily understood. Our new notation for postaxial polydactyly consists of some related symbols that are each provided a meaning. This system is simple, especially for easily understanding the morphology, and ideal for daily medical use. We conclude that it could become a universal notation method for cases of postaxial polydactyly of the foot.

Long-read whole genome sequencing reveals HOXD13 alterations in synpolydactyly.

Synpolydactyly 1, also called syndactyly type II (SDTY2), is a genetic limb malformation characterized by polydactyly with syndactyly involving the webbing of the third and fourth fingers, and the fourth and fifth toes. It is caused by heterozygous alterations in HOXD13 with incomplete penetrance and phenotypic variability. In our study, a five-generation family with an SPD phenotype was enrolled in our Rare Disease Genomics Protocol. A comprehensive examination of three generations using Illumina short-read whole-genome sequencing (WGS) did not identify any causative variants. Subsequent WGS using Pacific Biosciences (PacBio) long-read HiFi Circular Consensus Sequencing (CCS) revealed a heterozygous 27-bp duplication in the polyalanine tract of HOXD13. Sanger sequencing of all available family members confirmed that the variant segregates with affected individuals. Reanalysis of an unrelated family with a similar SPD phenotype uncovered a 21-bp (7-alanine) duplication in the same region of HOXD13. Although ExpansionHunter identified these events in most individuals in a retrospective analysis, low sequence coverage due to high GC content in the HOXD13 polyalanine tract makes detection of these events challenging. Our findings highlight the value of long-read WGS in elucidating the molecular etiology of congenital limb malformation disorders.

Female infant with apert syndrome and high imperforate anus without fistula

Apert syndrome (AS) is a rare type of congenital craniofacial dysmorphic and severe syndactyly of the hands and feet. Fibroblast growth factor receptor (FGFR) gene mutations are suspect to be involved in this anomaly. The distinct features are craniosynostosis-a condition of premature closure of skull's sutures-, midface hypoplasia-an incomplete development of the middle of the face-, and syndactyly-webbed fingers or toes-. The anorectal malformations (ARMs) associations with AS is rare, and the genetic link is highly complex. Only 12.7% of ARMs cases were associated with a syndrome that has a well-known impact on intellectual development, including AS. To our knowledge, this is the first reported case of AS with a high imperforate anus without fistula. • The association of anorectal malformations (ARMs) with AS is rare, and the genetic link is highly complex. • High imperforate anus can be associated with apert syndrome. This is the first reported case of apert syndrome and high imperforate anus.

Functional Outcome of Syndactyly Repair in Children

Background: As the most prevalent form of congenital hand malformation, syndactyly carries significant aesthetic and practical implications. For the vast majority of situations, surgery is the best option. Congenital syndactyly can be repaired with skin grafts and local flaps, however the results are often less functional and cosmetic than anticipated and often leave scars and residual syndactyly. So we set out to find out how children's syndactyly healing went in this study.1 Objective: To analyze the functional outcome of syndactyly repair in children presenting in a tertiary care hospital. Methodology: This Descriptive case series was conducted at Department of Plastic and Reconstructive Surgery, LUMHS Jamshoro / Hyderabad for 6 months. Sample size of 180 cases was recruited through Non-probability consecutive sampling. Then all patients underwent surgery under general anesthesia. In all cases, procedure was performed depends upon the type / extent of syndactyly. Then patients were discharged after recovery and were followed up on 1st, 2nd and 3rd months post operatively for assessment of functional outcome of syndactyly repair i.e. no supination and no pronation was noted. All this information was noted on proforma. Data was entered and analyzed using SPSS 22.0. Results: The mean age of children was 6.30+3.55. There were 66 (37%) females and 114 (63%) male in the sample. There were 128 (71%) cases of simple syndactyly and 52 (29%) cases of complex syndactyly. There were 127 (71%) cases who had no-supination, 162 (90%) cases who had no-pronation. There was significant difference observed between both type of syndactyly (P<0.05) for supination while insignificant for pronation. Conclusion: Thus we have found that syndactyly repair is effective technique through which we can attain success in maximum number of patients which can help in achieving normal angulation of fingers after surgery. Key words: Syndactyly, Pronation, Supination, Angulation, Children

Mode of inheritance of syndactyly in selected human families in Bahawalnagar, Pakistan

Syndactyly is joining or merging of web in feet and hands digits. It is inherited by autosomal dominant, autosomal recessive, x-linked, and y-linked manner. Its prevalence is around 1 in 2000 live birth. Non-syndromic syndactyly is classified into nine types. In this study, we find out prevalence, percentage, types, and mode of inheritance of syndactyly in families of district Bahawalnagar. The survey was carried out in hospitals, schools, and villages of district Bahawalnagar to find out the patients with congenital syndactyly. Three families with cousin marriages were selected for pedigrees. These families had 2:1 of foot and hand syndactyly. The percentage of complete and incomplete syndactyly was recorded 50% in all families. The mode of inheritance was autosomal dominant and autosomal recessive pattern because of two types of syndactyly type I (SD1) and syndactyly type I-c. In families Bwn1, Bwn2, and Bwn3 the percentage of family members associated with syndactyly was 16%, 9.7%, and 6.89% respectively. It was further noted that all male members of all families were affected with syndactyly. This study finds out the type I (SD1) and type I-c syndactyly in the studied sample population.

Novel HOXD13 variants in syndactyly type 1b and type 1c, and a new spectrum of TP63-related disorders.

Syndactyly is the most common limb defect depicting the bony and/or cutaneous fusion of digits. Syndactyly can be of various types depending on the digits involved in the fusion. To date, eight syndactyly-associated genes have been reported, of which HOXD13 and GJA1 have been explored in a few syndactyly but most of them have unknown underlying genetics. In the present study HOXD13, GJA1 and TP63 genes have been screened by resequencing in 24 unrelated sporadic cases with various syndactyly. The screening revealed two pathogenic HOXD13 variants, NM_000523:c.500 A > G [p.(Y167C)], and NM_000523:c.961 A > C [p.(T321P)] in syndactyly type 1b and type 1c, respectively. This is the first report to identify HOXD13 pathogenic variant in syndactyly type 1b and third report in syndactyly type 1c pathogenesis. Furthermore, this study also reports a TP63 pathogenic variant, NM_003722:c.953 G > A [p.(R318H)] in Ectrodactyly andCleft lip and palate (ECLP). In conclusion, the current study expands the clinical spectrum of HOXD13 and TP63-related disorders.

Un cas de syndactylie bilatérale complexe, complète et compliquée

We report the case of a 21-year-old female patient, born with a bilateral hand deformity consisting of syndactyly of the 3rd and 4th rays on each side, without any other associated congenital anomaly. In order to correct the functional and aesthetic discomfort caused by this malformation, she consulted an orthopedic surgeon. A hand X-ray (A, B) was performed to determine the type of syndactyly and any associated bony hand anomalies. It revealed a complex, complete and complicated bilateral syndactyly with, on both the right and the left, a bifidity of the phalanges of the 4th ray forming a synostosis with the 3rd ray. The rest of the bones and joints of the hand are normal. Syndactyly is one of the most common congenital anomalies of the extremities. It is a defect in finger differentiation, defined as a fusion of adjacent fingers. Syndactyly can be seen in the upper and lower extremities, and up to 50% of cases are bilateral. To avoid the morbidity associated with this condition, it must be diagnosed and treated promptly. Syndactyly is described as simple or complex, depending on the presence (complex) or absence (simple) of bony fusion. Complete syndactyly extends to the fingertips with inclusion of the nail folds, while incomplete syndactyly does not extend the full length of the finger. Complicated syndactyly is defined by the presence of interposed accessory phalanges or abnormal bones.

A Review of the Phenotype of Synpolydactyly Type 1 in Homozygous Patients: Defining the Relatively Long and Medially Deviated Big Toe with/without Cupping of the Forefoot as a Pathognomonic Feature in the Phenotype.

Synpolydactyly type 1 (SPD1, OMIM 186000) is inherited as autosomal dominant and is caused by HOXD13 mutations. The condition is rare and is known for its phenotypic heterogeneity. In the homozygous state, the phenotype is generally more severe and is characterized by three main features: a more severe degree of syndactyly, a more severe degree of brachydactyly, and the frequent loss of the normal tubular shape of the metacarpals/metatarsals. Due to the phenotypic heterogeneity and the phenotypic overlap with other types of syndactyly, no pathognomonic feature has been described for the homozygous phenotype of SPD1. In the current communication, the author reviews the literature on the phenotypes of SPD1 in homozygous patients. The review documents that not all homozygous patients show a severe hand phenotype. The review also defines the “relatively long and medially deviated big toe with/without cupping of the forefoot” as a pathognomonic feature in the phenotype. Illustration of this feature is done through a demonstrative clinical report in a multigeneration family with SPD1 and HOXD13 polyalanine repeat expansion. Finally, the pathogenesis of the clinical features is reviewed.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

BackgroundSynpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.MethodsWe used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.ResultsOur results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.ConclusionBased on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

A rare TTC30B variant is identified as a candidate for synpolydactyly in a Chinese pedigree.

Syndactyly type II (synpolydactyly, SPD) is a rare autosomal dominant inherited disease with higher incomplete penetrance. Currently, several variants in HOXD13 and one deletion in FBLN1 have been associated with SPD. However, the causative variants in several SPD families and their etiological mechanism are still largely unknown. Whole exome and PCR-sanger sequencing followed by two-point linkage analysis were performed to identify the pathogenic variant in a six-generation Chinese pedigree. Homology modeling in combination with the RNAi and qRT-PCR experiments was used for revealing the pathogenic mechanism of the TTC30B variant. A six-generation SPD family was reported. The affected subjects in this family had no other clinical malformation beyond SPD. A rare missense variant c.1157C>T [p.Ala375Val] (chr2:178416368, hg19) in TTC30B was demonstrated to be responsible for this SPD family. The modeling structure indicated that the Ala375 was evolutionarily and structurally conserved. The variant p.Ala375Val was predicted to be deleterious for protein structure and/or stability. Two-point linkage analysis resulted in a maximum LOD score of 3.1444 (P = 0.000071). Furthermore, we found that TTC30B was regulated by the Shh signaling pathway and the abnormal expression of TTC30B will affect the activation of the Shh signaling pathway in human retinal pigment epithelial cells. This study demonstrates for the first time that an IFT (intraflagellar transport) - related gene TTC30B is implicated with SPD.

National Patterns in Surgical Management of Syndactyly: A Review of 956 Cases.

Purpose: Being one of the most common congenital hand malformations, syndactyly is repaired by orthopedic, plastic, and fellowship-trained general surgeons. Limited multi-institutional outcomes analyses regarding incidence, timing, and type of repair exist. Methods: All syndactyly cases performed over a 5-year period from 2012-2016 were isolated from the National Surgical Quality Improvement Program Pediatric database. Patient demographics, surgical factors, perioperative outcomes, and risk factors were analyzed using χ2, Fisher exact, and t-test analysis. Results: A total of 956 patients who underwent syndactyly repair were identified. Most cases were simple syndactyly with nearly even case distribution among plastic and orthopedic surgeons. Most patients were men and Caucasian. Mean age at the time of surgery was 2.6 years. Most cases were performed as outpatient surgery. Patients of plastic surgeons had significantly more airway abnormalities and shorter operative times. Patients with complex syndactyly had significantly more ventilator dependence, tracheostomy, and comorbidities when compared with those with simple syndactyly. Cases with complex syndactyly also had longer operative times and a higher rate of superficial surgical site infections. Conclusions: Syndactyly repair is a safe procedure with few major or minor reconstructive complications regardless of the surgical specialty or syndactyly type. Patients with complex syndactyly have significantly more preoperative comorbidities with comparable outcomes. orthopedic surgeons have significantly longer operative times than plastic surgeons, likely due to caring for increased number of patients with complex syndactyly.

882 Syndactyly type III and hypotrichosis in oculodentodigital syndrome with GJA1 mutation

882 Syndactyly type III and hypotrichosis in oculodentodigital syndrome with GJA1 mutation

Linear Separation of Toe Syndactyly With Preserved Subcutaneous Vascular Network Skin Grafts.

Conventional surgery of toe syndactyly is accomplished using a zig-zag incision and full thickness or split thickness skin grafting. However, this method has an aesthetic problem with a prominent scar on the dorsal side of the foot. The aim of the article was to investigate the efficacy of a cosmetically conscious operation for syndactylies performed using a single technique. A retrospective analysis was performed involving 66 patients with 88 syndactylic toes who presented to the department of plastic and reconstructive surgery at 1 of 3 major institutions during a 16-year period (1998-2014). Syndactylies were classified according to the affected interdigital spaces (IDSs). All cases were treated using the same method: linear skin incisions to divide the digits, triangular flaps on the dorsal and plantar sides of the foot, and preserved subcutaneous vascular network skin grafts from the medial inframalleolar region. The most frequent type of toe syndactyly was IDS-2 (union of the second/third toes), which accounted for 59.1% (39/66) of the cases. The rates of familial anomalies were significantly different between bilateral IDS-2 (4/13) and unilateral IDS-2 (0/24) (P < 0.05, Fisher exact test). There were no severe postoperative complications, including scar contracture or keloid formation. All patients obtained sufficiently deep IDSs, and none required repeat surgery. A straight incision minimizes the scar observed from the visible side, and preserved subcutaneous vascular network skin grafts prevent postoperative contracture of linear scar.

A Systematic Review and Comparison of Outcomes Following Simple Syndactyly Reconstruction With Skin Grafts or a Dorsal Metacarpal Advancement Flap

Many techniques exist for simple syndactyly reconstruction. The most commonly used techniques involve either skin grafts or a dorsal metacarpal advancement flap. Our aim was to review and compare the outcomes of these 2 techniques systematically. We reviewed articles from PubMed, MEDLINE, EMBASE, and Google Scholar published between January 1966 and January 2016. We identified studies that reported outcomes after reconstruction of simple syndactyly using skin grafts and those using only a dorsal metacarpal advancement flap. Cases of complex syndactyly and those that were not clearly differentiated by technique or type of simple syndactyly were excluded. Outcomes were then stratified by technique and type of syndactyly (complete and incomplete). We identified 693 articles and selected 34 for inclusion. No standardized outcome measure was uniformly applied in the examined studies. Overall, skin grafting procedures were associated with more complications (eg, flap necrosis/graft failure, contracture, web creep, hypertrophic scarring) and a greater need for revision. When stratified by subtype, patients with simple, complete syndactyly who underwent skin grafting had a significantly higher rate of hypertrophic scarring than those who underwent reconstruction with a dorsal metacarpal advancement flap. Simple syndactyly reconstruction with a dorsal metacarpal advancement flap may lead to fewer complications than procedures using skin grafts. However, substantial limitations of currently available evidence do not allow for the recommendation of a specific technique. Future research should use a uniform reporting system for syndactyly classification and complications. Therapeutic IV.

Identification of a missense HOXD13 mutation in a Chinese family with syndactyly type I-c using exome sequencing.

Syndactyly is one of the most common hereditary limb malformations, and is characterized by the fusion of specific fingers and/or toes. Syndactyly type I‑c is associated with bilateral cutaneous or bony webbing of the third and fourth fingers and occasionally of the third to fifth fingers, with normal feet. The aim of the present study was to identify the genetic basis of syndactyly type I‑c in four generations of a Chinese Han family by exome sequencing. Exome sequencing was conducted in the proband of the family, followed by direct sequencing of other family members of the same ancestry, as well as 100 ethnically‑matched, unrelated normal controls. A missense mutation, c.917G>A (p.R306Q), was identified in the homeobox D13 gene (HOXD13). Sanger sequencing verified the presence of this mutation in all of the affected family members. By contrast, this mutation was absent in the unaffected family members and the 100 ethnically‑matched normal controls. The results suggest that the c.917G>A (p.R306Q) mutation in the HOXD13 gene, may be responsible for syndactyly type I‑c in this family. Exome sequencing may therefore be a powerful tool for identifying mutations associated with syndactyly, which is a disorder with high genetic and clinical heterogeneity. The results provide novel insights into the etiology and diagnosis of syndactyly, and may influence genetic counseling and the clinical management of the disease.

An increased duplication of ZRS region that caused more than one supernumerary digits preaxial polydactyly in a large Chinese family.

Preaxial polydactyly (PPD) is inherited in an autosomal dominant fashion and characterized by the presence of one or more supernumerary digits on the thumb side. It had been identified that point mutation or genomic duplications of the long-range limb-specific cis-regulator - zone of polarizing activity regulatory sequence (ZRS) cause PPD or other limb deformities such as syndactyly type IV (SD4) and Triphalangeal thumb-polysyndactyly syndrome (TPTPS). Most previously reported cases involved with no more than one extra finger; however, the role of the point mutation or genomic duplications of ZRS in the case of more than one redundant finger polydactyly remains unclear. In this article, we reported a family case of more than one redundant finger polydactyly on the thumb side for bilateral hands with a pedigree chart of the family. Results of quantitative PCR (qPCR) and sequence analysis suggested that the relative copy number (RCN) of ZRS but not point mutation (including insertion and deletion) was involved in all affected individuals.