Tumor Suppressor Protein PTEN Research Articles

The tumor suppressor protein PTEN inhibits rat hepatic stellate cell activation

Following a fibrogenic stimulus, the hepatic stellate cell (HSC) transforms from a quiescent to an activated cell type associated with increased proliferation, collagen and smooth muscle alpha-actin (alphaSMA) expression. Phosphatase and Tensin Homolog Deleted on Chromosome Ten (PTEN), a tumor suppressor phosphatase, has been shown to play a role in several nonmalignant diseases. Here, we investigated the role of PTEN during HSC activation. Rat HSCs 2 days after isolation were transduced with adenoviruses expressing either the wild-type (WT) or a dominant negative form of PTEN, and culture-associated activation of HSCs, including morphological changes, expression of alphaSMA and alpha1(I) collagen, and cell proliferation, were evaluated. Apoptosis of HSCs was detected by measuring activity of caspase 3/7. Phosphorylation status of Akt, p70(S6K), and Erk was detected by Western blotting. Overexpression of WT-PTEN inhibited phenotypic changes were associated with HSC activation, including morphological changes, expression of alphaSMA and alpha1(I) collagen, and HSC proliferation, including cyclin D1 expression. WT-PTEN expression also induced apoptosis in HSCs with increased caspase 3/7 activity. Expression of WT-PTEN also caused decreased activation of Akt, p70(S6K), and Erk signaling pathways. Taken together, these findings show that PTEN represents an important negative regulator for transactivation of HSCs. This may have important implications for the design of therapeutic strategies to prevent the progression of liver fibrosis.

Lipid Bilayer Coated Gold Nanoparticles Provide Insight Into Proteins' Conformational Changes

While nanoparticles have been studied and used for many years and their unique chemical and physical properties have been extensively characterized, nanoparticles are now increasingly used to investigate biological systems. Nanoparticles can be formed on a submicron scale and do not interfere with normal biological processes, thus can be used in an in vivo system, allowing researchers to gain insight into its inner workings. The use of nanoparticles has also proven to be quite flexible, and has provided an indispensable tool in the advancement of drug delivery, tissue engineering, and detection of biomolecules. We have previously studied conformational changes occuring within proteins upon binding to phospholipid model membranes, particularly the tumor suppressor protein PTEN. To gain a more in depth characterization of these protein conformation changes, we have developed a technique in which we have fabricated 50nm gold nanoparticles coated with an asymmetric lipid bilayer, in a manner that allows us to control the identity of the lipids making up the outer leaflet. Using Raman spectroscopy, we will take advantage of the surface enhanced Raman spectroscopy (SERS) effect, which will increase PTEN band intensities binding of the protein to the lipid covered nanoparticle. Systematic mutation of tryptophan residues within the protein will allow us to probe the binding induced conformational changes in the vicinity of the tryptophan. While SERS has been used previously to study protein conformational changes, proteins were in these cases directly immobilized onto the nanoparticles. In contrast, our novel approach immobilizes the lipids on the nanoparticles and the protein can freely interact with the target lipid. While we plan to use these methods to examine PTEN, further development of this technique will allow for better study of conformational changes in a myriad of interfacial enzymes.

The tumor suppressor protein PTEN inhibits rat hepatic stellate cell activation

The tumor suppressor protein PTEN inhibits rat hepatic stellate cell activation

PVHL and PTEN tumour suppressor proteins cooperatively suppress kidney cyst formation

In patients with von Hippel-Lindau (VHL) disease, renal cysts and clear cell renal cell carcinoma (ccRCC) arise from renal tubular epithelial cells containing biallelic inactivation of the VHL tumour suppressor gene. However, it is presumed that formation of renal cysts and their conversion to ccRCC involve additional genetic changes at other loci. Here, we show that cystic lesions in the kidneys of patients with VHL disease also demonstrate activation of the phosphatidylinositol-3-kinase (PI3K) pathway. Strikingly, combined conditional inactivation of Vhlh and the Pten tumour suppressor gene, which normally antagonises PI3K signalling, in the mouse kidney, elicits cyst formation after short latency, whereas inactivation of either tumour suppressor gene alone failed to produce such a phenotype. Interestingly, cells lining these cysts frequently lack a primary cilium, a microtubule-based cellular antenna important for suppression of uncontrolled kidney epithelial cell proliferation and cyst formation. Our results support a model in which the PTEN tumour suppressor protein cooperates with pVHL to suppress cyst development in the kidney.

Regulation of cytoplasmic and nuclear PTEN levels by human papillomavirus (HPV) type 16 E6 and E7 oncogenes in HPV16+ oropharyngeal cancer cell line

6034 Background: We have previously shown that repression of HPV type 16 E6 and E7 genes using short hairpin RNAs to HPV16+ oropharyngeal cancer cells results in restoration of cellular p53 and pRb tumor suppressor pathways. PTEN is a cellular tumor suppressor protein that functions as a plasma membrane lipid phosphatase antagonizing the phosphoinositide 3-kinase/AKT cell survival pathway. PTEN is also found in cell nuclei maintaining the chromosomal stability. We sought to investigate the role of HPV E6 and E7 oncogenes in the regulation of PTEN tumor suppressor protein levels in HPV16+ oropharyngeal cancer cells. Methods: Short hairpin RNAs targeting HPV type 16 E6 and E7 genes were delivered by retrovirus infection to HPV16+ oropharyngeal cancer cell lines 147T and 090. E6 and E7 mRNA downregulation was assessed by quantitative reverse transcription polymerase chain reaction and western blotting for p53 and Rb. The protein levels of AKT, pAKT and PTEN were analyzed before and after silencing in 147T and 090 oropharygeal cell lines by western blotting. Quantitative real time RT-PCR analysis was also used to detect changes to mRNA expression of AKT and PTEN after E6/E7 repression. Results: The protein levels of cytoplasmic and nuclear PTEN were significantly upregulated after E6/E7 gene silencing. The upregulation of PTEN protein after silencing was not associated with a change in the phosphorylated status of AKT. Quantitative real time RT-PCR analysis showed that PTEN mRNA levels were not significantly upregulated after E6/E7 repression. Conclusions: We provide evidence that the principal HPV16 oncoproteins (E6 and E7) are involved in downregulation of cytoplasmic and nuclear PTEN protein levels in HPV16+ oropharygeal cancer cell lines. PTEN upregulation after E6/E7 silencing occurs at the protein and not at the mRNA level. Thus, it is possible that PTEN protein stabilization after E6/E7 repression is associated with cellular restoration of p53 protein. The lack of correlation between PTEN downregulation and AKT activation is consistent with data showing that PTEN tumorigenesis also occurs via AKT-independent mechanisms. No significant financial relationships to disclose.

The secret lives of voltage sensors

The secret lives of voltage sensors

Loss of PTEN expression does not contribute to PDK-1 activity and PKC activation-loop phosphorylation in Jurkat leukaemic T cells

AbstractUnopposed PI3-kinase activity and 3′-phosphoinositide production in Jurkat T cells, due to a mutation in the PTEN tumour suppressor protein, results in deregulation of PH domain-containing proteins including the serine/threonine kinase PKB/Akt. In Jurkat cells, PKB/Akt is constitutively active and phosphorylated at the activation-loop residue (Thr308). 3′-phosphoinositide-dependent protein kinase-1 (PDK-1), an enzyme that also contains a PH domain, is thought to catalyse Thr308 phosphorylation of PKB/Akt in addition to other kinase families such as PKC isoforms. It is unknown however if the loss of PTEN in Jurkat cells also results in unregulated PDK-1 activity and whether such loss impacts on activation-loop phosphorylation of other putative PDK-1 substrates such as PKC. In this study we have addressed if loss of PTEN in Jurkat T cells affects PDK-1 catalytic activity and intracellular localisation. We demonstrate that reducing the level of 3′-phosphoinositides in Jurkat cells with pharmacological inhibitors of PI3-kinase or expression of PTEN does not affect PDK-1 activity, Ser241 phosphorylation or intracellular localisation. In support of this finding, we show that the levels of PKC activation-loop phosphorylation are unaffected by reductions in the levels of 3′-phosphoinositides. Instead, the dephosphorylation that occurs on PKB/Akt at Thr308 following reductions in 3′-phosphoinositides is dependent on PP2A-like phosphatase activity. Our finding that PDK-1 functions independently of 3′-phosphoinositides in T cells is also confirmed by studies in HuT-78 T cells, a PTEN-expressing cell line with undetectable levels of 3′-phosphoinositides. We conclude therefore that loss of PTEN expression in Jurkat T cells does not impact on the PDK-1/PKC pathway and that only a subset of kinases, such as PKB/Akt, are perturbed as a consequence PTEN loss.

ErbB-2 Induces Bilateral Adrenal Pheochromocytoma Formation in Mice

Pheochromocytoma (PCC) is a rare catecholamine-producing tumor that arises from the adrenal medulla and is often familial. The genetic basis for familial PCC involves mutations of RET, VHL, SHDx or NF-1 in more than 20% of cases. Additional genes may be important in pathogenesis of both familial and sporadic PCC. ErbB-2/Her2/Neu is a growth factor receptor tyrosine kinase that is frequently overexpressed in tumors and there is clinical evidence suggesting that enhanced ErbB-2 growth factor receptor signaling may play a role in PCC. In the present study, ectopic expression of an activated ErbB-2 transgene resulted in bilateral adrenal PCC. Analyses of tumor samples and normal adrenal tissue revealed that levels of the Pten tumor suppressor protein were greatly reduced in PCCs, while levels of the cell cycle regulatory protein cyclin D1 were usually increased. In addition, levels of phospo-AKT were increased in PCCs versus normal adrenal tissue. Biochemical analyses established that PCC’s were functionally active, producing abundant levels of the catecholamines, epinephrine and norepinephrine. These data establish that increased ErbB-2 growth factor receptor signaling in the adrenal medulla can lead to PCC through combined influences on Pten, AKT and cyclin

The p53/p21 DNA damage-signaling pathway is defective in most meningioma cells

Although meningiomas represent the most common class of tumors of the central nervous system, the molecular events underlying their genesis and development are still not well defined. In the present study we have used the immuno-blotting technique to study the expression level of the tumor suppressor proteins p53, p21 and PTEN in primary meningioma cells. We have also studied the induction of p21 and p53 in response to both UV light and gamma-rays. We present evidence that the p53/p21-dependent gamma-ray signaling pathway is defective in 5 out of 8 (62%) of these cells. Furthermore, we have shown that the tumor suppressor p21, p53 and PTEN proteins are differently expressed in these cells, with up to 40-folds difference between the lowest and the highest levels of each protein. These results suggest that the tumor suppressors p53/p21 signaling pathway and PTEN play important roles in the development of benign meningiomas.

PTEN-Mediated Resistance to Epidermal Growth Factor Receptor Kinase Inhibitors

Molecularly targeted therapies are transforming the treatment of cancer. Elucidating the dynamic signaling networks that underlie sensitivity and resistance to these inhibitors is critical for successful clinical application. There is considerable evidence to suggest that constitutively activating mutations in kinases that regulate cellular growth may result in tumor cell "addiction" and favorable response to targeted inhibition. However, there is emerging evidence to suggest that clinical response may also be determined by other changes in the molecular circuitry of cancer cells, such as loss of key tumor-suppressor proteins. Here, we will discuss resistance to epidermal growth factor receptor tyrosine kinase inhibitors in glioblastoma patients that is mediated by loss of the PTEN tumor-suppressor protein.

PTEN Enters the Nuclear Age

Regulation of the PTEN tumor suppressor protein is poorly understood. In this issue, Wang et al. (2007) and Trotman et al. (2007) describe how ubiquitination regulates PTEN stability and its nuclear localization. Additionally, Shen et al. (2007) report that a nuclear pool of PTEN helps to maintain chromosomal stability.

Downregulation of catalase by reactive oxygen species via PI 3 kinase/Akt signaling in mesangial cells

Reactive oxygen species (ROS) contribute to many glomerular diseases by targeting mesangial cells. ROS have been shown to regulate expression of many antioxidant enzymes including catalase. The mechanism by which the expression of catalase protein is regulated by ROS is not precisely known. Here we report that increased intracellular ROS level by hydrogen peroxide (H(2)O(2)) reduced the expression of catalase. H(2)O(2) increased phosphorylation of Akt kinase in a dose-dependent and sustained manner with a concomitant increase in the phosphorylation of FoxO1 transcription factor. Further analysis revealed that H(2)O(2) promoted rapid activation of phosphatidylinositol (PI) 3 kinase. The PI 3 kinase inhibitor Ly294002 and expression of tumor suppressor protein PTEN inhibited Akt kinase activity, resulting in the attenuation of FoxO1 phosphorylation and preventing the downregulating effect of H(2)O(2) on catalase protein level. Dominant negative Akt attenuated the inhibitory effect of H(2)O(2) on expression of catalase. Constitutively active FoxO1 increased the expression of catalase. However, dominant negative FoxO1 inhibited catalase protein level. Catalase transcription was reduced by H(2)O(2) treatment. Furthermore, expression of dominant negative Akt and constitutively active FoxO1 increased catalase transcription, respectively. These results demonstrate that ROS downregulate the expression of catalase in mesangial cells by PI 3 kinase/Akt signaling via FoxO1 as a target.

A novel leptin signalling pathway via PTEN inhibition in hypothalamic cell lines and pancreatic β-cells

In obesity and diabetes, the ability of hypothalamic neurons to sense and transduce changes in leptin and insulin levels is compromised. The effects of both hormones require intracellular signalling via the PI3-kinase pathway, which is inhibited by the phosphatase PTEN. We show that leptin-stimulated F-actin depolymerization in mouse hypothalamic cells is inhibited by PTEN, a process involving independent effects of both its lipid and protein phosphatase activities. Potentially mediating this F-actin depolymerization, leptin, but not insulin, stimulated the phosphorylation of PTEN in a CK2 dependent manner, and inhibited its phosphatase activity. Similarly, hyperpolarization of mouse pancreatic beta-cells by leptin also requires coincident PtdIns(3,4,5)P3 generation and actin depolymerization, and could be inhibited by mechanisms requiring both the lipid and protein phosphatase activities of PTEN. These results demonstrate a critical role for PTEN in leptin signalling and indicate a mechanism by which leptin and insulin can produce PI3K dependent differential cellular outputs.

Pten, Tumorigenesis, and Stem Cell Self-Renewal

Self-renewal pathways crucial for maintaining stem cells are deregulated in cancer, raising the spectre that cancer therapies targeting such pathways might also ablate normal stem cells. As Yilmaz et al. (2006) report in a recent Nature paper, this may not be the case for the tumor suppressor protein Pten, which drives the self-renewal of normal hematopoietic stem cells and the formation of leukemia cells through different mechanisms.

Control of estrogen receptor by tumor suppressor protein PTEN in breast cancer cells

Excessive exposure to estrogen has long been associated with an increased risk for developing breast cancer and anti-estrogen therapy is the gold standard of care in the treatment of estrogen receptor (ER) α-positive breast cancers. However, there are several mysteries concerning both anti-estrogen, tamoxifen, and estrogen. The most important of these are: (1) some ERα-positive breast cancers do not respond to tamoxifen; (2) some ERα-negative breast cancers do respond to tamoxifen; (3) initial or acquired resistance to tamoxifen occurs with recurrent tumors; (4) estrogen can cause marked tumor regression in long-term tamoxifen-resistant ERα-positive breast cancer. These mysteries indicate that we do not know enough about estrogen signaling to understand the effects of targeting these receptors in cancer. The discovery of ERβ, the second estrogen receptor, has added another level of complexity to estrogen signaling. This review summarizes recent publications and makes an updated portrait of ERα and ERβ in breast carcinogenesis and endocrine cancer therapy.

Interaction between B-CLL Cells and Lymphoid Microenvironment Leads to Activation of PI3-K/Akt Pathway and Inhibition of Apoptosis.

Inhibition of apoptosis and long survival leads to accumulation of the leukemic cells in B cell chronic lymphocytic leukemia (B-CLL). This could be due to activation of anti-apoptotic cascades in CLL cells through interaction with their lymphoid microenvironment. Therefore, we investigated the role of tumor microenvironment in prolongation of survival of B-CLL cells and activation of the potent anti-apoptotic PI3-K/Akt pathway.Stromal fibroblasts of bone marrow (BMFs), spleen (SF) and lymph gland (LGF) were used as an in vitro model for lymphoid microenvironment and we tested their ability to inhibit spontaneous apoptosis of B-CLL cells. Co-culture of B-CLL cells with human BMFs, LGF, and SF significantly inhibited apoptosis and prolonged survival of the leukemic cells in comparison to suspension cultures and to co-cultures with fibroblasts obtained from non-lymphoid organs. Trans-well culture experiments indicated that cell-cell interaction and soluble mediators are essential for this supportive effect. To explore the involvement of PI3-K/Akt pathway in the anti-apoptotic effect of stromal fibroblasts, co-cultures were performed in presence of PI3-K inhibitors (wortmannin or Ly294002) or siRNAs against PI3-K (p110ß subunit) and Akt1. These inhibitors significantly reduced the supportive effect of stromal fibroblasts and induced apoptosis in B-CLL cells. Interestingly, the leukemic cells were far more sensitive to PI3-K inhibition than T cells, monocytes and fibroblasts. Induction of apoptosis was associated with a significant decrease in the intracellular PIP3, PI3-K, PDK1 and Akt1, NF-kappa B, IKK and de-phosphorylation/activation of tumor suppressor protein PTEN. Studies using phosphospecific anti-PTEN antibody demonstrated that PBMC of CLL patients (n=40) highly express a phosphorylated form of PTEN. The results demonstrate that the PI3-K/Akt pathway is involved in inhibition of apoptosis of B-CLL cells and suggest that interaction of the leukemic cells with lymphoid microenvironment maintains the activation of this pathway. The data also suggest that targeting this pathway represents a new option for designing novel therapeutic strategies in B-CLL.

Molecular Determinants of the Response of Glioblastomas to EGFR Kinase Inhibitors

The epidermal growth factor receptor (EGFR) is frequently amplified, overexpressed, or mutated in glioblastomas, but only 10 to 20 percent of patients have a response to EGFR kinase inhibitors. The mechanism of responsiveness of glioblastomas to these inhibitors is unknown. We sequenced kinase domains in the EGFR and human EGFR type 2 (Her2/neu) genes and analyzed the expression of EGFR, EGFR deletion mutant variant III (EGFRvIII), and the tumor-suppressor protein PTEN in recurrent malignant gliomas from patients who had received EGFR kinase inhibitors. We determined the molecular correlates of clinical response, validated them in an independent data set, and identified effects of the molecular abnormalities in vitro. Of 49 patients with recurrent malignant glioma who were treated with EGFR kinase inhibitors, 9 had tumor shrinkage of at least 25 percent. Pretreatment tissue was available for molecular analysis from 26 patients, 7 of whom had had a response and 19 of whom had rapid progression during therapy. No mutations in EGFR or Her2/neu kinase domains were detected in the tumors. Coexpression of EGFRvIII and PTEN was significantly associated with a clinical response (P<0.001; odds ratio, 51; 95 percent confidence interval, 4 to 669). These findings were validated in 33 patients who received similar treatment for glioblastoma at a different institution (P=0.001; odds ratio, 40; 95 percent confidence interval, 3 to 468). In vitro, coexpression of EGFRvIII and PTEN sensitized glioblastoma cells to erlotinib. Coexpression of EGFRvIII and PTEN by glioblastoma cells is associated with responsiveness to EGFR kinase inhibitors.

Significance of Skp2 expression in human gastric carcinoma and the relationship between Skp2, p27 and PTEN expression

Objective: S-phase kinase-associated protein 2 (Skp2) is a positive regulator of G1-S transition and promotes ubiquitin-mediated proteolysis of the cyclin-dependent kinase inhibitor p27. Its overexpression has been implicated in cell transformation and oncogenesis. In this study, we investigated significance of Skp2 expression in human gastric carcinoma and the relationship between Skp2, p27 and PTEN expression. Methods: Immunohistochemical analysis was performed on 138 surgical resected primary gastric carcinoma specimens, 102 paired metastasis carcinoma tissue specimens in lymph node from the same set of 138 surgical resected primary gastric carcinoma specimens, 30 dysplasia specimens, 30 intestinal metaplasia specimens, and 20 normal gastric mucosa specimens for Skp2 and performed on the same set of 138 surgical resected primary gastric carcinoma specimens for p27 and PTEN. Results: Skp2 labeling frequency % was increased dramatically in intestinal metaplasia, dysplasia, and primary gastric carcinoma compared with normal gastric mucosa (P=0.000, all the same). Skp2 labeling frequency % in metastasis gastric carcinoma in lymph node was significantly higher than primary gastric carcinoma (P=0.037). Skp2 labeling frequency % was positively associated with differentiated degree (rho=0.315, P=0.000), vessel invasion (rho=0.303, P=0.000) and lymph node metastasis (rho=0.254, P=0.000) respectively. An inverse correlation of Skp2 was observed with both its biochemical target p27 expression in gastric carcinoma (rho=−0.451, P=0.000) and with its putative negative regulator, the PTEN tumor suppressor protein (rho=−0.480, P=0.000). p27 expression had positive relationship with PTEN expression in gastric carcinoma (rho=0.642, P=0.000). Conclusion: Skp2 overexpression is correlated with carcinogenesis and progression of gastric carcinoma: elevated Skp2 expression is correlated with decreased p27 and PTEN in gastric carcinoma, and p27 expression is parallel with PTEN expression. These suggest that PTEN may regulate expression of p27 through the Skp2 pathway, and the effects of Skp2, p27 and PTEN together play an important role in carcinogenesis and progression of gastric carcinoma.

LKB1 interacts with and phosphorylates PTEN: a functional link between two proteins involved in cancer predisposing syndromes

Germline mutations of the LKB1 (STK11) tumor suppressor gene lead to Peutz-Jeghers syndrome (PJS) and predisposition to cancer. LKB1 encodes a serine/threonine kinase generally inactivated in PJS patients. We identified the dual phosphatase and tumor suppressor protein PTEN as an LKB1-interacting protein. Several LKB1 point mutations associated with PJS disrupt the interaction with PTEN suggesting that the loss of this interaction might contribute to PJS. Although PTEN and LKB1 are predominantly cytoplasmic and nuclear, respectively, their interaction leads to a cytoplasmic relocalization of LKB1. In addition, we show that PTEN is a substrate of the kinase LKB1 in vitro. As PTEN is a dual phosphatase mutated in autosomal inherited disorders with phenotypes similar to those of PJS (Bannayan-Riley-Ruvalcaba syndrome and Cowden disease), our study suggests a functional link between the proteins involved in different hamartomatous polyposis syndromes and emphasizes the central role played by LKB1 as a tumor suppressor in the small intestine.

TPTE “Cancer/Testis” antigen is a candidate target for immunotherapy in epithelial ovarian carcinoma

2583 Background: Cancer/testis (CTA) antigens expression is highly tissue-restricted, immunogenic in cancer patients, and are novel targets for cancer vaccine.These CTA are expressed in different tumors and normal testes, but not in other normal tissues. Transmembrane phosphatase with tensin homology (TPTE) is a novel, 2761 bp long CTA located on chromosome 21p11 and shares significant homology with tumor suppressor protein PTEN. Our study goals were to determine TPTE expression in epithelial ovarian carcinoma (EOC) and examine for correlation with clinical outcome. Methods: Frozen specimens were obtained from 100 patients with EOC treated between 1995 and 2003. Following isolation of total RNA, one-step reverse transcriptase PCR (RT-PCR) was performed on the EOC tissues, 8 cancer cell lines (IOSE, HOSE, OVCA-3, OV-2774, SKOV-6, OVCA-429 and SKOV-3) and 16 normal tissues. A 433 bp TPTE specific PCR product was amplified using TPTE specific sense 5’TTTATTCGATTCCTCGTTATGTACG3’ and antisense 5’ACATAATTCTTTCCCAGAAGGG3’ primers. Glyceraldehyde-3-phosphodehydrogenase specific PCR amplification was used a control. The χ2 test and Kaplan-Meier method were used for statistical analysis. Statistical significance was determined by the log-rank test. Results: TPTE was not expressed in any of the normal tissues (including brain, heart, kidney, spleen, lungs) but was expressed in 35 out of 100 (35%) EOC tissues. All cancer cell lines except SKOV-6 expressed TPTE. There were no significant relationships between stage, grade, histology and TPTE +ve and TPTE -ve patients.The median follow up for all patients was 32 months (range 0.5–119 months). Median survival in TPTE negative patients was 40 months (CI:32,48) versus 55 months (CI: 44,66) in TPTE positive patients (not significant). Conclusions: TPTE is expressed in a high proportion of EOC patients. Although there was no significant difference in overall survival in TPTE+ve and TPTE-ve patients, its lack of expression in normal tissues, homology to PTEN and its potential role in tumorigenesis makes TPTE an attractive target for antigen specific immunotherapy for EOC. We are evaluating immunogenicity of TPTE for development of polyvalent CTA vaccine therapy for EOC. No significant financial relationships to disclose.