Tumefaciens Strain GV3101 Research Articles

An Efficient Agrobacterium-Mediated Genetic Transformation Using Embryonic Axis in Cotton (Gossypium hirsutum L.)

Agrobacterium-mediated genetic transformation approach allows for introducing novel genes in cotton (Gossypium hirsutum L.). Development of efficient regeneration and transformation protocol is very important for recalcitrant plants like cotton. In the present study, five-day-old germinated mature embryo parts especially embryonic axis, hypocotyl and plumule of cotton ‘Lashata’ were wounded and inoculated with A. tumefaciens strain GV2260 harbouring plasmid p35S-GUS-INT. The binary plasmid p35S-GUS-INT contains neomycin phosphotransferase II (NPTII) gene driven by nopaline synthase (NOS) promoter and β-glucuronidase (GUS) gene controlled by cauliflower mosaic virus (CaMV) 35S promoter. After inoculation, explants were co-cultivated in liquid and agar-solidified MS medium for 48 h in dark condition. Agar-solidified co-cultivation medium increased transformation frequency as compared to liquid medium. The putative primary transformants were confirmed with histochemical GUS assay, PCR and RT-PCR. However, comparing the three culture explant, the embryonic axis explants had significant difference with embryonic hypocotyl and plumule explants in terms of number and percentage (%) of GUS, PCR and RT-PCR positive plant. The total transformation efficiency was recorded as 3% with varying GUS expression levels.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

A New Plant Expression System for Producing Pharmaceutical Proteins.

In the past decade, interest in the production of recombinant pharmaceutical proteins in plants has tremendously progressed because plants do not harbor mammalian viruses, are economically competitive, easily scalable, and capable of carrying out complex post-translational modifications required for recombinant pharmaceutical proteins. Mucuna bracteata is an essential perennial cover crop species widely planted as an underground cover in oil palm and rubber plantations. As a legume, they have high biomass, thrive in its habitat, and can fix nitrogen. Thus, M. bracteata is a cost-efficient crop that shows ideal characteristics as a platform for mass production of recombinant protein. In this study, we established a new platform for the transient production of a recombinant protein in M. bracteata via vacuum-assisted agro-infiltration. Five-week-old M. bracteata plants were vacuum infiltrated with Agrobacterium tumefaciens harboring a plasmid that encodes for an anti-toxoplasma immunoglobulin (IgG) under different parameters, including trifoliate leaf positional effects, days to harvest post-infiltration, and the Agrobacterium strain used. Our results showed that vacuum infiltration of M. bracteata plant with A. tumefaciens strain GV3101 produced the highest concentration of heterologous protein in its bottom trifoliate leaf at 2days post-infiltration. The purified anti-toxoplasma IgG was then analyzed using Western blot and ELISA. It was demonstrated that, while structural heterogeneity existed in the purified anti-toxoplasma IgG from M. bracteata, its transient expression level was two-fold higher than the model platform, Nicotiana benthamiana. This study has laid the foundation towards establishing M. bracteata as a potential platform for the production of recombinant pharmaceutical protein.

Role of the Arabidopsis calcineurin B-like protein-interacting protein kinase CIPK21 in plant cold stress tolerance

The Arabidopsis calcineurin B-like protein-interacting protein kinase CIPK21 gene (AtCIPK21) plays important roles in cell metabolism, plant development, and abiotic stress responses. However, the function of the AtCIPK21 gene in cold stress tolerance in plant cells is not fully understood. In this study, we use cell cultures of three plant species including rice (Oryza sativa L.), cotton (Gossypium hirsutum L.), and white pine (Pinus strobus L.), as well as Agrobacterium tumefaciens strain GV3101 harboring pBI-AtCIPK21 to generate transgenic cell lines. After confirmation of integration of the AtCIPK21 gene into the genome by polymerase chain reaction (PCR), southern blotting, and northern blotting analyses, the rice, cotton, and pine AtCIPK21 transgenic cell lines were used to examine cold stress tolerance. The experimental results demonstrated that overexpression of the AtCIPK21 gene enhanced cold stress tolerance of transgenic cells by increasing cell viability and cell growth rate, decreasing lipid peroxidation and ion leakage, increasing the content of polyamines, as well as elevating the activity of antioxidative enzymes. In rice cells, AtCIPK21 increases expression of Ca2+-dependent protein kinase (CPK) genes and mitogen-activated protein kinase (MAPK) genes under cold stress. These results indicated that overexpression of the AtCIPK21 gene in plant cells improved cold stress tolerance by elevating polyamines content, antioxidative enzyme activity, and expression of CPK genes and MAPK genes. Overexpression of the AtCIPK21 gene may be a valuable approach for engineering plant cold stress tolerance.

Feasible regeneration and agro bacterium-mediated transformation of Brassica juncea with Euonymus alatus diacylglycerol acetyltransferase (EaDAcT) gene.

In the present study an effort has been made to optimize the in vitro regeneration protocol for Agrobacterium-mediated transformation of Brassica juncea, because of its importance as oilseed crops. The highest callus induction frequency of 87% was observed on MS (Murashige and Skoog, 1962) medium supplemented with 4 µM 6-benzyladenine (BA) after four weeks of culture period. Subculturing of organogenic calli in MS media with a similar hormonal composition resulted in shoot organogenesis after six weeks of culture cultivation. The highest shoot induction frequency (92%) was recorded on MS medium containing 4 µM BA in combination with 1 µM of α-naphthalene acetic acid (NAA). Further, well-developed roots were formed in MS media augmented with 6 µM of Indole acetic acid (IAA) in combination with 1 µM Kinetin (Kn). Cotyledon explants were exploited in vitro for the successful transformation of B. juncea. A binary vector comprised of the Euonymus alatus diacylglycerol acetyltransferase (EaDAcT) gene under the transcriptional control of a glycinin promoter and with a basta selection marker was introduced into A. tumefaciens strain GV3101 via electroporation. EaDAcT gene is responsible for unusual triacylglycerol’s production where the sn-3 position is esterified with acetate instead of the long-chain fatty acid found in the triacylglycerol’s. The highest regeneration frequency (100%) of transgenic shoots was observed on MS medium supplemented with 4 µM BA plus 1 µM NAA in the presence of 25 mg l−1 basta and 160 mg l−1 timintin. The efficiency of stable transformation was found to be approximately 7% in the transgenic plants. Moreover, the transformed regenerated shoots were confirmed by PCR analysis using EaDAcT gene-specific primers.

Embryogenic cell suspensions for high-capacity genetic transformation and regeneration of switchgrass (Panicum virgatum L.)

BackgroundSwitchgrass (Panicum virgatum L.), a North American prairie grassland species, is a potential lignocellulosic biofuel feedstock owing to its wide adaptability and biomass production. Production and genetic manipulation of switchgrass should be useful to improve its biomass composition and production for bioenergy applications. The goal of this project was to develop a high-throughput stable switchgrass transformation method using Agrobacterium tumefaciens with subsequent plant regeneration.ResultsRegenerable embryogenic cell suspension cultures were established from friable type II callus-derived inflorescences using two genotypes selected from the synthetic switchgrass variety ‘Performer’ tissue culture lines 32 and 605. The cell suspension cultures were composed of a heterogeneous fine mixture culture of single cells and aggregates. Agrobacterium tumefaciens strain GV3101 was optimum to transfer into cells the pANIC-10A vector with a hygromycin-selectable marker gene and a pporRFP orange fluorescent protein marker gene at an 85% transformation efficiency. Liquid cultures gave rise to embryogenic callus and then shoots, of which up to 94% formed roots. The resulting transgenic plants were phenotypically indistinguishable from the non-transgenic parent lines.ConclusionThe new cell suspension-based protocol enables high-throughput Agrobacterium-mediated transformation and regeneration of switchgrass in which plants are recovered within 6–7 months from culture establishment.

Super-Agrobacterium ver. 4: Improving the Transformation Frequencies and Genetic Engineering Possibilities for Crop Plants.

Agrobacterium tumefaciens has been utilized for both transient and stable transformations of plants. These transformation methods have been used in fields such as breeding GM crops, protein production in plant cells, and the functional analysis of genes. However, some plants have significantly lower transient gene transfer and stable transformation rates, creating a technical barrier that needs to be resolved. In this study, Super-Agrobacterium was updated to ver. 4 by introducing both the ACC deaminase (acdS) and GABA transaminase (gabT) genes, whose resultant enzymes degrade ACC, the ethylene precursor, and GABA, respectively. A. tumefaciens strain GV2260, which is similar to other major strains (EHA105, GV3101, LBA4404, and MP90), was used in this study. The abilities of the Super-Agrobacterium ver. 4 were evaluated in Erianthus ravennae, Solanum lycopersicum “Micro-Tom,” Nicotiana benthamiana, and S. torvum. Super-Agrobacterium ver. 4 showed the highest T-DNA transfer (transient transformation) frequencies in E. ravennae and S. lycopersicum, but not in N. benthamiana and S. torvum. In tomato, Super-Agrobacterium ver. 4 increased the stable transformation rate by 3.6-fold compared to the original GV2260 strain. Super-Agrobacterium ver. 4 enables reduction of the amount of time and labor required for transformations by approximately 72%, and is therefore a more effective and powerful tool for plant genetic engineering and functional analysis, than the previously developed strains. As our system has a plasmid containing the acdS and gabT genes, it could be used in combination with other major strains such as EHA105, EHA101, LBA4404, MP90, and AGL1. Super-Agrobacterium ver. 4, could thus possibly be a breakthrough application for improving basic plant science research methods.

“Floral-dip” transformation of Amaranthus caudatus L. and hybrids A. caudatus × A. paniculatus L.

After “floral-dip” transformation of Amaranth plants with Agrobacterium tumefaciens strain GV3101 carrying pCBV19 gene vector that contained bar and gus genes, transgenic seeds were obtained. The functioning of the tran+sferred genes in Amaranthus tissues was confirmed with herbicide selection (PPT herbicide – phospinotricin) and gus gene activity. Positive results were obtained for cultivars “Karmin” and “Kremoviy rannii”. The percentage of GUS positive samples was 1% (for “Karmin”), 2.2% (for “Kremoviy rannii”) from the total initial quantity of plants that was prior to selection with the herbicide. The seeds of six amaranth cultivars were received after treatment with A. tumefaciens by the method “floral dip”. The lowest lethal dose of herbicide PPT was established – 40 mg/l. After spraying with herbicide, resistant plants were obtained for cultivars: “Kremoviy rannii” (21%) and “Karmin” (20%). After conduction of PCR analysis, positive results were obtained for four cultivars. The percentage of bar positive plants was 0.3% (“Helios”); 0.26% (“Sterkch”); 0.06% (“Kremoviy rannii”); 0.3% (“Rushnichok”) from total initial quantity of plants.

Improvement of the in vitro regeneration and Agrobacterium-mediated genetic transformation of Medicago sativa L.

Alfalfa is a fodder crop that accounts for one of the best sources of protein and is widely cultivated around the world. In vitro regeneration of alfalfa has been studied earlier; however, most of the studies were almost intervened with callus formation. In this study, 3 explant sources (cotyledonary node, hypocotyl, and root crown) of two Turkish cultivars (Nimet and Savas) were excised from young seedlings. Explants were subjected to different concentrations of BAP, BAP-IBA, and TDZ to evaluate the direct in vitro regeneration potential of selected plant parts. Moreover, we transformed the alfalfa plant with pBin19 harboring 35s.GUS-INT_35s.nptII construct to investigate the transformation efficiency and regeneration frequency after bacterial inoculation. The transformation was carried out by Agrobacterium tumefaciens strain GV2260. The highest mean number of regenerated shoots per explant was recorded as 8.5, 6.66, and 6.33 shoots per explant after cotyledonary node explants were treated with BAP (0.40 mg/L), BAP-IBA (1.25-0.06 mg/L), and TDZ (0.55 mg/L), respectively. The highest gene transformation frequency was 9.52% and 6.19% based on PCR and GUS assays. The regeneration frequency was decreased by up to 48.1% under kanamycin selection pressure. The effect of cultivar on shoot regeneration frequency, mean number of regenerated shoots, and gene transformation efficiency was significant. This study contributes to in vitro regeneration of alfalfa crop and its genetic transformation which could be utilized in future gene transformation studies.

Plant regeneration and Agrobacterium-mediated transformation of the miracle tree Neolamarckia cadamba

Neolamarckia cadamba is a miracle tree species with considerable economic potential used as a timber wood, woody forage and traditional medicine resource. The present study aimed to establish an efficient protocol of plant regeneration and Agrobacterium-mediated genetic transformation for N. cadamba. Greenish callus were induced from different type explants when cultured on Murashige and Skoog’s (MS) medium supplemented with thidiazuron (TDZ) and kinetin (KT). The callus could differentiate into somatic embryos or adventitious shoots, and these two regeneration pathways often occurred in the same callus clumps. It was found that MS medium supplemented with 2 mg/L TDZ, 0.2 mg/L KT provided the most suitable medium for leaf explants to induce adventitious shoot, delivering a maximum regeneration frequency with a mean of 8.2 shoots per explant. The micro-shoots developed roots in MS supplemented with 0.05 mg/L α-naphthaleneacetic acid (NAA), and could be successfully acclimatized to a greenhouse with more than 90% survival. Based on this regeneration protocol, an Agrobacterium tumefaciens-mediated genetic transformation system was successfully developed for N. cadamba. Genetic transformation was obtained through the infection of leaf with A. tumefaciens strain GV3101 harboring a modified binary vector pCAMBIA1305 containing the marker genes β-glucuronidase (GUS) and fluorescent protein YFP. The presence of GUS in transformed plants was confirmed using PCR and histological stain, while the expression of YFP was confirmed through fluorescent microscopy and RT-PCR. Out of 276 putative transformants, 15 plants were found to be positive transgenic. Nevertheless, by adopting this protocol, positive transformed plants could be obtained within three months.

Efficient plant regeneration and Agrobacterium-mediated transformation via somatic embryogenesis in purslane (Portulaca oleracea L.): an important medicinal plant

Portulaca oleracea is an important medicinal plant, which is a source of pharmacologically active molecules such as β-Carotene, ascorbic acid, and Omega-3 fatty acids. The present research focuses on the development of an efficient protocol for micropropagation and Agrobacterium-mediated genetic transformation of P. oleracea. Callus induction, somatic embryogenesis, and plant regeneration from stem and leaf explants were investigated at various concentrations of kinetin (Kin) and 6-Benzylaminopurine (BAP) alone or in combination with indole-3-acetic acid, 1-Naphthaleneacetic acid and 2,4-Dichlorophenoxyacetic acid (2,4-D). Direct differentiation of somatic embryos from leaf explants occurred on the MS medium supplemented with 1.5 mg/L BAP under dark conditions. The embryos were transferred to the same medium without growth regulators under 16 h light/8 h dark cycles. In this medium, germinated somatic embryos rapidly developed into healthy plantlets with shoots and roots. Several parameters such as pre-culture of explants, co-cultivation period, wounding of explants, type of explants and bacterial strains were studied to optimize transformation efficiency. Different kanamycin concentrations were assessed for the selection of transgenic plants. Agrobacterium tumefaciens strains LBA4404 and GV3101, harbouring the GUS gene on pBI121 binary vector, were used for plant transformation and strain LBA4404 was found to be more efficient. The results indicated that use of leaf as explant, pre-culture of explants for 7 days, co-cultivation period for 4 days at 25 ± 2 °C and wounding of leaf explants produced the best transformation results. Expression, integration and inheritance of GUS reporter gene were confirmed by histochemical and molecular analyses.

Regeneration and Genetic Transformation Systems of Durum Wheat, Triticum durum

Wheat is a major cereal crop for humans but quite recalcitrant in transformation. Establishment of regeneration system in wheat using immature embryos is not easy and time/cost-consuming. Herein, we developed a regeneration and transformation system using mature seeds in four pasta wheat cultivars. The MS medium with 2.0 mg/l 2,4-D and 2 mg/l BA was the optimum medium for developing shoots from calli. Wheat cultivars showed different regeneration frequencies response due to their genetic makeup. The cultivar Sohag-3 produced the highest regeneration frequency (93.2%) among the tested cultivars. Developed cultivars Sohag-3 and ACSAD1105 mature embryos were co-cultivated with Agrobacterium tumefaciens strain GV3101 with the binary vector pISV2678 harboring the bar gene and β-glucuronidase (gus) gene. The transformation efficiencies were 12.3 and 9.1% for cultivars Sohag-3 and ACSAD1105, respectively. The polymerase chain reaction (with specific primers for the transgenes) and the dot blot hybridization were used to confirm the integration of the transgene in transformed plants. The transformation percentages were reduced according to their expression and reached 5.6 and 4.6% for cultivars Sohag-3 and ACSAD1105, respectively. RT-PCR and northern blot analysis confirmed the expression of the gus gene only in the transgenic plants. The procedures developed in this study demonstrate the ability to produce transgenic wheat plants expressing the gus gene; hence, this protocol could be used to regenerate transgenic wheat plants expressing desirable and selective genes.

Genome-Wide Analysis of Lectin Receptor-Like Kinases in Tomato (Solanum lycopersicum) and Its Association with the Infection of Tomato Yellow Leaf Curl Virus

Lectin receptor-like kinases (LecRLKs) are crucial factors in response to plant biotrophic pathogens. This study aimed to systemically analyze the effect of tomato LecRLKs on the responses to tomato yellow leaf curl virus (TYLCV) infection. A total of 93 tomato SlyLecRLK genes, including 69 G-type LecRLKs, 23 L-type LecRLKs, and one C-type LecRLK, were identified using genome-wide analysis and were clustered into three subfamilies using phylogenetic analysis. These SlyLecRLK genes were localized on the 12 tomato chromosomes with some gene duplication events. Transcriptomic analysis showed most of SlyLecRLKs were modulated by phytohormones and TYLCV infection. Gene ontology (GO) enrichment analysis showed all SlyLecRLK genes were associated with receptor protein kinase activity and protein modification. Quantitative RT-PCR (qRT-PCR) and gene interference validation showed SlyLecRLKs007, SlyLecRLKs036, and SlyLecRLKs044 genes were inhibited by TYLCV infection, and silencing of them were accompanied by accumulation of TYLCV DNA content. Subcellular localization of LecRLKs023 and LecRLKs044 on cell membranes was determined using a SlyLecRLK-containing A. tumefaciens strain GV3101. These results showed SlyLecRLK genes were key factors for TYLCV resistance, and also provided crucial information uncovering the protective effects of SlyLecRLKs on resisting TYLCV infection in tomato.

Agrobacterium tumefaciens-mediated transformation of Jatropha curcas L. with a polyhydroxyalkanoate gene (phaC)

Polyhydroxybutyrate is a component of bioplastics that is synthesized under the control of enzymes encoded by pha multigenes. The genes are naturally present in Ralstonia eutropha. However, the production of bioplastics in bacteria is inefficient because the bacterial biomass is relatively small compared with plants or fungi. As such, engineering techniques have been developed that enable pha genes to be inserted into plant biomass, and then be expressed in the biomass of the plant to produce polyhydroxybutyrate. The objectives of this study were to transform the tissue of Jatropha curcas using the phaC gene (a pha gene), to regenerate the transformed plant, and to confirm the presence of the inserted genes with PCR. The genetic transformation of J. curcas was mediated by Agrobacterium tumefaciens strain GV3101 containing pARTC by dipping the cotyledon tissue of J. curcas in a suspension of the bacterium for 30 min, followed by cocultivation for 3 d on Murashige and Skoog (MS) medium. The tissue was then placed on a selection medium, i.e. MS medium containing 13.3 µM BAP and 0.05 µM IBA with the addition of 20 mg/L kanamycin. The results showed that 12.35% of the tissue survived and regenerated into a shoot after 1–2 months. Molecular analysis of the transformed tissue was performed using phaC and nptII primers, in order to detect the presence of the phaC and nptII genes. Specific bands were detected at 659 bp and 700 bp, corresponding to the nptII primer and phaC primer, respectively.

AGROBACTERIUM-MEDIATED TRANSFORMATION OF TOMATO (LYCOPERSICON ESCULENTUM Mill.) USING A SYNTHETIC Cry1Ab GENE FOR ENHANCED RESISTANCE AGAINST TUTA ABSOLUTA (Meyrick)

The effect of different plant hormones on in vitro regeneration of tomato (Lycopersicon esculentum Mill.) two cultivars Castle Rock and Super strain B, obtained from hypocotyls and cotyledons of cultured in vitro seedlings was examined. The optimal concentrations of plant growth regulators were the MS medium containing 3 mg L-1 of zeatin and 0.1 mg L-1 of NAA of cotyledon and hypocotyl explants of Super strain B cultivar. While, the best regeneration medium was the MS medium containing 1 mg L-1 ZEA, 0.5 mg L-1 BAP and 0.1 mg L-1 IAA of cotyledon and hypocotyl explants of Castle Rock cultivar. Agrobacterium‐mediated genetic transformation system has been expanded of tomato cultivar Super strain B. Transformation efficiency of hypocotyl explants was studied with Agrobacterium tumefaciens strain GV3101 harboring binary vector pICBV19, containing gus and bar genes. Transformed tomato shoots were obtained from hypocotyls explants on MS medium contained with 3 mg L-1 ZEA and 0.1 mg L-1 NAA. The gene expression of gus and bar genes was tested in the putatively transformed tomato plantlets through GUS histochemical and leaf painting assays. The plasmid pBI121 containing an insect resistance gene (cry1Ab) and kanamycin gene (nptII) as a plant selectable marker were introduced into these explants. Putatively transformed plantlets were examined by PCR and southern blot analysis. The expression of cry1Ab gene was tested through insect bioassay. For insect bioassay, experiments were conducted to determine the mortality percentage of Cry1Ab toxin protein against Tuta absoluta (Meyrick). The results indicated that Cry1Ab toxin protein expressed in transformed tomato plants showed 100% instars larval mortality was obtained after feeding for 4–5 days.

Fusion gene construct preparation with lectin and protease inhibitor genes against aphids and efficient genetic transformation of Brassica juncea using cotyledons explants

Globally, Brassica juncea is one of the significant oilseed crops, which is commercially important and cultivated under diverse agro-climatic region preferably for its high oil content as well as superior oil quality. Biotic stress is one of the dominant factors which hinders plant growth and yield globally. Though substantial progress has been made in breeding and genetic manipulation of plants for imposing resistance, the task remains as a challenge even today. Here, in this study, two major defense genes of plant origin, lectin from lentil and protease inhibitors from chickpea, which have insecticidal activity against phytophagous insect pests have been isolated and stacked into one ORF by overlapping extension PCR and a fusion gene construct is prepared. For tissue specific expression of this fusion gene, phloem specific promoter rolC was utilized and the construct was mobilized into Agrobacterium tumefaciens strain GV3101. Further, genetic transformation of B. juncea cv. Varuna was performed with fusion gene using Agrobacterium-mediated genetic transformation. The regeneration of the transformed putative plants was screened with hygromycin selection. Fusion gene integration in randomly selected transformed plants gives 17% overall transformation efficiency by PCR and Southern hybridization. A quantitative real-time PCR analysis showed that the transcript level of the fusion gene was within 1.8–2.8-fold. The expression of the fusion gene was significantly higher in the third line (2.8-fold). The aphid resistance test demonstrated that inhibition of larval survivability is about 40%, and the extent of leaf damage measured was also diminished in the transgenic plants compared to non transformed control plants. This study provides insight the multi-toxin approach developed through overlap extension PCR in B. juncea and may facilitate genetic engineering for the potential improvement of resistance against aphids.

The widely used Nicotiana benthamiana 16c line has an unusual T-DNA integration pattern including a transposon sequence.

Nicotiana benthamiana is employed around the world for many types of research and one transgenic line has been used more extensively than any other. This line, 16c, expresses the Aequorea victoria green fluorescent protein (GFP), highly and constitutively, and has been a major resource for visualising the mobility and actions of small RNAs. Insights into the mechanisms studied at a molecular level in N. benthamiana 16c are likely to be deeper and more accurate with a greater knowledge of the GFP gene integration site. Therefore, using next generation sequencing, genome mapping and local alignment, we identified the location and characteristics of the integrated T-DNA. As suggested from previous molecular hybridisation and inheritance data, the transgenic line contains a single GFP-expressing locus. However, the GFP coding sequence differs from that originally reported. Furthermore, a 3.2 kb portion of a transposon, appears to have co-integrated with the T-DNA. The location of the integration mapped to a region of the genome represented by Nbv0.5scaffold4905 in the www.benthgenome.com assembly, and with less integrity to Niben101Scf03641 in the www.solgenomics.net assembly. The transposon is not endogenous to laboratory strains of N. benthamiana or Agrobacterium tumefaciens strain GV3101 (MP90), which was reportedly used in the generation of line 16c. However, it is present in the popular LBA4404 strain. The integrated transposon sequence includes its 5’ terminal repeat and a transposase gene, and is immediately adjacent to the GFP gene. This unexpected genetic arrangement may contribute to the characteristics that have made the 16c line such a popular research tool and alerts researchers, taking transgenic plants to commercial release, to be aware of this genomic hitchhiker.

SacB-SacR Gene Cassette As the Negative Selection Marker to Suppress Agrobacterium Overgrowth in Agrobacterium-Mediated Plant Transformation

Agrobacterium overgrowth is a common problem in Agrobacterium-mediated plant transformation. To suppress the Agrobacterium overgrowth, various antibiotics have been used during plant tissue culture steps. The antibiotics are expensive and may adversely affect plant cell differentiation and reduce plant transformation efficiency. The SacB-SacR proteins are toxic to most Agrobacterium tumefaciens strains when they are grown on culture medium supplemented with sucrose. Therefore, SacB-SacR genes can be used as negative selection markers to suppress the overgrowth of A. tumefaciens in the plant tissue culture process. We generated a mutant A. tumefaciens strain GV2260 (recA-SacB/R) that has the SacB-SacR cassette inserted into the bacterial genome at the recA gene locus. The mutant Agrobacterium strain is sensitive to sucrose but maintains its ability to transform plant cells in both transient and stable transformation assays. We demonstrated that the mutant strain GV2260 (recA-SacB/R) can be inhibited by sucrose that reduces the overgrowth of Agrobacterium and therefore improves the plant transformation efficiency. We employed GV2260 (recA-SacB/R) to generate stable transgenic N. benthamiana plants expressing a CRISPR-Cas9 for knocking out a WRKY transcription factor.

Overexpression of Arabidopsis BBX 21 Gene in Bg 250 Rice Enhances Its Architecture and Productivity

Arabidopsis BBX21 protein was identified as a transcription activator which can activate the light dependent transcription and positively regulate light mediated development of plants. The productivity of crop plants can be enhanced by over-expressing central regulators of light signaling pathway. The present study was conducted to enhance the productivity of Bg 250 Sri Lankan rice variety by overexpressing Arabidopsis BBX21 gene. The BBX21 gene was cloned into pPZP 200 binary vector and the cloned vector gene construct was transformed into Agrobarcteium tumefaciens GV3101 strain by freeze thaw method. The selected recombinant colonies of A. tumefaciens strain GV3101 harboring BBX 21 gene were transformed into three weeks old Bg 250 rice callus. Selection of the transformed callus was conducted on N6B5 selection medium containing 50 mg/L gentamycin and 500mg/L cefotaxime. A total of putative 83 plants which showed resistant to gentamycin were subjected to PCR analysis and the results showed 69 of the regenerated plants are transgenic. The T1 seeds collected from putative transgenic plants were characterize to check its integration and inheritance. The transgenic plants which showed 3:1 ratio was selected and further grown to obtain its homozygous lines. The expression of BBX21 gene was demonstrated by northern blot analysis and the results showed 4 fold higher expression of BBX21 gene in the transgenic plants compared with its non-transgenic wild type plants. The phenotypic analysis of homozygous BBX21 transgenic plants showed improved plant height, leaf length, leaf area, number of panicles and bushy appearance compared with its non-transgenic plants. Taken together, these results demonstrate an involvement of BBX21 gene in rice modifying architecture and productivity of Bg 250 transgenic plants. Int J Appl Sci Biotechnol, Vol 4(2): 240-246

Artificial Agrobacterium tumefaciens strains exhibit diverse mechanisms to repress Xanthomonas oryzae pv. oryzae-induced hypersensitive response and non-host resistance in Nicotiana benthamiana.

Xanthomonas oryzae pv. oryzae (Xoo) rapidly triggers a hypersensitive response (HR) and non-host resistance in its non-host plant Nicotiana benthamiana. Here, we report that Agrobacterium tumefaciens strain GV3101 blocks Xoo-induced HR in N.benthamiana when pre-infiltrated or co-infiltrated, but not when post-infiltrated at 4h after Xoo inoculation. This suppression by A.tumefaciens is local and highly efficient to Xoo. The HR-inhibiting efficiency of A.tumefaciens is strain dependent. Strain C58C1 has almost no effect on Xoo-induced HR, whereas strains GV3101, EHA105 and LBA4404 nearly completely block HR formation. Intriguingly, these three HR-inhibiting strains employ different strategies to repress HR. Strain GV3101 displays strong antibiotic activity and thus suppresses Xoo growth. Comparison of the genotype and Xoo antibiosis activity of wild-type A.tumefaciens strain C58 and a set of C58-derived strains reveals that this Xoo antibiosis activity of A.tumefaciens is negatively, but not solely, regulated by the transferred-DNA (T-DNA) of the Ti plasmid pTiC58. Unlike GV3101, strains LBA4404 and EHA105 exhibit no significant antibiotic effect on Xoo, but rather abolish hydrogen peroxide accumulation. In addition, expression assays indicate that strains LBA4404 and EHA105 may inhibit Xoo-induced HR by suppression of the expression of Xoo type III secretion system (T3SS) effector genes hpa1 and hrpD6. Collectively, our results unveil the multiple levels of effects of A.tumefaciens on Xoo in N.benthamiana and provide insights into the molecular mechanisms underlying the bacterial antibiosis of A.tumefaciens and the non-host resistance induced by Xoo.