tRNA Gly Gene Research Articles

Characterization of a rat tRNA gene cluster containing the genes for tRNAAsp, tRNAGly and tRNAGlu, and pseudogenes.

The putative genes for tRNAGAUAsp(C), tRNAGGAGly(G) and tRNAGAGGlu are in a cluster on the rat chromosome and are present exclusively in a 3.3 kb region cleaved with a restriction endonuclease EcoRI. The cluster reiterates about 10 times on the haploid DNA. Four lambda clones each containing an independent repeating unit were isolated from a rat gene library. The studies on the cloned DNA revealed that the length of the repeating unit including the 3.3 kb EcoRI fragment was at least 13.5 kb. Nucleotide sequence analysis of the 3.3 kb DNA in the isolated clones showed sequence variations among the repeating units and incomplete genes for tRNAGly and tRNAGlu within the clusters.

Mammalian tRNA genes: nucleotide sequence of rat genes for tRNAAsp, tRNAGly and tRNAGlu.

A cloned 2.1 kb fragment of rat DNA hybridized to purified tRNAAsp has been sequenced. The result revealed that in addition to the putative gene for tRNAAspGAU(C), the fragment contained the tRNAGlyGGA(G) and tRNAGluGAG genes. The genes for tRNAAsp, tRNAGly and tRNAGlu have the same polarity, are arranged in this order and are regularly separated by DNA regions of about 450 bp. These rat genes contain neither intervening sequences nor the CCA sequence expected in the 3'-end of the mature tRNA. As observed in lower eukaryotic tRNA genes, the 5'-flanking regions of the three rat genes do not have any significant sequence homology as a regulatory element. In the 3'-flanking region, the sequences CTTTTTG and CTTTTG are present 11 bp downstream from the 3'-end of the genes for tRNAAsp and tRNAGly, respectively. The same CTTTTG sequence is repeated twice in regions 47 and 60 bp away from the tRNAGlu gene. The short T cluster common to the three genes might be the transcription termination site as in lower eukaryotic tRNA genes.

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.

Study of the transfer RNAs coded by T2, T4, and T6 bacteriophages.

T2, T4, and T6 bacteriophage tRNAs coding for arginine, leucine, proline, isoleucine, and glycine were isolated under conditions of short term and long term infection of Escherichia coli B cells. The corresponding phage tRNA species were examined for sequence homology by RNA-DNA hybridization analysis and by their relative behavior on reversed phase chromatography. The results indicate that all three T-even phages code for similar tRNA species; however, some tRNA species are homologous, others are not, and not all of the same tRNA species are coded by each bacteriophage. Reversed phase chromatography showed the presence of isoacceptor tRNAs for each phage aminoacyl-tRNA species. Pulse-chase experiments for [32P]tRNAGly suggest that the multiple isoacceptor species observed derive from the intracellular modification of a single tRNAGly gene product.