Tris-borate Buffer Research Articles

MOLECULAR GENETIC STATUS OF PIGS OF UKRAINIAN BREEDS SUITABLE FOR USE IN XENOTRANPLANTATION

Thousands of people in Ukraine and the world need organ transplants. However, the main obstacle to the wider use of transplantation remains the shortage of donor organs and tissues. To prevent human infection with viruses during organ transplantation, pigs are carefully screened for PERV retroviruses and animals with low expression levels of PERV-A and PERV-C are selected. The article is devoted to the discussion of the results of research on the frequency of retrovirus PERV types A and C in populations of Ukrainian pig breeds. The research was carried out on samples of pigs of the following breeds: Mirgorod, Great White, Poltava meat, Ukrainian meat, Ukrainian Steppe Ryaba, Landras, Pietren, Vietnamese Vyslobryukha, Vietnamese Meishan, and wild pig. Biomaterial samples (venous blood, bristles with hair bulbs) were collected for molecular genetic analysis. Isolation of genomic DNA from the samples was carried out by the salt method and using the Chelex-100 ion exchange resin. Genotyping was performed by the method of allele-specific (PCR-SSP) multiplex polymerase chain reaction using primers complementary to regions of the PERV-C, PERV-A gene loci. A fragment of the domestic pig alpha-actin locus (α-Actin) was used as an internal PCR control. Amplification was carried out in a thermal cycler "Tertsik-2" ("DNA-technology", RF). Electrophoretic separation of amplified DNA sections in multiplex PCR format was performed in a 2% agarose gel in a tris-borate electrophoresis buffer. It was established that among the studied groups of pigs, the highest concentration of retrovirus PEVR-C was found in animals of the breeds Vietnamese Vyslobrukha (100%), Poltava meat (75%), Ukrainian steppe spotted (55%), large white (50%), landrace (50%). The largest share of PEVR-A retrovirus carrier animals is characterized by the breeds of Vietnamese Vyslobrukha (100%), Poltava meat 95%), Pietren (80%) and Ukrainian meat (73%). The largest number of individuals free from PERV-A and PERV-C retroviruses were found in experimental groups of breeds of Ukrainian steppe spotted (75 and 45%, respectively), Myrhorod (32 and 75%, respectively), landrace (75 and 50%, respectively) and wild pig. Pigs these breeds can become promising organ donors for xenotransplantation.

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA.
 Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C.
 To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment.
 Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C.
 Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C.
 The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C.
 The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK).
 Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm.
 Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

Polymorphism of plasminogen activator inhibitor gene G43A 1 (PAI-1) in patients with acute complications of ulcer disease

Objective of the study. To carry out a comparative analysis of the frequency of PAI-1 gene G43A polymorphism in citizens of Chernivtsi region who suffer from various forms of ulcer disease, and to study the possible relationship between different types of genotype and the development of complications.Material and methods. 60 patients with ulcer disease were examined: 42 (70%) men, 18 (30%) women. 37 (61.67%) patients had a duodenal ulcer, the rest ones (38.33%) had a gastric ulcer. Uncomplicated ulcer disease was diagnosed in 12 (20%) patients. 5 (8.33%) patients were found to have an ulcer perforation. In 43 (71.67%) patients there was an ulcer complicated by acute bleeding. In 29 (67.44%) patients the bleeding was stopped. In 14 (32.56%) patients there was a relapse of bleeding.PAI genotyping by G43A mutation was performed by using polymerase chain reaction (PCR). PCR amplification of the corresponding RAI gene fragment was performed by using a specific pair of primers 5’-CCA ACA GAG GAC TCT TGG TC-3’ and 5’- CAC AGA GAG AGT CTG GCC ACG-3’. PCR was performed by using a CFX96 amplifier (Bio-Rad, USA). PCR results were carried out by electrophoresis in 2% agarose gel using a tris-borate buffer. For DNA fragments visualization the gel was stained with ethidium bromide and photographed using ultraviolet light on the GelDoc 2000 installation (BioRad, USA). To determine the length of the obtained fragments, their electrophoretic mobility was compared with the mobility of the DNA marker Gene Ruler DNA Leader Mix (Thermoscientific). The statistical dependence between the values was tested by determining the Fisher criterion, χ2-criterion by Pearson, in particular, the correspondence of the genotype distribution to the Hardy-Weinberg equilibrium.Results. 94.12% patients without acute bleeding and 91.67% patients without acute complications were found to have GG genotype. One female patient (8.33%) without any acute complications was found to have homozygous AA genotype by the mutant allele. No patient with an ulcer perforation was a carrier of allele A. None of the patients without bleeding had a heterozygous GA genotype. GA genotype was found in 25.58% of patients with an acute ulcerative bleeding, which is statistically significantly higher than in patients without any bleeding. Allele A was more common among patients with recurrent bleeding than in ones without it.Conclusions. 1. Among patients with ulcer disease without acute complications of Chernivtsi region 91.67% of whom have homozygous GG genotype by polymorphism G43A РАІ-1 gene, and 8.33% – AA genotype; no heterozygous genotype GA was found in any case.2. All examined patients with a perforated ulcer had the GG genotype.3. Patients with acute ulcerative bleeding, 27.91% of whom are carriers of mutant allele A (among them 25.58% have heterozygous GA genotype, and 2.33% – homozygous AA genotype), which is statistically significantly higher than in patients with ulcer disease without any bleeding and it shows the role of hereditary disorders of the PAI-1 gene in the development of ulcerative hemorrhages. 4. Accounting for G43A polymorphism of PAI-1 gene may become a component of the whole complex for predicting the occurrence of ulcerative bleeding in clinical conditions.

CHARACTERISTICS OF UKRAINIAN GREY CATTLE BY DNA-MARKERS

CHARACTERISTICS OF UKRAINIAN GREY CATTLE BY DNA-MARKERS

Supramolecular gel electrophoresis of large DNA fragments.

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23kbp), Lambda DNA-Mono Cut Mix (10 to 49kbp), and Marker 7 GT (10 to 165kbp), were analyzed in this study. Large DNA fragments of greater than 100kbp showed distinct mobility using a typical continuous field electrophoresis system.

GENETICS CHARACTERS INTRAPEDIGRYS TYPES OF CARPATHIAN BREED BEES

GENETICS CHARACTERS INTRAPEDIGRYS TYPES OF CARPATHIAN BREED BEES

Rapid agarose gel electrophoretic mobility shift assay for quantitating protein: RNA interactions

Interactions between proteins and nucleic acids are frequently analyzed using electrophoretic mobility shift assays (EMSAs). This technique separates bound protein:nucleic acid complexes from free nucleic acids by electrophoresis, most commonly using polyacrylamide gels. The current study utilizes recent advances in agarose gel electrophoresis technology to develop a new EMSA protocol that is simpler and faster than traditional polyacrylamide methods. Agarose gels are normally run at low voltages (∼10 V/cm) to minimize heating and gel artifacts. In this study we demonstrate that EMSAs performed using agarose gels can be run at high voltages (≥20 V/cm) with 0.5 × TB (Tris-borate) buffer, allowing for short run times while simultaneously yielding high band resolution. Several parameters affecting band and image quality were optimized for the procedure, including gel thickness, agarose percentage, and applied voltage. Association of the siRNA-binding protein p19 with its target RNA was investigated using the new system. The agarose gel and conventional polyacrylamide gel methods generated similar apparent binding constants in side-by-side experiments. A particular advantage of the new approach described here is that the short run times (5–10 min) reduce opportunities for dissociation of bound complexes, an important concern in non-equilibrium nucleic acid binding experiments.

An efficient protocol for isolation of functional RNA from peel tissue of different banana (Musa spp.) cultivars for gene expression studies on anthracnose development

Extraction of good quality RNA in larger quantities is a prerequisite for gene expression studies. Existing protocols for RNA extraction from banana pulp tissues were not successful on peel tissues of banana (Musa spp) as they contain higher concentrations of polyphenols, polysaccharides and latex. This study developed a new protocol by modifying the existing protocols. The modifications included combining of pre-warmed Tris-Borate extraction buffer, incorporation of CTAB in the extraction buffer, incubation in extraction buffer at 65 o C for one hour, and a three-day long extraction procedure with phenol, phenol:chloroform (1:1) and chloroform:isoamyl alcohol (24:1) together with centrifugation steps at high speeds (i.e. 12,000 –14,000 rpm). Spectrophotometric analysis of the extracted RNA, denaturing agarose gel electrophoresis, cDNA library construction, sequence information of cDNA inserts and RT-PCR confirmed the quality of RNA extracted by the method developed in the present study for gene expression work. Furthermore, it is shown that the developed method is useful to extract good quality RNA from peel tissues of a range of dessert- and cooking-type banana cultivars. Tropical Agricultural Research Vol. 26 (2): 329 – 342 (2015)

English

This review article views predominately the structure and function of animal and bacterial photoreceptor pigments (rhodopsin, iodopsin, bacteriorhodopsin) and their aspects of nano- and biotechnological usage. On an example of bacteriorhodopsin is described the method of its isolation from purple membranes of photo-organotrophic halobacterium Halobacterium halobium by cellular autolysis by distilled water, processing of bacterial biomass by ultrasound at 22 KHz, alcohol extraction of low and high-weight molecular impurities, cellular RNA, carotenoids and lipids, the solubilization with 0,5 % (w/v) SDS-Na and subsequent fractionation by methanol and gel filtration chromatography on Sephadex G-200 Column balanced with 0.09 M Tris-borate buffer (pH = 8,35) with 0,1 % (w/v) SDS-Na and 2,5 mM EDTA. Within the framework of the research the mechanism of color perception by the visual analyzer having the ability to analyze certain ranges of the optical spectrum, as colors was studied along with an analysis of the additive mixing of two colors. It was shown that at the mixing of electromagnetic waves with different wavelengths, the visual analyzer perceive them as separate or average wave length corresponding to mix color.

Treatment Of Early Stage Follicular Lymphoma With Involved Field Radiotherapy and Rituximab. Role Of Bcl-2 Molecular Monitoring

BackgroundStage I or II follicular lymphoma (FL) is an uncommon disease, representing only 20% of FL. Conventional treatment is represented by local radiotherapy (RT), which allows eradication of the disease in about 50% of patients. Despite the negative bone marrow biopsy in all cases, most patients present Bcl-2 rearranged cells in the bone marrow (BM) and/or peripheral blood (PB). The aim of this study was to analyze the prognostic role of Bcl-2 molecular monitoring in a series of stage I-II FL cases followed at a single center. MethodsFifty-seven consecutive patients with a confirmed diagnosis of stage I/II FL were investigated at presentation by PCR in order to identify the presence of Bcl-2 rearranged cells in the BM and/or PB. All patients were treated with involved field RT (30-36 Gy). Subsequently, minimal residual disease (MRD) was evaluated every 6 months after RT in patients positive at baseline; patients negative at baseline were not retested. In part of the patients (after 2005) Rituximab was administered in case of persistently positive Bcl-2 cells in the BM or PB after radiotherapy. The PCR analysis of the Bcl-2/IgH rearrangement was performed according to published methods. It consists in a nested PCR that uses in the first round a couple of primers for the major breakpoint region (MBR) or for the minor cluster region (mcr). After this first step, the amplification products were re-amplified using oligonucleotide primers internal to the original ones. An aliquot of the PCR products was analysed on 2% agarose gel containing ethidium bromide in Tris-borate electrophoresis buffer and visualized under UV light. For MBR and mcr, a reproducible sensitivity level of 10-5 and 10-4 respectively, was obtained. Results1. Prognostic value of basal PCR in BM/PB: PCR analysis revealed Bcl-2 rearranged cells in the PB and/or BM in 38/57 patients (66.7%) at presentation. After a median follow-up of 55 months, 11 patients (19.3%) had a clinical relapse; of them, 10 belonged to the group with positive PCR at baseline, while only 1 patient with negative basal Bcl-2 (1.7%) experienced a clinical relapse (Pearson's chi2= 0.058, Fisher exact test = 0.079). Among the 11 patients who showed a clinical relapse, 5 presented a positive Bcl-2 at relapse, 3 were negative (1 already at baseline),while in 3 this information is not evaluable. 2. Effect of local RT: After irradiation of the sole site of the disease, Bcl-2 rearranged cells disappeared in 19 of 38 patients positive at baseline (50%). In 17/38 (44.7%), MRD remained positive, while 2 patients refused to perform the analysis. A negative MRD after RT does not seem to correlate with a lower relapse probability. Only 1 patient died of breast cancer. 3. Effect of rituximab treatment in Bcl-2+ patients: Fourteen patients with persistently positive Bcl-2 after RT were treated with Rituximab 375 mg/m2 for 4 weekly administrations: 9 of them (64%) patients became negative. This result was only temporary in 4/9 cases (1 clinical relapse). Among persistently Bcl-2 positive patients after Rituximab, 1 clinical relapse was also observed. ConclusionsIn limited stage FL, despite a negative BM biopsy, Bcl-2/IgH rearranged cells can be found in the BM and/or PB, and they can disappear after local RT of the involved lymph node(s) in 50% of cases (19/38). The basal presence of Bcl-2+ cells in the BM/PB has a prognostic role: no clinical relapses were observed in Bcl-2 negative cases at baseline, except for 1 patient. Conversely, a negative MRD after radiotherapy does not seem to correlate with a better prognosis. -Rituximab therapy can induce a negativization of Bcl-2 in MRD-positive patients. Nevertheless, Rituximab treatment was only partially effective: negativization was observed in the majority of MRD-positive patients, but it was only temporary in a proportion of them. In Rituximab-treated patients, clinical relapses occurred only in the presence of MRD. -Not all clinical relapses were preceded by MRD positivity; further data are necessary to establish the usefullness of MRD monitoring over time. Prognosis of patients with early-stage FL treated with local RT + Rituximab in case of MRD persistence, is excellent: cause-specific survival=100%, EFS=70% projected at 10 years. Disclosures:No relevant conflicts of interest to declare.

Enantioseparations of amino acids by capillary array electrophoresis with 532 nm laser induced fluorescence detection

Capillary array electrophoresis (CAE) is a promising technique for multiple enantiomeric separations. Carboxytetramethylrhodamine succinimidyl ester (TAMRA SE), a rhodamine-core fluorescent probe, has rarely been applied as an original precolumn derivatization reagent for chiral amino acid (AA) analysis so far. For these purposes, high-throughput enantiomeric separations of 12 TAMRA SE-AAs by a home-made 532nm CAE-LIF scanner are presented. The effect of cyclodextrins (CDs) and a variety of organic modifiers was quickly investigated. Baseline separations were achieved in 100mM Tris–borate buffer (pH 10.0) containing 2mM β-CD and 10mM hexamethylenediamine (HDA). Multiple determination of the enantiomeric excess (ee) in non-racemic mixtures of alanine is successfully presented.

Mid‐scale free‐flow electrophoresis with gravity‐induced uniform flow of background buffer in chamber for the separation of cells and proteins

A large-scale free-flow electrophoresis (LS-FFE) is often too large for cell separation of lab scale, whereas micro-FFE (μFFE) has great difficulty in cell isolation due to easy blockage by cell accumulation in μFFE. In this study, a mid-scale FFE (MS-FFE) is developed for cell and protein separations. The volume of the separation chamber (70×40×0.1-0.8 mm) is from 280 μL to 2.24 mL, much lower than that in an LS-FFE but higher than that in a μFFE. Gravity is used for uniform flow of the background buffer only via a single pump with 16 channels and the sample is injected via an adjuster originally used for clinical intravenous injection. The experiments reveal that the hydrodynamic and electrohydrodynamic flows are much stable, and the Joule heat can be effectively dispersed without obvious positive or negative deviation as shown by the omega plots. By the device, Escherichia coli and Staphylococcus aureus, which easily accumulate to block μFFE and are separated with difficulty due to their same negative charges carried, can be well isolated under the conditions of 4.5 mM pH 8.5 Tris-boric buffer (4.5 mM Tris, 4.5 mM boric acid) with 0.10 mM ethylene diamine tetraacetic acid and 5% m/v sucrose, 200 μL/min, 800 V, and sample injection via inlet 4. The mid-scale FFE device could also be used for the separation of three model proteins of horse heart cytochrome c, myoglobin and bovine serum albumin. The device has clear significance for mid-scale separation of cells and proteins.

Modification of a micellar system for amino acid separation by MEKC—Application for amino acid profiling in formulations for parenteral use

The paper proposes a new method for amino acid determination which can be applied for amino acid profiling in solutions for parenteral nutrition. The MEKC method based on a mixed micellar system was developed for the separation of 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) derivatized amino acids. Background electrolyte was based on tris–borate buffer with high alkaline pH. Sodium dodecyl sulfate micelles were modified using 1,2-hexanediol as a co-surfactant. The effect of the modifier on amino acid migration was studied with respect to hydrophobicity of the analytes. The modifier appeared to be suitable to improve the separation of AQC-tagged amino acids without an adverse effect on buffer ionic strength or EOF velocity. The method was successfully validated and applied for amino acid profiling in medicinal preparations for parenteral nutrition. The results obtained were compared with a reference chromatographic method (amino acid analyser).

Optimization of L-glutamic acid racemization reaction with capillary array electrophoresis

L-Glutamic acid (Glu) racemization research is of great importance for the preparation of optical pure D-Glu. In the present work, we studied L-Glu racemization reaction through Schiff base intermediate by using capillary array electrophoresis (CAE) with 532 nm laser-induced confocal fluorescence detection. The racemization products were labeled by carboxytetramethylrhodamine succinimidyl ester (TAMRA) and analyzed in a 100 mmol/L Tris-borate buffer (pH 10) system containing 2 mmol/L beta-CD by CAE. Under this condition, the TAMRA-Glu enantiomer can be completely separated. The influences of the type and dosage of the aldehyde, organic acids, as well as the water content in the reaction system on the racemization were examined in detail, and L-Glu was racemized quickly in the presence of 0. 2 molar ratio of L-Glu to salicylaldehyde (as the catalyzer) in acetic acid containing 20% (v/v) water.

Visual Test of Subparts per Billion-Level Mercuric Ion with a Gold Nanoparticle Probe after Preconcentration by Hollow Fiber Supported Liquid Membrane

With the combination of the gold nanoparticle (AuNP)-based visual test with hollow fiber supported liquid membrane (HFSLM) extraction, a highly sensitive and selective method was developed for field detection of mercuric ion (Hg(2+)) in environmental waters. Hg(2+) in water samples was extracted through HFSLM and trapped in the aqueous acceptor and then visually detected based on the red-to-blue color change of 3-mercaptopropionic acid-functionalized AuNP (MPA-AuNP) probe. The highest extraction efficiency of Hg(2+) was obtained by using a 600 mL sample (pH 8.0, 2.0% (w/v) NaCl), approximately 35 microL of acceptor (10 mM of 2,6-pyridinedicarboxylic acid, pH 4.0) filled in the lumen of a polypropylene hollow fiber tubing (55 cm in length, 50 microm wall thickness, 280 microm inner diameter), a liquid membrane of 2.0% (w/v) trioctycphosphine oxide in undecane, and a shaking rate of 250 rpm. The chromegenic reaction was conducted by incubating the mixture of MPA-AuNP stock solution (12 microL, 15 nM), Tris-borate buffer solution (18 microL, 0.2 M, pH 9.5), and acceptor (30 microL) at 30 degrees C for 1 h. The detection limit can be adjusted to 0.8 microg/L Hg(2+) (corresponding to an enrichment factor of approximately 1000 in the HFSLM) and 2.0 microg/L Hg(2+) (the U.S. Environmental Protection Agency limit of [Hg(2+)] for drinkable water) by using extraction times of 3 and 1 h, respectively. The proposed method is extremely specific for Hg(2+) with tolerance to at least 1000-fold of other environmentally relevant heavy and transition metal ions and was successfully applied to detect Hg(2+) in a certified reference water sample, as well as real river, lake, and tap water samples.

Structural Diversity of Triplet Repeat RNAs

Tandem repeats of various trinucleotide motifs are present in the human transcriptome, but the functions of these regular sequences, which likely depend on the structures they form, are still poorly understood. To gain new insight into the structural and functional properties of triplet repeats in RNA, we have performed a biochemical structural analysis of the complete set of triplet repeat transcripts, each composed of a single sequence repeated 17 times. We show that these transcripts fall into four structural classes. The repeated CAA, UUG, AAG, CUU, CCU, CCA, and UAA motifs did not form any higher order structure under any analyzed conditions. The CAU, CUA, UUA, AUG, and UAG repeats are ordered according to their increasing tendency to form semistable hairpins. The repeated CGA, CGU, and all CNG motifs form fairly stable hairpins, whereas AGG and UGG repeats fold into stable G-quadruplexes. The triplet repeats that formed the most stable structures were characterized further by biophysical methods. UV-monitored structure melting revealed that CGG and CCG repeats form, respectively, the most and least stable hairpins of all CNG repeats. Circular dichroism spectra showed that the AGG and UGG repeat quadruplexes are formed by parallel RNA strands. Furthermore, we demonstrated that the different susceptibility of various triplet repeat transcripts to serum nucleases can be explained by the sequence and structural features of the tested RNAs. The results of this study provide a comprehensive structural foundation for the functional analysis of triplet repeats in transcripts.

PARP-3 Is a Mono-ADP-ribosylase That Activates PARP-1 in the Absence of DNA

The PARP-3 protein is closely related to the PARP-1 and PARP-2 proteins, which are involved in DNA repair and genome maintenance. Here, we characterized the biochemical properties of human PARP-3. PARP-3 is able to ADP-ribosylate itself as well as histone H1, a previously unknown substrate for PARP-3. PARP-3 is not activated upon binding to DNA and is a mono-ADP-ribosylase, in contrast to PARP-1 and PARP-2. PARP-3 interacts with PARP-1 and activates PARP-1 in the absence of DNA, resulting in synthesis of polymers of ADP-ribose. The N-terminal WGR domain of PARP-3 is involved in this activation. The functional interaction between PARP-3 and PARP-1 suggests that it may have a role in DNA repair. However, here we report that PARP-3 small interfering RNA-depleted cells are not sensitive to the topoisomerase I poison camptothecin, inducing DNA single-strand breaks, and repair these lesions as efficiently as wild-type cells. Altogether, these results suggest that the interaction between PARP-1 and PARP-3 is unrelated to DNA single-strand break repair.

The Acute Lymphoblastic Leukemia-associated JAK2 L611S Mutant Induces Tumorigenesis in Nude Mice

JAK2 plays important roles in the regulation of a variety of cellular processes including cell migration, proliferation, and protection from apoptosis. Recently the L611S point mutation in JAK2 has been identified in a child with acute lymphoblastic leukemia. Here we analyzed the mechanism by which JAK2 exhibits its oncogenicity. In BaF3 murine hematopoietic cells, L611S mutant increased the expression of antiapoptotic proteins including X chromosome-linked inhibitor of apoptosis protein, inhibitor of apoptosis protein, and Bcl-XL. We also showed that JAK2 L611S mutant protects BaF3 cells from cytokine withdrawal-induced apoptotic cell death and leads to cytokine-independent cell growth. Furthermore BaF3 cells expressing JAK2 L611S mutant gained the ability to induce tumorigenesis in nude mice. The L611S mutant also exhibited malignancy, including prompt invasion and spreading into various organs, leading to rapid lethality of the mice. Finally we showed that a specific JAK2 inhibitor, AG490, potently inhibited cytokine-independent cell growth induced by JAK2 L611S mutant via the induction of apoptotic cell death. In addition, treatment with AG490 significantly inhibited the JAK2 L611S mutant-induced tumorigenesis in nude mice. Thus, our results both in vitro and in vivo strongly suggest that L611S mutant of JAK2 harbors potent oncogenic activity, and this probably requires the antiapoptotic signaling pathway.

The Hantavirus Glycoprotein G1 Tail Contains Dual CCHC-type Classical Zinc Fingers

Hantaviruses are distributed worldwide and can cause a hemorrhagic fever or a cardiopulmonary syndrome in humans. Mature virions consist of RNA genome, nucleocapsid protein, RNA polymerase, and two transmembrane glycoproteins, G1 and G2. The ectodomain of G1 is surface-exposed; however, it has a 142-residue C-terminal cytoplasmic tail that plays important roles in viral assembly and host-pathogen interaction. Here we show by NMR, circular dichroism spectroscopy, and mutagenesis that a highly conserved cysteine/histidine-rich region in the G1 tail of hantaviruses forms two CCHC-type classical zinc fingers. Unlike classical zinc fingers, however, the two G1 zinc fingers are intimately joined together, forming a compact domain with a unique fold. We discuss the implication of the hantaviral G1 zinc fingers in viral assembly and host-pathogen interaction.

A Disease-causing Point Mutation in Human Mitochondrial tRNAMet Results in tRNA Misfolding Leading to Defects in Translational Initiation and Elongation

The mitochondrial tRNA genes are hot spots for mutations that lead to human disease. A single point mutation (T4409C) in the gene for human mitochondrial tRNA(Met) (hmtRNA(Met)) has been found to cause mitochondrial myopathy. This mutation results in the replacement of U8 in hmtRNA(Met) with a C8. The hmtRNA(Met) serves both in translational initiation and elongation in human mitochondria making this tRNA of particular interest in mitochondrial protein synthesis. Here we show that the single 8U-->C mutation leads to a failure of the tRNA to respond conformationally to Mg(2+). This mutation results in a drastic disruption of the structure of the hmtRNA(Met), which significantly reduces its aminoacylation. The small fraction of hmtRNA(Met) that can be aminoacylated is not formylated by the mitochondrial Met-tRNA transformylase preventing its function in initiation, and it is unable to form a stable ternary complex with elongation factor EF-Tu preventing any participation in chain elongation. We have used structural probing and molecular reconstitution experiments to examine the structures formed by the normal and mutated tRNAs. In the presence of Mg(2+), the normal tRNA displays the structural features expected of a tRNA. However, even in the presence of Mg(2+), the mutated tRNA does not form the cloverleaf structure typical of tRNAs. Thus, we believe that this mutation has disrupted a critical Mg(2+)-binding site on the tRNA required for formation of the biologically active structure. This work establishes a foundation for understanding the physiological consequences of the numerous mitochondrial tRNA mutations that result in disease in humans.