Transfection Of Antisense Oligonucleotides Research Articles

Antisense oligonucleotide-mediated terminal intron retention of endoglin: A potential strategy to inhibit renal interstitial fibrosis

TGF-β is considered an important cytokine in the development of interstitial fibrosis in chronic kidney disease. The TGF-β co-receptor endoglin (ENG) tends to be upregulated in kidney fibrosis. ENG has two membrane bound isoforms generated via alternative splicing. Long-ENG was shown to enhance the extent of renal fibrosis in an unilateral ureteral obstruction mouse model, while short-ENG inhibited renal fibrosis. Here we aimed to achieve terminal intron retention of endoglin using antisense-oligo nucleotides (ASOs), thereby shifting the ratio towards short-ENG to inhibit the TGF-β1-mediated pro-fibrotic response. We isolated mRNA from kidney biopsies of patients with chronic allograft disease (CAD) (n = 12) and measured total ENG and short-ENG mRNA levels. ENG mRNA was upregulated 2.3 fold (p < 0.05) in kidneys of CAD patients compared to controls, while the percentage short-ENG of the total ENG mRNA was significantly lower (1.8 fold; p < 0.05). Transfection of ASOs that target splicing regulatory sites of ENG into TK173 fibroblasts led to higher levels of short-ENG (2 fold; p < 0.05). In addition, we stimulated these cells with TGF-β1 and measured a decrease in upregulation of ACTA2, COL1A1 and FN1 mRNA levels, and protein expression of αSMA, collagen type I, and fibronectin. These results show a potential for ENG ASOs as a therapy to reduce interstitial fibrosis in CKD.

VEGF-A promotes the motility of human melanoma cells through the VEGFR1–PI3K/Akt signaling pathway

Vascular endothelial growth factor A (VEGF-A) and its receptors (VEGFR1 and R2) play important roles in the progression of malignant melanoma through tumor angiogenesis. However, it is not clear whether the VEGF-A/VEGFR1 signaling pathway is involved in the proliferation and migration of melanoma cells. Thus, the effect of VEGF-A on cell migration was investigated in human melanoma cell lines. Of several splicing variants of VEGF-A, VEGF165 is the most abundant and responsible for VEGF-A biological potency. VEGF165 facilitated the migration of melanoma cells in both a chemotactic and chemokinetic manner, but cell proliferation was not affected by VEGF165. VEGF165 also induced the phosphorylation of Akt. In addition, VEGF165-induced cell migration was inhibited significantly by VEGFR1/2 or a VEGFR1-neutralizing antibody. Furthermore, the downregulation of VEGFR1 via the transfection of VEGFR1-targeting antisense oligonucleotides suppressed VEGF165-induced cell migration. Moreover, wortmannin, an inhibitor of phosphatidylinositol-3 kinase (PI3K) in the PI3K/Akt pathway, suppressed VEGF165-induced Akt phosphorylation and VEGF165-induced cell migration. These findings suggest that the motility of melanoma cells is regulated by signals mediated through the PI3K/Akt kinase pathway with the activation of VEGFR1 tyrosine kinase by VEGF165. Thus, the downregulation of signaling via VEGF-A/VEGFR1 might be an effective therapeutic approach that could prevent the progression of malignant melanoma.

Downstream Neighbor of SON (DONSON) Expression Is Enhanced in Phenotypically Aggressive Prostate Cancers.

Simple SummaryDownstream neighbor of SON (DONSON) plays a crucial role in cell cycle progression and in maintaining genomic stability. We identified DONSON to be associated with an aggressive histopathological phenotype and unfavorable survival in prostate cancer (PCa) in different transcriptomic cohorts and on the protein level in our tissue microarray cohort. DONSON expression in the primary tumor was particularly strong in locally advanced, metastasized, and dedifferentiated carcinomas (TNM Stage, Gleason). Highly proliferating tumors exhibited a significant correlation to DONSON expression, and DONSON expression was notably upregulated in distant metastases and androgen-deprivation resistant metastases. In vitro, specific DONSON-knockdown significantly reduced the migration capacity in PC-3 and LNCaP, which further suggests a tumor-promoting role of DONSON in PCa. The results of our comprehensive expression analyses, as well as the functional data obtained after DONSON-depletion, lead us to the conclusion that DONSON is a promising prognostic biomarker with oncogenic properties in PCa.Downstream neighbor of Son (DONSON) plays a crucial role in cell cycle progression and in maintaining genomic stability, but its role in prostate cancer (PCa) development and progression is still underinvestigated. Methods: DONSON mRNA expression was analyzed with regard to clinical-pathological parameters and progression using The Cancer Genome Atlas (TCGA) and two publicly available Gene Expression Omnibus (GEO) datasets of PCa. Afterwards, DONSON protein expression was assessed via immunohistochemistry on a comprehensive tissue microarray (TMA). Subsequently, the influence of a DONSON-knockdown induced by the transfection of antisense-oligonucleotides on proliferative capacity and metastatic potential was investigated. DONSON was associated with an aggressive phenotype in the PCa TCGA cohort, two GEO PCa cohorts, and our PCa TMA cohort as DONSON expression was particularly strong in locally advanced, metastasized, and dedifferentiated carcinomas. Thus, DONSON expression was notably upregulated in distant and androgen-deprivation resistant metastases. In vitro, specific DONSON-knockdown significantly reduced the migration capacity in the PCa cell lines PC-3 and LNCaP, which further suggests a tumor-promoting role of DONSON in PCa. In conclusion, the results of our comprehensive expression analyses, as well as the functional data obtained after DONSON-depletion, lead us to the conclusion that DONSON is a promising prognostic biomarker with oncogenic properties in PCa.

Antisense oligonucleotide technology can be used to investigate a circular but not linear RNA-mediated function for its encoded gene locus.

As a class of powerful molecular tool, antisense oligonucleotides (ASOs) are not only broadly used in protein and RNA biology, but also a highly selective therapeutic strategy for many diseases. Although the concept that ASO reagents only reduce expression of the targeted gene in a post-transcriptional manner has long been established, the effect and mechanism of ASO reagents on RNA polymerase II (Pol II) transcription are largely unknown. This raised question is particularly important for the appropriate use of ASOs and the valid interpretation of ASO-mediated experiments. In this study, our results show that linear RNA ASO attenuates transcription of nascent transcripts by inducing premature transcription termination which is combinatorially controlled by Integrator, exosome, and Rat1 in Drosophila. However, circular RNA (circRNA) ASO transfection does not affect transcription activity of the encoded gene. These data suggest that the ASO technique can be applied to study a circRNA-mediated but not linear RNA-mediated function for its encoded gene locus.

The antitumor effect of miR-448 in epithelial ovarian cancer.

BackgroundOvarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood.MethodsThe miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays.ResultsIn this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2.ConclusionsOur study suggests that miR-448 has an inhibitory role in OC.

Deciphering the role of miR-71 in Echinococcus multilocularis early development in vitro.

Echinococcosis represents a major public health problem worldwide and is considered a neglected disease by the World Health Organization. The etiological agents are Echinococcus tapeworms, which display elaborate developmental traits that imply a complex control of gene expression. MicroRNAs (miRNAs), a class of small regulatory RNAs, are involved in the regulation of many biological processes such as development and metabolism. They act through the repression of messenger RNAs (mRNAs) usually by binding to the 3’ untranslated region (3’UTR). Previously, we described the miRNome of several Echinococcus species and found that miRNAs are highly expressed in all life cycle stages, suggesting an important role in gene expression regulation. However, studying the role of miRNAs in helminth biology remains a challenge. To develop methodology for functional analysis of miRNAs in tapeworms, we performed miRNA knockdown experiments in primary cell cultures of Echinococcus multilocularis, which mimic the development of metacestode vesicles from parasite stem cells in vitro. First, we analysed the miRNA repertoire of E. multilocularis primary cells by small RNA-seq and found that miR-71, a bilaterian miRNA absent in vertebrate hosts, is one of the top five most expressed miRNAs. Using genomic information and bioinformatic algorithms for miRNA binding prediction, we found a high number of potential miR-71 targets in E. multilocularis. Inhibition of miRNAs can be achieved by transfection of antisense oligonucleotides (anti-miRs) that block miRNA function. To this end, we evaluated a variety of chemically modified anti-miRs for miR-71 knockdown. Electroporation of primary cells with 2’-O-methyl modified anti-miR-71 led to significantly reduced miR-71 levels. Transcriptomic analyses showed that several predicted miR-71 targets were up-regulated in anti-miR-treated primary cells, including genes potentially involved in parasite development, host parasite interaction, and several genes of as yet unknown function. Notably, miR-71-silenced primary cell cultures showed a strikingly different phenotype from control cells and did not develop into fully mature metacestodes. These findings indicate an important function of miR-71 in Echinococcus development and provide, for the first time, methodology to functionally study miRNAs in a tapeworm.

Piwi-Interacting RNA1037 Enhances Chemoresistance and Motility in Human Oral Squamous Cell Carcinoma Cells.

BackgroundPiwi-interacting RNAs (piRNAs) are thought to silence transposable genetic elements. However, the functional roles of piRNAs in oral squamous cell carcinoma (OSCC) remain unelucidated. In the present study, we aimed to investigate the role of Piwi-interacting RNA 1037 (piR-1037) in chemoresistance to cisplatin (CDDP)-based chemotherapy and the oncogenic role of piR-1037 in OSCC cells.MethodsRT-PCR was used to evaluate the levels of piR-1037 and X-linked Inhibitor of apoptosis protein (XIAP) mRNA in OSCC cell lines or tumor xenografts. Transfection of piR-1037 DNA antisense and piR-1037 RNA oligonucleotides was performed to suppress and overexpress piR-1037 in OSCC cells, respectively. A CCK8 assay was used to measure the viability or proliferation of OSCC cells. Apoptosis in OSCC cells and xenografts was determined using a TUNEL assay kit. The activity of caspase-3, caspase-8 and caspase-1 in OSCC cells was measured with colorimetric caspase assay kits. Western blot analysis was conducted to analyze XIAP expression in OSCC cells and xenograft samples. Immunoprecipitation (IP) and RNA pull-down assays were utilized to analyze the piR-1037 - XIAP interaction. Transwell assays were performed to evaluate migration and invasion of OSCC cells.ResultsCDDP treatment upregulated piR-1037 expression in OSCC cells and OSCC xenografts. Suppression of the CDDP-induced upregulation of piR-1037 expression enhanced the sensitivity of OSCC cells to CDDP. piR-1037 promoted protein expression and directly bound XIAP, a key apoptotic inhibitor that is implicated in chemoresistance. The relationship between piR-1037 and XIAP suggested that piR-1037 enhanced OSCC cell chemoresistance to CDDP at least partially through XIAP. Moreover, targeting the basal expression of piR-1037 inhibited cell motility by affecting epithelial–mesenchymal transition (EMT).ConclusionpiR-1037 enhances the chemoresistance and motility of OSCC cells. piR-1037 promotes chemoresistance by interacting with XIAP and regulates the motility of OSCC cells by driving EMT.

Cytomegalovirus promotes intestinal macrophage-mediated mucosal inflammation through induction of Smad7.

Intestinal macrophages in healthy human mucosa are profoundly down-regulated for inflammatory responses (inflammation anergy) due to stromal TGF-β inactivation of NF-κB. Paradoxically, in cytomegalovirus (CMV) intestinal inflammatory disease, one of the most common manifestations of opportunistic CMV infection, intestinal macrophages mediate severe mucosal inflammation. Here we investigated the mechanism whereby CMV infection promotes macrophage-mediated mucosal inflammation. CMV infected primary intestinal macrophages but did not replicate in the cells or reverse established inflammation anergy. However, CMV infection of precursor blood monocytes, the source of human intestinal macrophages in adults, prevented stromal TGF-β-induced differentiation of monocytes into inflammation anergic macrophages. Mechanistically, CMV up-regulated monocyte expression of the TGF-β antagonist Smad7, blocking the ability of stromal TGF-β to inactivate NF-κB, thereby enabling MyD88- and NF-κB-dependent cytokine production. Smad7 expression also was markedly elevated in mucosal tissue from subjects with CMV colitis and declined after antiviral ganciclovir therapy. Confirming these findings, transfection of Smad7 antisense oligonucleotide into CMV-infected monocytes restored monocyte susceptibility to stromal TGF-β–induced inflammation anergy. Thus, CMV-infected monocytes that recruit to the mucosa, not resident macrophages, are the source of inflammatory macrophages in CMV mucosal disease and implicate Smad7 as a key regulator of, and potential therapeutic target for, CMV mucosal disease.

The effect of U3 snoRNA knockdown on the chondrocyte proteome

Purpose: Osteoarthritis (OA) is the most common age related musculoskeletal disease leading to impairment in movement, with a total of 8.75 million people affected in UK only. During OA cartilage in joints start to deteriorate uncovering underlying bone, the friction of which causes pain. Accounting the studies up to date the mechanisms of cartilage degeneration are still not fully understood. Although, extracellular matrix composes 95% of the hyaline cartilage the only residing cells in the cartilage are chondrocytes. With regard to this, understanding biological processes regulating the homoeostasis of chondrocytes and defining the biomarkers of early OA attracts huge interest. Small nucleolar RNAs (snoRNAs) represent a class of regulatory RNAs, most of which involved in chemical modification of ribosomal RNAs and spliceosomal RNAs. One of the important snoRNA which associated with 18s rRNA maturation is U3, snoRNA binds to 18s pre-RNA in order to cleave 5’ ETS at A0 and A1 sites. Although, U3 possess conservative motives and their functions are similar among eukaryote species, the most of the work was carried out on Xenopus and Saccharomyces cerevisiae. In that context, it was interesting to investigate the role of snoRNAs in human cell lines. For that purpose we choose SW1353 cells, a human chondrosarcoma cell lineage which holds certain similarities with primary human chondrocytes. Methods: SW1353 cells were cultured in phenol red free Dulbecco's Modified Eagle medium supplemented with 10% Fetal bovine serum, 0.2% Amphotericin B, 1% Penicillin-Streptomycin and 1% L-Glutamin. Transfection of U3 antisense oligonucleotide and scrambled oligonucleotide (ASO) was carried out using HiPerfect transfection reagent. Total RNA from cells was extracted using TRIzol reagent and knockdown of U3 was confirmed by qPCR. Proteins of cell lysates and proteins secreted into media of U3 knockdown and scrambled cells were analysed on Q-exactive Orbitrap mass spectrometer. Proteins were identified using Mascot and quantified with ProgenesisQI™ software. Results: Amount of identified proteins derived from cell lysates were in the range of 951 and 473 proteins after adjustment to 1% FDR. Meanwhile, proteins from media showed far less proteins identified, with the highest 41 and the lowest 10 proteins in sample. The number of differently expressed (DE) proteins with at least 2-fold change and p< 0.05 was 124, of which 4 were downregulated in knockdown and 120 upregulated in cell lysate samples. However, media proteins showed difference in only few proteins (p<0.05), namely FLNB, EIF4B, SERPINE2, ALYREF and ECM1, all upregulated in knockdown samples. Among the top molecular and cellular functions in Ingenuity Pathway Analysis, DE proteins were accounted to cell death and survival, with 71 proteins mapped to the aforementioned cellular function. Conclusions: In current study we have showed the importance of U3 snoRNA in homeostasis of SW1353 cells, the knockdown of U3 leads to the upregulation of proteins involved in cell death pathway. Moreover, suppression of U3 expression increased activation in glycolysis pathway, we assume that is to compensate the reduction of mature and functional ribosomes.

Effect of microRNA-128 on cisplatin resistance of glioma SHG-44 cells by targeting JAG1.

This current study intends to investigate the effect of microRNA-128 (miR-128) on cisplatin (DDP) resistance in glioma SHG-44 cells. SHG-44/DDP cells were transfected with miR-128 antisense oligonucleotide (ASO) and assigned into blank, resistance, NC, anti-miR-128, miR-128 mimic, si-JAG1, and anti-miR-128 + si-JAG1 groups. qRT-PCR and Western blotting were employed for determining expression of miR-128, JAG1, Bax and Bcl-2. MTT assay, Giemsa staining, and flow cytometry were applied to detect DDP resistance, cellular morphology, and cell cycle, respectively. JAG1 is targeted and negatively regulated by miR-128. In in vitro experiments, compared with the blank group, the rest groups exhibited declined miR-28 and Bax expression, lowered cell inhibition rate and apoptosis rate, but elevated JAG1 and Bcl-2 expression with cells arrested in the S phase. Compared with the resistance group, the anti-miR-128 group showed decreasedBax expression along with a lowered cell inhibition rate and apoptosis rate, but increased JAG1 and Bcl-2 expression with reduced cells arrested in the S phase; while the miR-128 mimic group showed an opposite trend; the si-JAG1 group showed decreased Bcl-2 expression and reduced cells in the S phase. In in vivo experiments, compared with the resistance group, the tumor growth rate, tumor volume, and weight as well as JAG1 expression accelerated in the anti-miR-128 group; whereas the miR-128 mimic and si-JAG1 groups exhibited an opposite trend. Our findings demonstrated that miR-128 ASO transfection might down-regulate the expression of miR-128 in SHG-44/DDP and up-regulate the DDP resistance in SHG-44/DDP cells, providing a potential treatment target for glioma.

Decreased sorbitol synthesis leads to abnormal stamen development and reduced pollen tube growth via an MYB transcription factor, MdMYB39L, in apple (Malus domestica).

Sugars produced by photosynthesis not only fuel plant growth and development, but may also act as signals to regulate plant growth and development. This work focuses on the role of sorbitol, a sugar alcohol, in flower development and pollen tube growth of apple (Malus domestica). Transgenic 'Greensleeves' apple trees with decreased sorbitol synthesis had abnormal stamen development, a decreased pollen germination rate and reduced pollen tube growth, which were all closely related to lower sorbitol concentrations in stamens. RNA sequencing and quantitative RT-PCR analyses identified reduced transcript levels during stamen development and pollen tube growth in the transgenic trees of a stamen-specific MYB39-like transcription factor, MdMYB39L, and of its putative target genes involved in hexose uptake, cell wall formation and microsporogenesis. Suppressing MdMYB39L expression in pollen via antisense oligonucleotide transfection significantly reduced the expression of its putative target genes and pollen tube growth. Exogenous sorbitol application during flower development partially restored MdMYB39L expression, stamen development, and pollen germination and tube growth of the transgenic trees. Addition of sorbitol to the germination medium also partially restored pollen germination and tube growth of the transgenic trees. We conclude that sorbitol plays an essential role in stamen development and pollen tube growth via MdMYB39L in apple.

Inhibitory effect of bcl-XL antisense oligodeoxynucleotides on the proliferation of colon cancer cells and the growth of human colon cancer xenografts in nude mice

Objective To investigate the effect of bcl-XL antisense oligonucleotide transfection on the proliferation of colon cancer cells and the growth of human colon cancer xenografts in nude mice. Methods A long-term SW620 single cell suspension was prepared for subcutaneous injection in nude mice. Nude mice were randomly divided into 3 groups: control group, N-ODN group and antisense oligonucleotide group (n=5), with an average of 50 mm3. The antisense oligonucleotide group and N-ODN group were injected with 2 ml/kg antisense oligonucleotide or N-ODN, and the control group was injected with equal amount of normal saline. At 16th day after the operation, the tumor cells were taken out, and some tumor tissues were extracted. RNA and protein were extracted. The cationic liposome mediated transfection of antisense oligonucleotide, real-time quantitative polymerase chain reaction (Real-time PCR), Western blotting, methyl thiazol tetrazolium (MTT) method and TdT-mediated dUTP nick end labeling (TUNEL) method were applied to observe the effects of bcl-XL antisense oligonucleotide on the proliferation and apoptosis of colorectal cancer cells in vivo and the growth of human colon cancer xenografts. Results (1) The inhibition rate of cell proliferation activity was gradually increased with the increase of antisense oligonucleotide concentration. When the concentration was over 200 nmol/L, the inhibition rate of cell proliferation was significantly decreased with the difference being statistically significant (t=2.418, 1.531 and 1.838, P=0.003, 0.016 and 0.011). (2) The relative expression levels in the control group, blank control group, N-ODN group and mRNA antisense oligonucleotides group were 0.96±0.25, 0.97±0.48, 0.78±0.32 and 0.41±0.13, the inhibition rate was 0.00%, -6.25%, 18.75% and 57.29%, respectively. There was significant difference between antisense oligonucleotide group and control group, blank control group or N-ODN group (P=0.025). (3) Compared with the control group, there was no significant change in the blank control group; the N-ODN group was slightly lower than that in the control group; the antisense oligonucleotide group was significantly lower (P=0.017). (4) The positive rates of cells in control group, blank control group, N-ODN group and antisense oligonucleotide group were 3.7%, 5.0%, 7.0% and 35.0%, respectively. By statistical analysis, antisense oligonucleotide group and cell control group, blank control group and N-ODN group, the difference was statistically significant (χ2=181.880, P=0.000); cells in the control group, N-ODN group and control group comparison between 22 blank, there was no statistically significant difference (χ2=1.410, P=0.084). (5) There was no significant difference in tumor volume between first groups (P=0.162). On the sixth day, there was significant difference between the antisense oligonucleotide group and the control group (t=2.410, P=0.027). On the eleventh and the 16 day, there was significant difference between the two groups in (P=0.028, 0.016). (6) The expression of bcl-XL gene in the tumor tissues of the 3 groups of nude mice was significantly decreased after antisense oligonucleotide treatment, but the expression of antisense oligonucleotide group was significantly decreased, while the expression of N-ODN in the control group and the control group did not change significantly. Conclusion bcl-XL antisense oligonucleotides can effectively inhibit the proliferation of colon cancer cells and the growth of human colon cancer xenografts in nude mice. To reduce the expression of bcl-XL by antisense oligonucleotides, and to provide the experimental basis for gene therapy of colon cancer. Key words: Colon cancer; Oligonucleotides; Bcl-XL; Proliferation

Abstract 1397: Antisense oligo nucleotide of Annexin A4 improved platinum resistance in ovarian clear cell cancer

Abstract Introduction: Ovarian cancer in Japan are classified as clear cell carcinoma (CCC) more than 20 %, this percentage is higher than in Europe and United States. Besides, it is well known that CCC of ovary is highly resistant to cancer chemotherapy including carboplatin and paclitaxel treatment. We reported that Annexin A4 protein was overexpressed in ovarian CCC tissues by immunohistochemical analysis. Elevated Annexin A4 level has been detected in various epithelial cancer cell lines and have reported associating with chemoresistance to platinum-based cancer drugs. To overcome the platinum chemoresistance, we thought antisense oligonucleotides (ASOs) to be a good therapeutic option in a way of highly specific therapy for improving chemoresistance by suppressing the expression of Annexin A4 in cancer cells. Methods: We generated ASO targeting Annexin A4 with 2’, 4’-bridged nucleic acid. And we analyzed suppression of Annexin A4 in ASO-transfected RMG-I cell line (CCC) in vitro using real time PCR and western blotting. In 16 types of ASOs targeting Annexin A4, 2 ASOs were eligible. Cells were seeded in 96-well plates (2,000 cells per well). Next day, cells were transfected with ASOs using lipofectamine 2000 and were exposed to various concentrations of cisplatin (0 - 100 μM) for 72 hr. Then, drug concentrations resulting in a 50% inhibition of cell growth (IC50 values) were calculated. Intracellular platinum accumulation in Annexin A4 overexpressing cells was analyzed. To assess the improvement of platinum resistance in vivo, we used ICR nu/nu mice xenografted subcutaneously with RMG-I cells. Intraperitoneal injection of cisplatin 3mg/kg after intratumoral administration of ASO 1mg/kg each twice a week were given to xenograft mice. Results: By realtime PCR analysis, among strong 16 types of ASOs targeting Annexin A4, 2 ASOs showed strong knockdown efficiency (about 80% knockdown) compared to negative control ASOs. Western blotting analysis showing knockdown of Annexin A4 expression was observed in Annexin A4 ASO transfected cells compared to no treatment or control ASOs in vitro. ASO-transfected RMG-I cells was less resistant to cisplatin (IC50 = 3.3μM) compared with control cells (IC50 = 5.2μM) Same result were obtained with carboplatin. Platinum resistance was significantly improved in treated with Annexin A4 ASO and cisplatin compared to control ASO and cisplatin treated group in vivo. Conclusion: By transfection of ASOs targeting Annexin A4, platinum resistance have improved in vivo and in vitro, Annexin A4 have associated with efflux of platinum anti-tumor drug. In conclusion, antisense oligonucleotides for Annexin A4 will be a therapeutic option for ovarian clear cell carcinoma with chemoresistance to platinum antitumor drug. Citation Format: Reisa Kakubari, Satoshi Nakagawa, Tadashi Iwamiya, Eiji Kobayashi, Shinnya Matsuzaki, Yutaka Ueda, Kiyoshi Yoshino, Yuya Kasahara, Satoshi Obika, Tadashi Kimura, Satoshi Serada, Tetsuji Naka, Minoru Fujimoto. Antisense oligo nucleotide of Annexin A4 improved platinum resistance in ovarian clear cell cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 1397. doi:10.1158/1538-7445.AM2017-1397

Transfection of Antisense Oligonucleotides Mediated by Cationic Vesicles Based on Non-Ionic Surfactant and Polycations Bearing Quaternary Ammonium Moieties.

Three different ionene polymers with varying quaternary ammonium moieties were used as a proof of concept for the formulation of antisense oligonucleotides, which are capable of inhibiting Renilla luciferase messenger ribonucleic acid (mRNA). Cationic vesicles, consisting of cationic polymer, antisense oligonucleotide (Luc) and non-ionic surfactant polysorbate 80, were investigated regarding their ζ potential, cytotoxicity and transfection efficiency. Deoxyribonucleic acid- (DNA) forming complexes in the presence of cationic vesicles were also investigated in terms of small-angle X-ray scattering (SAXS). The studied cationic vesicles showed very little, if any, toxicity against HeLa cells. Transfection abilities proved to vary strongly depending on the present quaternary ammonium moiety.

Characterization of the MAPK Gene Family and PbrMAPK13 Response to Hormone and Temperature Stresses via Different Expression Pattern in Pyrus ×bretschneideri Pollen

Mitogen-activated protein kinase (MAPK) cascades are universal signal-transduction modules, but the available information is limited in pear (Pyrus). In this study, 87 MAPK genes were identified from five Rosaceae species: chinese white pear (Pyrus ×bretschneideri cv. Dangshansuli), peach (Prunus persica), apple (Malus domestica), strawberry (Fragaria vesca), and plum (Prunus mume), 23 of which came from chinese white pear, designated as PbrMAPK. Based on the phylogenetic analysis and the architectures of conserved protein motifs of these gene sequences, MAPK family genes of five Rosaceae species were classified into two primary types (I and II) or four groups (Classes A–D). We have indicated that both segment and tandem duplications significantly contributed to the expansion of the MAPK family in Rosaceae by analysis of genomic evolution. In chinese white pear pollen, the expression analysis revealed that all PbrMAPKs could respond to temperature stresses (high/low temperature) and phytohormones, except PbrMAPK8 and PbrMAPK19 that displayed lower expressions, which suggested that PbrMAPKs play pivotal roles in signal-transduction pathways. In addition, we determined that PbrMAPK13 is located in the nucleus and plasma membranes. The lengths of pollen tubes became shorter when PbrMAPK13 was silenced by antisense oligonucleotide transfection. Our results provided an evolutionary foundation and functional characterization for MAPK gene families in chinese white pear and other plant species so as to elucidate their biological roles.

A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer

Dihydrofolate reductase (DHFR) plays a key role in folate metabolism and is a target molecule of methotrexate. An increase in the cellular expression level of DHFR is one of the mechanisms of tumor resistance to methotrexate. The present study investigated the possibility that adenosine-to-inosine RNA editing, which causes nucleotide conversion by adenosine deaminase acting on RNA (ADAR) enzymes, might modulate DHFR expression. In human breast adenocarcinoma-derived MCF-7 cells, 26 RNA editing sites were identified in the 3'-UTR of DHFR. Knockdown of ADAR1 decreased the RNA editing levels of DHFR and resulted in a decrease in the DHFR mRNA and protein levels, indicating that ADAR1 up-regulates DHFR expression. Using a computational analysis, miR-25-3p and miR-125a-3p were predicted to bind to the non-edited 3'-UTR of DHFR but not to the edited sequence. The decrease in DHFR expression by the knockdown of ADAR1 was restored by transfection of antisense oligonucleotides for these miRNAs, suggesting that RNA editing mediated up-regulation of DHFR requires the function of these miRNAs. Interestingly, we observed that the knockdown of ADAR1 decreased cell viability and increased the sensitivity of MCF-7 cells to methotrexate. ADAR1 expression levels and the RNA editing levels in the 3'-UTR of DHFR in breast cancer tissues were higher than those in adjacent normal tissues. Collectively, the present study demonstrated that ADAR1 positively regulates the expression of DHFR by editing the miR-25-3p and miR-125a-3p binding sites in the 3'-UTR of DHFR, enhancing cellular proliferation and resistance to methotrexate.

Disarmed anthrax toxin delivers antisense oligonucleotides and siRNA with high efficiency and low toxicity

Inefficient cytosolic delivery and vector toxicity contribute to the limited use of antisense oligonucleotides (ASOs) and siRNA as therapeutics. As anthrax toxin (Atx) accesses the cytosol, the purpose of this study was to evaluate the potential of disarmed Atx to deliver either ASOs or siRNA. We hypothesized that this delivery strategy would facilitate improved transfection efficiency while eliminating the toxicity seen for many vectors due to membrane destabilization. Atx complex formation with ASOs or siRNA was achieved via the in-frame fusion of either Saccharomyces cerevisiae GAL4 or Homo sapien sapien PKR (respectively) to a truncation of Atx lethal factor (LFn), which were used with Atx protective antigen (PA). Western immunoblotting confirmed the production of: LFN-GAL4, LFn-PKR and PA which were detected at ~45.9kDa, ~37kDa, and ~83kDa respectively and small angle neutron scattering confirmed the ability of PA to form an annular structure with a radius of gyration of 7.0±1.0nm when placed in serum. In order to form a complex with LFn-GAL4, ASOs were engineered to contain a double-stranded region, and a cell free in vitro translation assay demonstrated that no loss of antisense activity above 30pmol ASO was evident. The in vitro toxicity of both PA:LFn-GAL4:ASO and PA:LFn-PKR:siRNA complexes was low (IC50>100μg/mL in HeLa and Vero cells) and subcellular fractionation in conjunction with microscopy confirmed the detection of LFn-GAL4 or LFn-PKR in the cytosol. Syntaxin5 (Synt5) was used as a model target gene to determine pharmacological activity. The PA:LFn-GAL4:ASO complexes had transfection efficiency approximately equivalent to Nucleofection® over a variety of ASO concentrations (24h post-transfection) and during a 72h time course. In HeLa cells, at 200pmol ASO (with PA:LFN-GAL4), 5.4±2.0% Synt5 expression was evident relative to an untreated control after 24h. Using 200pmol ASOs, Nucleofection® reduced Synt5 expression to 8.1±2.1% after 24h. PA:LFn-GAL4:ASO transfection of non- or terminally-differentiated THP-1 cells and Vero cells resulted in 35.2±19.1%, 36.4±1.8% and 22.9±6.9% (respectively) Synt5 expression after treatment with 200pmol of ASO and demonstrated versatility. Nucleofection® with Stealth RNAi™ siRNA reduced HeLa Synt5 levels to 4.6±6.1% whereas treatment with the PA:LFn-PKR:siRNA resulted in 8.5±3.4% Synt5 expression after 24h (HeLa cells). These studies report for the first time an ASO and RNAi delivery system based upon protein toxin architecture that is devoid of polycations. This system may utilize regulated membrane back-fusion for the cytosolic delivery of ASOs and siRNA, which would account for the lack of toxicity observed. High delivery efficiency suggests further in vivo evaluation is warranted.

MiR-940 Inhibited Pancreatic Ductal Adenocarcinoma Growth by Targeting MyD88

Background: Pancreatic ductal adenocarcinoma (PDAC) is an almost universally lethal disease. Deregulation or dysfunction of miRNAs contribute to cancer development. The role of miR-940 in PDAC remains unclear. Methods: The level of miR-940 in PDAC tissues and cell lines was measured by qRT-PCR. MiR-940 was over-expressed by miRNAs mimics transfection and reduced by miRNAs antisense oligonucleotides (ASO) transfection. Cell proliferation was analyzed by MTT assay and cell apoptosis was evaluated by FACS analysis. Targeted genes were predicted by a bioinformatics algorithm and confirmed by a dual luciferase reporter assay. Myeloid differentiation primary response gene (88) (MyD88) protein level was assayed by immunohistochemistry and Western blot analysis. Results: Low miR-940 level and high MyD88 protein level in PDAC tissues were both correlated with low survival rate. Up-regulation of miR-940 inhibited PDAC cell lines growth while down-regulation induced cell growth. The 3' UTR of MyD88 was targeted by miR-940. Conclusions: Low level of miR-940 and high level of MyD88 in PDAC promoted PDAC cells growth which might be related to the low survival rate of PDAC patients. MiR-940 exerted its effect by targeting MyD88.

MiR-429 inhibits oral squamous cell carcinoma growth by targeting ZEB1.

BackgroundOral squamous cell carcinoma (OSCC) is the sixth most common human malignancy worldwide. To develop new therapeutics requires elucidation of the underlying mechanism of OSCC pathogenesis. The role of miR-429 in OSCC remains unknown.Material/MethodsThe level of miR-429 and ZEB1 in OSCC tissues and cell lines was measured by qRT-PCR. MiR-429 was down-regulated by miRNAs antisense oligonucleotides (ASO) transfection and up-regulated by miRNAs mimics. Cell proliferation was analyzed by MTT assay. Cell apoptosis was revealed by FACS analysis. Targeted genes were predicted by a bioinformatics algorithm and confirmed by a dual luciferase reporter assay.ResultsMiR-429 was down-regulated in OSCC tissues, and miR-429 overexpression inhibited OSCC cell lines growth and vice versa. Further, we found that miR-429 could inhibit zinc finger E-boxbinding homeobox 1 (ZEB1) expression, and that miR-429 and ZEB1 expression in OSCC tissues were negatively correlated.ConclusionsOur data demonstrate the tumor suppressor role of miR-429 in OSCC, and may provide a potential therapeutic target that warrants further investigation.

MicroRNA-100 functions as a tumor suppressor by inhibiting Lgr5 expression in colon cancer cells

Previous studies have demonstrated that microRNAs (miRNAs), a class of single‑stranded RNA molecules that are 18‑27 nucleotides in length, serve a critical function in tumorigenesis, including in the development of colon cancer. In the current study, miR‑100 levels were demonstrated to be reduced in colon cancer tissues compared with the levels in matched adjacent normal tissues. Forced overexpression of miR‑100 by transfection with miR‑100 mimics substantially inhibited the proliferation, migration and invasion of SW480 and HCT116 cells, whereas reduced expression, resulting from transfection of antisense oligonucleotides, promoted these processes. At the molecular level, miR‑100 was observed to reduce the levels of leucine‑rich repeat‑containing G protein‑coupled receptor 5 (Lgr5), by binding to its 3'‑untranslated region. As a result of this, Wnt/β‑catenin signaling was affected by fluctuations in the level of miR‑100 mimics or antisense. Collectively, the results of the current study elucidate a novel regulatory pathway involving miR‑100 and Lgr5 in colon cancer cells, which may present a potential therapeutic target.