Toxic Tall Fescue Research Articles

281 Changes in satellite cell number in maternal and fetal muscle with 5-hydroxy tryptophan supplementation during late gestation

Abstract Toxic tall fescue contains ergot alkaloids, which induce vasoconstriction in livestock, leading to fescue toxicosis. This condition can impact muscle development due to altered blood flow. Supplementation with 5-HTP may counteract the vasoconstrictive effects of fescue alkaloids. We aimed to investigate the influence of 5-HTP supplementation on satellite cells, myoblast, and preadipocyte numbers in maternal and fetal muscle during late gestation in Suffolk ewes. We hypothesized that 5-HTP supplementation would mitigate the effects of fescue toxicosis on muscle cell populations, potentially promoting muscle development and regeneration in maternal and fetal tissues. Suffolk ewes (n = 75), naïve to toxic tall fescue, were blocked by body condition score and body weight into 10 groups for synchronization. Ewes were confirmed pregnant using transabdominal ultrasound, and lamb number was estimated at gestational day (gd) 60. Pregnant ewes carrying twins (n = 30) were randomly assigned to one of three treatments: 1) negative control (CON, n = 10), 2) toxic tall fescue seed containing 1.77 mg ewe-1ּ d-1 ergovaline/ergovalinine plus 5-HTP (2.5 mg/kg BW) supplement (5HTP, n = 10), or 3) positive control, fed toxic tall fescue seed containing 1.77 mg ewe-1ּ d-1 ergovaline/ergovalinine (E+, n = 10). Ewes were individually fed a total mixed ration from gd 78 to gd 85 of pregnancy and then TMR plus treatment (CON, E+ or 5HTP) from gd 86 to d 111. On gd 112, terminal necropsies were performed, and semimembranosus muscle (SM) from the ewe and fetus was removed. Weights were obtained, and then samples were digested using pronase (1.5mg/mL) to isolate preadipocyte (PP1), myoblasts (PP2) and satellite cell (PP3) fractions using a pre-plating technique. Cells were quantified using a Neubauer-hemocytometer and trypan blue to also assess cell viability and changes in cell number. Fetal SM had a greater (P < 0.05) number of pre-adipocytes, myoblasts, and satellite cells per gram of tissue digested in comparison with the ewes. Pre-adipocyte and myoblast number per gram of tissue digested did not differ (P > 0.05) by treatment. The 5HTP group had the greater (P < 0.05) number of satellite cells per gram of tissue digested in comparison with the CON group. Satellite cell numbers tended (P < 0.10) to be greater in the 5HTP group in comparison to the E+ group. Satellite cell numbers from CON and E+ treatment groups did not differ (P > 0.05). In conclusion, 5-HTP supplementation during late gestation in Suffolk ewes exposed to toxic tall fescue significantly increased satellite cell numbers in maternal and fetal muscle tissues. This suggests a potential mitigation of the impact of fescue toxicosis on muscle cell populations.

Ruminal ergovaline and volatile fatty acid dynamics: Association with poor performance and a key growth regulator in steers grazing toxic tall fescue

Fescue toxicosis (FT) is produced by an ergot alkaloid (i.e., ergovaline [EV])-producing fungus residing in toxic fescue plants. Associations between EV, decreased weight gain and ruminal volatile fatty acids are unclear. Feces, rumen fluid, and blood were collected from 12 steers that grazed non-toxic (NT) or toxic (E +) fescue for 28 days. The E + group exhibited decreased propionate (P), increased acetate (A), and increased ruminal A:P ratio, with similar trends in feces. Plasma GASP-1 (G-Protein-Coupled-Receptor-Associated-Sorting-Protein), a myostatin inhibitor, decreased (day 14) only in E + steers. Ergovaline was present only in E + ruminal fluid and peaked on day 14. The lower ruminal propionate and higher A:P ratio might contribute to FT while reduced GASP-1 might be a new mechanism linked to E + -related weight gain reduction. Day 14 ergovaline zenith likely reflects ruminal adaptations favoring EV breakdown and its presence only in rumen points to local, rather than systemic effects.

PSVI-5 Using Red Clover Extract to Mitigate Tall Fescue Toxicosis

Abstract Tall fescue toxicosis is caused by ergot alkaloids produced by the fungus Neotyphodium coenophialum that resides within the majority of the tall fescue plants in the Southeastern and lower Midwestern US. Tall fescue (Festuca arundinacea) toxicosis is estimated to cost livestock producers over $1 billion dollars annually through reduced growth and reproductive performance. Improvements in performance by cattle grazing toxic tall fescue can have substantial economic advantages for livestock producers throughout the tall fescue region. Numerous methods to mitigate tall fescue toxicosis have been tried over the past 60+ years, but a practical solution to this problem has not been discovered to date. Forages used to dilute fescue include clovers which will not compete on much of the marginal sites that tall fescue predominates. As mentioned above, clovers have been used to dilute toxic fescue and have shown to be a good mitigation strategy if the clovers persist. Red clover extract (RCE) has shown promise in the mitigation of symptoms related to tall fescue toxicosis, but effective dosages have not yet been determined to date. Dorper ewe and wether lambs (n = 30, 34 ± 0.97 kg initial BW) were weighed and assigned randomly to one of five diets in a 2-period study. Diets consisted of a positive control of non-toxic tall fescue seed with no RCE (CONT), a negative control of toxic tall fescue seed with no RCE (E+0) and toxic tall fescue seed with RCE supplemented at 0.33 (E+33), 0.67 (E+67), and 1 (E+100) percent of the diet. Fescue seed was mixed with liquid molasses to ensure consumption, and seed, DDGS and RCE was offered at approximately 0800 and 1600 h, and bermudagrass hay was offered for ad libitum consumption. Lambs were housed in individual 1 × 1.5 m pens in an enclosed building where temperature was maintained at 27° C (80° F). The animal had an ad libitum access to water. Each period consisted of a 14-day adaptation period followed by 7 d of total fecal and urine collection. Diets were offered for ad libitum consumption during the first 12 days of each period and then held constant during the remaining 9 days. Dry matter (DM) and organic matter (OM) intake was greater (P < 0.05) from CONT than all other treatments and E+33 was greater (P < 0.05) than E+10 and E+67. Digestibility of DM and OM were greater (P < 0.05) from CONT than all other treatments. By contrast, the diets did not influence (P > 0.05) nitrogen balance, urinary nitrogen losses, fecal nitrogen losses and nitrogen retained. Overall, results demonstrated that RCE inclusion into the diet of toxic tall fescue did not significantly change growth and performance parameters in sheep.

Replacing Toxic Tall Fescue With a Nontoxic Forage

Tall fescue is among the most popular cool‐season pasture grasses in the United States and is widely grown in other countries with temperate climates. In the United States, nearly all tall fescue pastures planted before 1980 are infected with Epichloë coenophialum, a microscopic fungus. The common strain of this fungus produces toxins called “ergot alkaloids,” such as ergovaline. These ergot alkaloids cause fescue toxicosis, a severe livestock disorder that costs U.S. livestock producers at least $1 billion each year. At present, there is no medical cure for fescue toxicosis. There are, however, proven management strategies that lessen the effect of toxicosis. One is the replacement of toxic tall fescue with varieties that are endophyte‐free or contain novel endophytes. Earn 1 CEU in Integrated Pest Management by reading this article and taking the quiz at https://web.sciencesocieties.org/Learning‐Center/Courses.

Cover Image, Volume 56, Issue 3

Crops & SoilsVolume 56, Issue 3 p. i-i COVER IMAGEFree Access Cover Image, Volume 56, Issue 3 First published: 12 May 2023 https://doi.org/10.1002/crso.20280AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Graphical Abstract Tall fescue is among the most popular cool-season pasture grasses in the United States and is widely grown in other countries with temperate climates. In the United States, nearly all tall fescue pastures planted before 1980 are infected with Epichloë coenophialum, a microscopic fungus. The common strain of this fungus produces toxins called “ergot alkaloids,” such as ergovaline. These ergot alkaloids cause fescue toxicosis, a severe livestock disorder that costs U.S. livestock producers at least $1 billion each year. At present, there is no medical cure for fescue toxicosis. There are, however, proven management strategies that lessen the effect of toxicosis. One is the replacement of toxic tall fescue with varieties that are endophyte-free or contain novel endophytes. See page 4. Photo courtesy of Adobe Stock/jackienix. Volume56, Issue3May–June 2023Pages i-i RelatedInformation

Integrative interactomics applied to bovine fescue toxicosis

Bovine fescue toxicosis (FT) is caused by grazing ergot alkaloid-producing endophyte (Epichloë coenophiala)-infected tall fescue. Endophyte’s effects on the animal’s microbiota and metabolism were investigated recently, but its effects in planta or on the plant–animal interactions have not been considered. We examined multi-compartment microbiota–metabolome perturbations using multi-‘omics (16S and ITS2 sequencing, plus untargeted metabolomics) in Angus steers grazing non-toxic (Max-Q) or toxic (E+) tall fescue for 28 days and in E+ plants. E+ altered the plant/animal microbiota, decreasing most ruminal fungi, with mixed effects on rumen bacteria and fecal microbiota. Metabolic perturbations occurred in all matrices, with some plant-animal overlap (e.g., Vitamin B6 metabolism). Integrative interactomics revealed unique E+ network constituents. Only E+ had ruminal solids OTUs within the network and fecal fungal OTUs in E+ had unique taxa (e.g., Anaeromyces). Three E+-unique urinary metabolites that could be potential biomarkers of FT and targeted therapeutically were identified.

Effects of Tall Fescue Endophyte Type and Dopamine Receptor D2 Genotype on Cow-Calf Performance during Late Gestation and Early Lactation.

Grazing endophyte-infected, toxic tall fescue reduces cow/calf production; therefore, this study examines alternate strategies such as use of novel endophyte fescue varieties during late gestation and early lactation or genetic selection of resistant cows. Pregnant cows (n = 75) were randomly assigned to fescue endophyte type: 1) endophyte-infected ergot alkaloid producing tall fescue (E+) or 2) novel endophyte-infected, non-toxic tall fescue (NOV) within maternal (A|A, n = 38 and G|G, n = 37) DRD2 genotype to examine changes in cow/calf performance and milk production during late gestation and early lactation. Grazing E+ fescue pastures during late gestation reduced cow body weight gain but did not alter calf birth weight compared to NOV. Milk production and calf ADG during the first 30 day of lactation were lower for E+ than NOV. The calving rate was reduced, but not calving interval for E+ cows. The adjusted 205-day weight of calves was lower in those grazing E+ with their dams compared to NOV. There were no interactions between DRD2 genotype and fescue endophyte type indicating that genotype was not associated with response to E+ fescue in this study. Overall, grazing NOV tall fescue pastures rather than E+ during critical stages of production improved cow gain during late gestation, calving rate, early milk production and calf growth.

94 Genetic basis of blood traits in beef cattle and their relationship to production traits at weaning

Abstract Disease represents one of the main factors that determine profitability in animal production. Previous research has observed significant correlations between blood cell counts and the animal’s health status. We hypothesize that blood cell traits may be an effective indicator of performance in beef cattle. Complete blood counts were recorded from approximately 500 crossbred animals at weaning (Angus background crossed with Hereford, Charolais, Sim-Angus, Brangus) born between 2015 and 2016 and raised on toxic or novel tall fescue on three different farms. The animals were genotyped at an approximate density of 50,000 SNPs and the genotypes were imputed to an approximate density of 200,000 SNPs. Heritability, genetic and phenotypic correlations were estimated for 15 blood and 4 production traits across and within environments. Finally, with the objective of identifying the genetic basis underlying the different blood traits, a genome wide association study (GWAS) was performed for all traits. Heritability estimates ranged from 0.11 to 0.60, and generally weak phenotypic correlations and strong genetic correlations were found, however these parameters varied across environments, pointing to GxE interactions. GWAS identified 90 1 Mb windows that explained 0.5% or more of the estimated genetic variance for at least 1 trait with 21 windows overlapping two or more traits. Further research efforts include identifying underlying candidate genes for traits and comparing toxic and novel fescue effects on blood traits. It appears that blood traits have weak phenotypic correlations but strong genetic correlations among themselves, as evidenced by important overlapping regions of genetic control for similar blood traits. However, blood traits have limited potential as indicator traits for productivity.

Toxic tall fescue grazing increases susceptibility of the Angus steer fecal microbiota and plasma/urine metabolome to environmental effects

Impaired thermoregulation and lowered average daily gains (ADG) result when livestock graze toxic endophyte (Epichloë coenophialum)-infected tall fescue (E+) and are hallmark signs of fescue toxicosis (FT), a disease exacerbated by increased temperature and humidity (+temperature-humidity index; +THI). We previously reported FT is associated with metabolic and microbiota perturbations under thermoneutral conditions; here, we assessed the influence of E+ grazing and +THI on the microbiota:metabolome interactions. Using high-resolution metabolomics and 16S rRNA gene sequencing, plasma/urine metabolomes and the fecal microbiota of Angus steers grazing non-toxic or E+ tall fescue were evaluated in the context of +THI. E+ grazing affected the fecal microbiota profile; +THI conditions modulated the microbiota only in E+ steers. E+ also perturbed many metabolic pathways, namely amino acid and inflammation-related metabolism; +THI affected these pathways only in E+ steers. Integrative analyses revealed the E+ microbiota correlated and co-varied with the metabolomes in a THI-dependent manner. Operational taxonomic units in the families Peptococcaceae, Clostridiaceae, and Ruminococcaceae correlated with production parameters (e.g., ADG) and with multiple plasma/urine metabolic features, providing putative FT biomarkers and/or targets for the development of FT therapeutics. Overall, this study suggests that E+ grazing increases Angus steer susceptibility to +THI, and offers possible targets for FT interventions.

173 The effects of Fescue EMTTM Mineral Defense on stocker heifer growth while grazing tall fescue

Abstract Previous research demonstrates grazing tall fescue can decrease reproductive performance and weight gain in cattle. The objective of this study was to evaluate Fescue EMTTM Mineral Defense (Cargill Animal Nutrition, Minneapolis, MN) on summer weight gain in cattle grazing tall fescue pastures in SW Missouri. Heifers (n = 120; initial BW = 236 ± 2.5 kg) were stratified by weight to replicated tall fescue pastures to either a control mineral treatment or Fescue EMT™ Mineral Defense treatment. Forage availability was estimated weekly by ultrasonic sensor. Pasture samples were collected every 21 d and analyzed for ergovaline concentrations. Heifer weights and blood prolactin were measured throughout the trial. Average daily mineral consumption was calculated by mineral offered less residual. Data were analyzed on a pen-mean basis as a completely randomized design using JMP with 6 pens/ treatment and 10 heifers/pen. Prolactin was analyzed as Repeated Measures in JMP. Initial weights between treatments were not different (P > 0.05). Endophyte infection measured 75% or greater in all pastures. No differences were detected in pasture ergovaline (149 ± 19 µg/kg) or pasture availability (2,600 ± 150 kg/ha) between treatments (P > 0.20 at each sampling). Heifer ADG consuming Fescue EMT™ Mineral Defense compared to control mineral was greater at 0.28 kg versus 0.22 kg resulting in total gains of 21.8 kg versus 16.6 kg, respectively (P < 0.05). However, blood prolactin numerically decreased over time in both treatments. Results from this trial demonstrate a 31% improvement in weight gain for cattle consuming Fescue EMTTM Mineral Defense compared with cattle consuming a control mineral while grazing toxic tall fescue.

Response of Beef Cattle Fecal Microbiota to Grazing on Toxic Tall Fescue.

Tall fescue, the predominant southeastern United States cool-season forage grass, frequently becomes infected with an ergot alkaloid-producing toxic endophyte, Epichloë coenophialum Consumption of endophyte-infected fescue results in fescue toxicosis (FT), a condition that lowers beef cow productivity. Limited data on the influence of ergot alkaloids on rumen fermentation profiles or ruminal bacteria that could degrade the ergot alkaloids are available, but how FT influences the grazing bovine fecal microbiota or what role fecal microbiota might play in FT etiology and associated production losses has yet to be investigated. Here, we used 16S rRNA gene sequencing of fecal samples from weaned Angus steers grazing toxic endophyte-infected (E+; n = 6) or nontoxic (Max-Q; n = 6) tall fescue before and 1, 2, 14, and 28 days after pasture assignment. Bacteria in the Firmicutes and Bacteroidetes phyla comprised 90% of the Max-Q and E+ steer fecal microbiota throughout the trial. Early decreases in the Erysipelotrichaceae family and delayed increases of the Ruminococcaceae and Lachnospiraceae families were among the major effects of E+ grazing. E+ also increased abundances within the Planctomycetes, Chloroflexi, and Proteobacteria phyla and the Clostridiaceae family. Multiple operational taxonomic units classified as Ruminococcaceae and Lachnospiraceae were correlated negatively with weight gains (lower in E+) and positively with respiration rates (increased by E+). These data provide insights into how E+ grazing alters the Angus steer microbiota and the relationship of fecal microbiota dynamics with FT.IMPORTANCE Consumption of E+ tall fescue has an estimated annual $1 billion negative impact on the U.S. beef industry, with one driver of these costs being lowered weight gains. As global agricultural demand continues to grow, mitigating production losses resulting from grazing the predominant southeastern United States forage grass is of great value. Our investigation of the effects of E+ grazing on the fecal microbiota furthers our understanding of bovine fescue toxicosis in a real-world grazing production setting and provides a starting point for identifying easy-to-access fecal bacteria that could serve as potential biomarkers of animal productivity and/or FT severity for tall fescue-grazing livestock.

Eradication of the fungus Epichloë coenophiala from Schedonorus arundinaceus (tall fescue) seeds by interrupting the vertical transmission process

Tall fescue is usually infected by a fungal endophyte, responsible of livestock intoxication due to fungal alkaloids. An endophyte fungus grows in the apoplast of aboveground tissues and is vertically transmitted through the seeds. Disinfecting plants or clones not only is useful as a way of eliminating a dangerous microorganism from cultivars, but also for experimental purposes. However, not all fungicides are effective, and if they are, a waiting period must be respected in order to avoid confounding effects of the endophyte and the treatment. We subjected plants (ramets from four genotypes) to different doses of two fungicides, Almagor® (Triazole + Imidazole) and Amistar® (Methoxy-acrylate), and evaluated the endophyte persistence. Fungicides were pipette-poured on pseudostems’ bases of each plant. Endophytic status was diagnosed in tillers that received the fungicide and in the new tillers produced by the plants and seeds. While Amistar® had no detectable effect, Almagor® was 100% effective at all doses. The latter interrupted the vertical-transmission processes (5400 evaluated seeds were endophyte-free). Phytotoxic effects were not observed in seeds. Proportion of normal and abnormal seedlings depended only on plant genotype. Almagor® was effective in stopping the fungus from growing into reproductive buds when apical meristems were down on the bases. Use of Almagor® is promising on old pastures dominated by toxic tall fescue, with the purpose of enriching the soil seed-bank with endophyte-free seeds.https://doi.org/10.25260/EA.19.29.1.0.764

BILL E. KUNKLE INTERDISCIPLINARY BEEF SYMPOSIUM: A meta-analysis of research efforts aimed at reducing the impact of fescue toxicosis on cattle weight gain and feed intake.

The objective of this paper is to present a systematic review and meta-analysis of research efforts aimed at recovering cattle production losses attributed to toxic endophyte-infected [ (Morgan-Jones & Gams.) Glenn, Bacon, & Hanlin comb. Nov.] tall fescue [ (Schreb.) Darbysh.]. The strategies presented include those 1) applied with forage systems, 2) based on pharmacological compounds and functional foods, and 3) based on supplemental dietary nutrients. Cattle BW gain and DM intake was the dependent response evaluated. Among the forage systems reviewed, studies with nontoxic, endophyte-infected tall fescue as a total replacement forage system demonstrated the greatest improvement in per-hectare (152 ± 27.5 kg/ha) and per-animal (0.29 ± 0.03 kg/d) BW gain. Studies with interseeded legumes have exhibited a small and highly variable BW gain effect size per hectare (52 ± 24.1 kg/ha) and per animal (0.11 ± 0.03 kg/d). The legume response was seasonal, with summer exhibiting the greatest benefit. Studies with chemicals that suppress plant growth demonstrated BW gain responses (0.17 ± 0.06 kg/d) equal to or greater than the response observed with legume studies. Cattle grazing toxic tall fescue responded well to anthelmentics, antimicrobial feed additives, and steroid implants, and the use of these technologies may additively help recover production losses. As a group, functional foods have not improved BW gain ( = 0.85). Studies with cattle supplemented with highly digestible fiber supplements observed a 0.15 kg greater BW gain compared with studies using starch- and sugar-based supplements ( < 0.05). Weight gain was positively impacted by the level of supplementation (0.06 kg/DM intake as percent BW). Supplement feed conversion was estimated at 6:1 for the highly digestible fiber supplements compared with 11:1 for starch-based supplements. Tall fescue forage DM intake was predicted to maximize at a supplemental feeding rate of 0.24% BW with a breakpoint at 0.5% BW, and total maximum DM intake (forage plus supplement) occurred at 2.7% BW when supplemental feeding approached 0.9% BW. Results from this meta-analysis should be useful for 1) establishing and comparing measured responses to theoretical improvements in BW gain when additive strategies are considered, 2) research planning, and 3) producer education.

Bulls grazing Kentucky 31 tall fescue exhibit impaired growth, semen quality, and decreased semen freezing potential

Serum prolactin (PRL) and testosterone concentrations, body weight, body composition, semen quality, and semen freezing potential for bulls grazing the toxic tall fescue (Lolium arundinaceum [Schreb.] Darbysh. = Schedonorous arundinaceum [Schreb.] Dumort.) cultivar Kentucky 31 (E+) compared with a novel endophyte cultivar lacking ergot alkaloids (E−) were evaluated. Angus bulls were allotted to treatment (Day 0) and grazed E+ or E− for 155 days. Treatment-by-day interaction was significant (P < 0.05) for serum PRL concentrations with E+treated bulls exhibiting reduced PRL values compared with E− control bulls, but no differences were observed for serum testosterone concentrations (P > 0.05). Further, bulls on the E+ treatment exhibited decreased total gain, average daily gain, and body weight by Day 140 (P < 0.05) compared with the E− bulls. Rump muscle depth was lower because the treatment in bulls grazing E+ compared with E− (P < 0.05) and intramuscular fat in the E− bulls compared with the E+ group was higher by Day 155 (P < 0.05). Analysis of ejaculates showed significant treatment × day effects for sperm concentration with lower values observed for bulls on the E+ treatment (P < 0.05). The percent normal morphology was reduced in ejaculates from E+ bulls compared with E− bulls (P < 0.05), and the difference was due to an increase in abnormal sperm present in the E+ ejaculates from Day 84 to 140 (P < 0.05). In addition, spermatozoa motility and progressive motility were decreased on thawing in semen samples from E+ bulls compared with E− bulls (P < 0.05).

Effects of fescue toxicosis on bull growth, semen characteristics, and breeding soundness evaluation1

Tall fescue possesses heat, drought, and pest resistance conferred to the plant by its mutualistic relationship with the ergot alkaloid producing fungal endophyte, Neotyphodium coenophialum. The objective of this study was to evaluate the impact of ergot alkaloid consumption on growth, scrotal circumference (SC), and semen quality. The SC measurement and percentage of motile and normal sperm were used to determine if a bull passed the breeding soundness exam (BSE) requirements. Bulls (n = 14) between 13 and 16 mo of age exhibiting ≥32 cm SC and having passed a BSE were assigned to 1 of 2 dietary treatments accounting for BCS and BW. Bulls were fed the treatment diet containing toxic tall fescue seed (E+; 0.8 μg of ergovaline and ergovalanine/g DM) or the control diet containing endophyte-free nontoxic tall fescue seed (E-) for 126 d. Blood samples were collected and BSE and BCS accessed at the start of the test (d 0) and every 21 d to the end of test (d 126). Weights were obtained on d 0 and d 126. Serum prolactin (PRL) concentrations were affected by treatment × day interactions (P = 0.04) verifying the effectiveness of the E+ diet. Bulls consuming the E+ diet exhibited declining PRL concentrations from 250 ± 52.1 ng/mL on d 0 to 30.6 ± 46.9 ng/mL by d 126 whereas bulls receiving the E- ration maintained serum PRL concentrations greater than or equal to 226.7 ± 50.4 ng/mL across the 126-d study. Body condition score (P = 0.4) and BW (P = 0.4) were not different between treatments. No difference due to treatment was observed for the percentage of bulls passing a standard BSE exam (P = 0.6) and no treatment effect was observed for any semen characteristic measured by computer-assisted semen analysis (CASA; P ≥ 0.2). The SC was negatively affected by treatment × day interaction (P = 0.04) with E- bulls exhibiting a larger SC at d 126 compared with E+ bulls of 36.7 ± 0.8 versus 34.3 ± 0.8 cm, respectively. Within treatment, E+ bulls exhibited a decrease in SC (P = 0.0001) with a d 0 SC of 37.3 ± 0.8 cm and dropping to 34.3 ± 0.8 by d 126. Theoretically, reduced SC would negatively impact semen quality, but this was not observed. However, CASA and BSE evaluation data are consistent with recent reports indicating that bulls grazing E+ tall fescue exhibited only subtle, if any, differences on semen characteristics.

2011 AND 2012 EARLY CAREERS ACHIEVEMENT AWARDS: Improving the production, environmental, and economic efficiency of the stocker cattle industry in the southeastern United States1,2

Grazing forages on small-grain fields can be a profitable "second crop" for grain producers and an opportunity for cow-calf producers to retain ownership of weaned calves. The increasing costs of conventional tillage and movement of soil nutrients into surface water creates a need for more sustainable production practices to be incorporated by producers into wheat pasture production systems. Research at the Livestock and Forestry Research Station near Batesville, AR, and the Southwest Research and Extension Center near Hope, AR, has been conducted over a 9-yr span to characterize the impacts of pasture systems on forage production, animal performance, soil quality, water runoff, and the economics associated with the stocker cattle enterprises. Gains of growing cattle grazing nontoxic endophyte-infected tall fescue and small-grain forages can be increased by 80 and 150%, respectively, compared with grazing Bermuda grass or toxic endophyte-infected tall fescue. Producers grazing spring-calving cowherds can use these improved forages to accelerate stocker performance when retaining calves in the fall and improve net returns by 99% with winter annual or nontoxic tall fescue production systems compared with Bermuda grass or toxic tall fescue. Rainfall simulation of small grain pastures indicates that runoff volume and nutrient load does not differ between conventionally tilled fields and no-till fields in the spring before tillage when soil surface cover is similar. In the fall after tillage, however, conventionally tilled fields had 4 times greater runoff; hence, there was 1.9 times greater N runoff and 3.2 times greater P runoff in conventionally tilled fields compared with no-till. Total natural rainfall runoff from conventionally tilled wheat fields were 2 times greater than from no-till fields with 25 mm rainfall events yet were 4 times greater with 62-mm rainfall events. Soil analysis shows that soil aggregate content was greater in no-till compared with conventional till, indicating greater soil porosity, improved water infiltration rate, and reduced erositivity of soil. Carbon concentration in no-till soils was 50% greater than conventional tillage after 9 yr. These experiments show that production systems can be designed that maintain livestock production, increase soil quality, reduce nutrient discharge, and promote improved economic returns.

Constriction of bovine vasculature caused by endophyte-infected tall fescue seed extract is similar to pure ergovaline1,2

Ergovaline has been extensively used to study vasoactive effects of endophyte- (Neotyphodium coenophialum) infected tall fescue (Lolium arundinaceum). However, initial results indicated that an extract of toxic tall fescue seed (E+EXT) is more potent than ergovaline alone in a right ruminal artery and vein bioassay. The E+EXT induced a greater contractile response than an equal concentration of ergovaline alone in the ruminal artery of heifers (P = 0.018). This led to a hypothesis that other compounds in the seed extract contribute to vasoconstriction. Thus, experiments were conducted to determine if vasoactivity of an E+EXT is different from a mixture of ergot alkaloids (ALK; ergovaline, ergotamine, ergocristine, ergocryptine, ergocornine, ergonovine, and lysergic acid) of similar concentrations and to determine if the vasoactivity of an E+EXT differs from an endophyte-free tall fescue seed extract (E-EXT). Segments of lateral saphenous vein and right ruminal artery and vein were collected from Holstein steers (n = 6) shortly after slaughter. Vessels were cleaned of excess connective tissue and fat and sliced into segments that were suspended in a multimyograph chamber with 5 mL of continually oxygenated Krebs-Henseleit buffer, equilibrated for 90 min, and exposed to a reference compound (120 mM KCl for ruminal vessels and 0.1 mM norepinephrine for saphenous vein). Increasing concentrations of each treatment (E+EXT, E-EXT, ALK, and ergovaline) were added to the respective chamber every 15 min after buffer replacement. Data were normalized as a percentage of maximal contractile response of the reference compound and fit to a sigmoidal concentration response curve. Ergovaline, ALK, and E+EXT induced similar responses in the saphenous vein, ruminal artery, and ruminal vein. The E+EXT displayed a smaller EC(50) (half maximal effective concentration) than ergovaline or ALK in the saphenous vein and ruminal vein (P < 0.008), but not the ruminal artery (P = 0.31). Extrapolated maximum response was greatest in the saphenous vein for ergovaline, least for E+EXT, and intermediate for ALK (P < 0.0001). The E-EXT did not induce a contractile response in any vessel tested (P > 0.1). Data from this study indicate that ergovaline is largely responsible for the locally induced vasoconstriction of bovine vasculature observed with endophyte-infected tall fescue.

Effects of bovine cytochrome P450 single‐nucleotide polymorphism, forage type and body condition on production traits in cattle*

Relating single-nucleotide polymorphisms (SNP) to cows with acceptable productivity could benefit cattle breeders in areas where tall fescue is the predominant forage. This study aimed to (i) identify SNPs in bovine cytochrome P450 3A28 (CYP3A28) and (ii) determine the associations between SNP genotype, forage and cow body condition (BC). Genotype (CC, CG or GG) and forage [Kentucky-31 wild-type endophyte-infected tall fescue (KY+) vs. bermudagrass] effects on milk volume and quality were determined in Herd 1 cows (123 cows); in Herd 2 (99 cows), genotype and BC (low vs. moderate) effects on ovarian follicle size, calving date and calving per cent were determined; and in Herd 3 (114 cows), effects of genotype and fescue cultivar [KY+ vs. non-toxic endophyte-infected tall fescue (HiMag4)] were related to calving per cent, calving date and weaning weights of both cow and her calf. A cytosine (C) to guanine (G) transversion at base 994 (C994G) in CYP3A28 was identified. There was a genotype × forage type interaction (p < 0.05) on milk protein in Herd 1 cows; CC cows grazing bermudagrass had greater milk protein percentage in relation to other cows in the herd. In Herd 2, BC and genotype × BC tended (p < 0.10) to influence follicle size and Julian calving date respectively. Diameter of the largest follicle tended to be larger in moderate BC than in low-BC cows; whereas, CC and CG cows in moderate BC and homozygous (CC and GG) cows in low BC tended to calve 14 days earlier in relation to CG cows in low BC. In Herd 3, there was a genotype × forage type interaction (p < 0.05) on calving per cent, Julian calving date and calf weaning weight. In this study, genetic alterations (G allele at C994G) coupled with nutritional factors (low BC and toxic tall fescue) resulted in overall lower productivity in cows.

Steer responses to feeding soybean hulls and steroid hormone implantation on toxic tall fescue pasture1

Crossbred steers were grazed in the spring and early summer on endophyte-infected (Neotyphodium coenophialum), Kentucky-31 tall fescue (Lolium arundinaceum) pastures to evaluate effects and interactions of feeding pelleted soybean hulls (PSBH) and steroid hormone implants (SHI) on steer performance, serum prolactin, and hair coat ratings (HCR). Steers were stratified by BW for assignment to six 3.0-ha toxic tall fescue pastures. With or without daily PSBH feeding, treatments were assigned randomly to pastures as the main plot treatment in a split-plot design. Pelleted soybean hulls were group-fed to provide 2.3 kg(steer·d(-1)) (as fed). With or without SHI (200 mg of progesterone and 20 mg of estradiol) treatments were randomly assigned as the subplot treatment to 2 steer subgroups within each pasture. Sixty-four steers were grazed for 77 d in 2007, and 60 steers were grazed for 86 d in 2008. Pasture forage mass declined linearly over time, but the rate of decline was greater (P = 0.001) in 2007 than in 2008. Pasture forage mass was never below 2,300 kg of DM/ha in either year. Average daily gain for steers on the combined PSBH and SHI treatments was greater (P < 0.01) than for those on the PSBH-only, SHI-only, and control (no SHI, no PSBH) treatments. Average daily gain for the PSBH-only steers was greater (P < 0.01) than for SHI-only and control steers and tended (P = 0.063) to be greater for SHI-only than for control steers. Steroid implants did not affect (P = 0.826) serum prolactin concentrations; however, prolactin concentrations in PSBH steers, with or without SHI, were increased (P = 0.01) 2-fold over SHI-only and control steers. Feeding PSBH and SHI treatments both reduced (P < 0.05) the percentage of steers with rough HCR, and a greater percentage of steers fed PSBH tended (P < 0.076) to have sleek hair coats. An economic analysis was conducted, which determined that costs of additional ADG with PSBH feeding were below breakeven costs over a wide range of PSBH costs and cattle prices. Breakeven costs for PSBH-only treatment for a range of cattle prices of $1.80 to $2.40/kg of BW were less than $120/t, whereas with PSBH feeding combined with SHI the breakeven cost was less than $240/t. Results indicate that steers grazing endophyte-infected tall fescue can be fed PSBH and implanted with steroid hormones to cost effectively increase ADG and that feeding PSBH can increase serum prolactin concentrations and induce some shedding of rough hair coats.

246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P &lt; 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P &lt; 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.