Top Necrosis Research Articles

First Report of Tomato mottle mosaic virus infecting Chinese snake gourd (Trichosanthes kirilowii) in China.

Tomato mottled mosaic virus (ToMMV) was first identified in tomato in Mexico (Li et al. 2013). It belongs to the genus Tobamovirus and family Virgaviridae, and is a positive-sense single-stranded RNA virus. The viral genome contains about 6400 nucleotides, encoding four proteins, including the 126 K protein, 183 K protein, movement protein (MP) and coat protein (CP) (Tu et al. 2021). ToMMV mainly poses a serious risk to solanaceous crops. The virus-infected plants appear stunted growth and top necrosis, and the disease leaves show mottled, shrinkage and necrosis symptoms, resulting in a significant decline in tomato fruit yield and quality (Li et al. 2017; Tu et al. 2021). Chinese snake gourd (Trichosanthes kirilowii Maxim) is a perennial climbing herb in the family Cucurbitaceae, and the fruit, seed, peel and root can all be used as traditional Chinese medicine. In May of 2021, twenty-seven symptomless seedlings (developed from tissue culture plantlets) were randomly collected from nursery in Fengyang, Anhui Province. Total RNA of each sample was extracted, and RT-PCR was performed using degenerate tobamovirus primers Tob-Uni1 (5'-ATTTAAGTGGASGGAAAAVCACT-3') and Tob-Uni2 (5'-GTYGTT GATGAGTTCRTGGA-3') (Letschert et al. 2002). Amplicons with expected size were obtained from 6 of 27 samples and sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98.7 to 100% with all ToMMV isolates deposited in NCBI GenBank. Then, ToMMV coat protein (CP) gene was amplified using specific primers CP-F (5'-ATGTCTTACGCTATTACTT CTCCG-3') and CP-R (5'-TTAGGACGCTGGCGCAGAAG-3'). The CP fragment was obtained and sequenced. Sequence alignment indicated that CP sequence of isolate FY (GenBank accession no. ON924176) exhibited a 100% identity with ToMMV isolate LN (MN853592.1). The anti-ToMMV polyclonal antibody (PAb) was prepared by the author (S.L.) by immunizing rabbit with purified virus from Nicotiana benthamiana, and serological tests (dot-enzyme linked immunosorbent assay, Dot-ELISA) of RNA-positive T. kirilowii leaf samples using anti-ToMMV PAb were also positive. To fulfill a Koch's postulate, a pure culture of ToMMV was obtained from N. benthamiana using infectious cDNA clone of ToMMV (Tu et al. 2021), and then healthy T. kirilowii plants were mechanically inoculated with a prepared inoculum from ToMMV-infected N. benthamiana, as described previously (Sui et al. 2017). T. kirilowii seedlings showed chlorosis and leaf tip necrosis symptoms at 10 and 20 day post-inoculation respectively, and ToMMV infection on symptomatic plants was also verified by RT-PCR detection using primers CP-F and CP-R. These results demonstrated that T. kirilowii is a host of ToMMV under natural conditions, which might threaten the production of this medicinal plant. The seedlings from nursery appeared to be asymptomatic, but the plants showed chlorosis and necrosis symptoms after indoor inoculation. In qRT-PCR analysis, viral accumulation level in greenhouse-inoculated plants was a 25.6-fold of that in field-collected samples, which may be the reason of different symptom expression between field samples and inoculated samples. ToMMV has now been detected from the solanaceous (tomato, pepper and eggplant) and leguminous (pea) crops in the field (Li et al. 2014; Ambrós et al. 2017; Zhang et al. 2022). To our knowledge, this is the first report of natural infection of ToMMV in T. kirilowii as well as its natural infection on Cucurbitaceae plants.

PM 7/153 (1) Mechanical inoculation of test plants

PM 7/153 (1) Mechanical inoculation of test plants

Registration of ‘Charro’ pinto bean

Abstract‘Charro’ pinto bean (Phaseolus vulgaris L.) (Reg. no. CV‐341, PI 695318), developed by Michigan State University AgBioResearch, was released in 2020 as a high‐yielding, upright, full‐season cultivar with excellent canning quality. Charro was developed using the pedigree breeding method to the F4 generation followed by pure line selection for disease, agronomic, and quality traits. In 4 yr of field trials, Charro yielded 3,230 kg ha−1 at 17 locations in mid‐Michigan, flowered in 46 d, and matured in 97 d on average. Plants averaged 52 cm in height, with a lodging resistance score of 1.6 and seed weight of 41.2 g per 100 seed. Charro combines high yield potential and erect architecture with full‐season maturity in a pinto seed type. Charro has resistance to lodging and high pod placement within the plant structure, making it suitable for direct harvest under narrow‐row production systems. The upright architecture also contributes to avoidance of white mold, a disease that is intensified under narrow‐row production systems. Charro exhibits the top necrosis reaction to strain NL 3 of Bean common mosaic necrosis virus. Charro produces seed that meets industry standards for export and packaging, and canning quality was rated excellent for the pinto bean seed class.

Registration of ‘Eiger’ great northern bean

Abstract‘Eiger’ great northern bean (Phaseolus vulgaris L.) (Reg. no. CV‐339, PI 695269), developed by Michigan State University AgBioResearch, was released in 2020 as a high‐yielding, upright, full‐season cultivar with anthracnose resistance and acceptable canning quality. Eiger was developed using the pedigree breeding method to the F4 generation followed by pure line selection for disease, agronomic, and quality traits. In 4 yr of field trials, Eiger yielded 3,166 kg ha−1 across 15 locations in mid‐Michigan, flowered in 44 d, and matured in 98 d on average. Plants averaged 54 cm in height, with a lodging resistance score of 1.3 and seed weight of 38.7 g per 100 seed. Eiger combines high yield potential and erect architecture with full‐season maturity in a great northern seed type. Eiger has resistance to lodging and high pod placement within the plant structure, making it suitable for direct harvest under narrow‐row production systems. The upright architecture also contributes to avoidance of white mold, a disease that is intensified in narrow rows. Eiger is resistant to races 73 and 109 of anthracnose present in Michigan and produces a top necrosis reaction to strain NL 3 of Bean common mosaic necrosis virus. Eiger produces seed that meets industry standards for export and packaging, and canning quality was rated acceptable for the great northern bean seed class.

Registration of ‘Yellowstone’ yellow bean

Abstract‘Yellowstone’ yellow bean (Phaseolus vulgaris L.) (Reg. no. CV‐340, PI 695270), developed by Michigan State University AgBioResearch, was released in 2020 as a determinate, virus‐resistant cultivar with highly desirable vibrant dry seed coat color. Yellowstone was developed using the pedigree breeding method to the F3 generation followed by pure line selection for disease, agronomic, and quality traits. In 4 yr of field trials, Yellowstone yielded 2,902 kg ha−1, flowered in 41 d, and matured in 94 d on average. Plants averaged 47 cm in height, with a lodging resistance score of 1.8 and seed weight of 46 g per 100 seed. Yellowstone is well adapted to growing conditions in Michigan and produces seed with an intense yellow seed coat color under local conditions. Yellowstone is resistant to lodging, which also contributes to the avoidance of white mold. Yellowstone exhibits the top necrosis reaction to strain NL 3 of Bean common mosaic necrosis virus conditioned by the I gene. Yellowstone produces seed that exceeds industry standards for export and packaging, and canning quality was rated acceptable for the yellow bean seed class.

Registration of ‘Adams’ black bean

Abstract‘Adams’ black bean (Phaseolus vulgaris L.) (Reg. no. CV‐338, PI 695268), developed by Michigan State University AgBioResearch, was released in 2020 as a high‐yielding, upright, full‐season cultivar with anthracnose resistance and acceptable canning quality. Adams was developed using the pedigree breeding method to the F4 generation followed by pure line selection for disease, agronomic, and quality traits. In 2 yr of field trials at 27 locations, Adams yielded 3,501 kg ha−1, flowered in 45 d, and matured in 96 d on average. Plants averaged 51 cm in height, with a lodging resistance score of 1.3 and seed weight of 20.9 g per 100 seed. Adams has resistance to lodging, with high pod placement within the plant structure, making it suitable for direct harvest under narrow‐row production systems. The upright architecture also contributes to avoidance of white mold. Adams is resistant to races 73 and 109 of anthracnose present in Michigan and produces a top necrosis reaction to strain NL 3 of Bean common mosaic necrosis virus. Adams produces seed that meets industry standards for export and packaging and was rated acceptable in canned bean color in the black bean seed class. The name Adams was chosen to honor Professor M. Wayne Adams, former bean breeder, for his significant contributions in archetype breeding and establishing the black bean breeding program at Michigan State University.

Registration of ‘Coho’ light red kidney bean

Abstract‘Coho’ light red kidney bean (Phaseolus vulgaris L.) (Reg. no. CV‐330, PI 692133), developed by Michigan State University AgBioResearch, was released in 2019 as an upright, full‐season cultivar that possesses acceptable canning quality and partial resistance to common bacterial blight and root rots. Coho was developed using the pedigree breeding method to the F4 generation followed by pure line selection for disease, agronomic, and quality traits. In 4 yr of field trials, Coho yielded 3,644 kg ha−1, flowered in 39 d, and matured in 99 d on average. Plants averaged 50 cm in height, with lodging resistance score of 1.1 and seed weight of 53.8 g 100 seed−1. Coho is resistant to race 73 of anthracnose and produced a top necrosis reaction to strain NL 3 of Bean common mosaic necrosis virus. Coho produces seed that meets industry standards for dry seed packaging and was rated satisfactory in overall canned bean quality in the light red kidney bean seed class.

고추에서 분리한 오이모자이크바이러스(CMV-GTN)의 특성과 고추 품종의 저항성 평가

오이모자이크바이러스(CMV)는 ê³ ì¶”ì— 심한 피해를 주는 바이러스이다. 2013ë „ ê³ ì¶” í’ˆì¢ ì²­ì–‘ì˜ ì„ ë‹¨ë¶€ìœ„ì— ê´´ì €ì¦ìƒì´ 나타난 식물체로부터 CMV를 순수 ë¶„ë¦¬í•˜ì˜€ê³ ì´ 분리주를 CMV-GTN으로 ëª ëª í•˜ì˜€ë‹¤. CMV-GTNê³¼ 기존에 특성이 잘 ì•Œë ¤ì§„ CMV-Ca-P1을 대상으로 외피단백질의 ì•„ë¯¸ë ¸ì‚° 서열과 여러 기주식물에서 ìƒë¬¼ì  반응을 비교하였다. CMV-Ca-P1의 외 피단백질 ì•„ë¯¸ë ¸ì‚°ì€ 217개로 구성되어 있었으나, CMV-GTN은 ì•„ë¯¸ë ¸ì‚° 서열 57번째에 발린이 추가된 218개로 구성되어 있었다. CMV-GTNê³¼ GeneBank에 등록된 다양한 CMV 분리주들의 ì™¸í”¼ë‹¨ë°±ì§ˆìœ ì „ìž ìœ ì‚¬ì„±ì€ 96-99%였다. 생물 ê²€ì •ì—ì„œ í† ë§ˆí† ì™€ ê³ ì¶”ì—ì„œ 병원성이 강하게 발현되는 CMV-GTN을 ê³ ì¶” í’ˆì¢ ì— 대한 ì €í•­ì„± 스크린을 위하여 ì„ ë°œí•˜ì˜€ë‹¤. ê³ ì¶” 시판 í’ˆì¢ 135ì¢ ì— 대하여 CMV-GTN으로 ê²€ì •í•˜ì˜€ê³ CMV-Ca-P1ê³¼ ì €í•­ì„± 반응을 비교하였다. ê·¸ ê²°ê³¼ CMV-GTN에 대하여 ì €í•­ì„± 반응을 표현한 í’ˆì¢ ì€ í”„ë ˆë¯¸ì—„, 중도 ì €í•­ì„± í’ˆì¢ ì€ 핫스타, ì¹´ì´ì €, 굿쵸이스였다. 한편 CMV-Ca-P1에 대한 ì €í•­ì„± í’ˆì¢ ì€ ë² ë¡œë”°ì™€ ì¹´ì´ì €ì˜€ë‹¤.

First Report of Tomato spotted wilt virus in Lettuce Crops in Saudi Arabia.

A survey for viruses in open field lettuce crops was carried out in March 2014 in the Al-Uyaynah area, central region of Saudi Arabia. In one plot, more than 50% of the lettuce plants (Lactuca sativa; hybrid: Romaine), with the majority of the affected plants in the edges of the plot, were showing virus-like symptoms such as necrotic lesions, necrosis of the lamina of the younger leaves, and leaf curling, indicating a possible infection by a Tospovirus, possibly Tomato spotted wilt virus (TSWV). Most of them were dead when the field was visited again 3 weeks later. Samples from 10 symptomatic and two asymptomatic plants were collected. Five of the samples from symptomatic and two from asymptomatic plants were mechanically inoculated onto Nicotiana benthamiana and N. glutinosa (three indicator plants of each species were used for each sample) using 0.1 M phosphate buffer (pH 7) containing 0.01M Na2SO3 mM. All the symptomatic lettuce samples were also tested serologically using polyclonal antisera (3) against TSWV, CMV, and by using monoclonal antibodies against potyviruses. Moreover, total RNA was extracted (1) and detection of TSWV was also attempted with reverse transcription (RT)-PCR using species specific primers (4) for a 276-bp fragment of the L RNA segment. In both serological and molecular methods, positive and negative controls were included. All the mechanically inoculated plants with tissue from the symptomatic lettuce plants of N. benthamiana showed chlorotic local lesions followed by systemic top necrosis 2 to 3 weeks post inoculation. Similarly, all inoculated N. glutinosa plants showed necrotic local lesions followed by systemic chlorosis. However, all the indicator plants mechanically inoculated with tissue from asymptomatic lettuce plants gave no reaction. All the symptomatic lettuce samples reacted positively, while asymptomatic samples reacted negatively in ELISA tests with TSWV antiserum and the presence of the virus was further confirmed by RT-PCR by using specific primers (method A) (4). PCR products of two randomly selected positive samples were directly sequenced and BLAST analysis of the obtained sequences (Accession Nos. KJ701035 and KJ701036) revealed 99% nucleotide and 100% amino acid identity with the deposit sequence in NCBI from South Korea (KC261947). Regarding mechanical inoculation, 10 days post-inoculation, both indicator plants showed typical symptoms of TSWV infection, such as necrotic local lesions, systemic necrotic patterns, and leaf deformation. None of the symptomatic plants was found to be infected with either CMV or potyvirus. To our knowledge, this is the first report of TSWV naturally infecting lettuce in Saudi Arabia; therefore, insect vector and weed management are necessary measures to control the virus spread to other crops such as tomato and pepper (2).

First Report of Natural Infection of Pea (Pisum sativum) by Tomato spotted wilt virus in Hungary

In June of 2009, stem vascular necrosis, interveinal necrosis of upper leaves, wilting of flowers, and necrotic spots on the pods were observed on garden pea (Pisum sativum L. 'Rajnai törpe') in northeast Hungary. A mechanical transmissible plant virus designated Ps091 was isolated from leaves of severely affected plants. Pathological investigations demonstrated that Ps091 had a host range very similar to that of Tomato spotted wilt virus (TSWV). It caused necrotic local lesions on Chenopodium spp. and induced systemic yellowing and necrosis on the upper leaves of Nicotiana benthamiana, N. clevelandii, and N. glutinosa by mechanical inoculation. Typical symptoms of TSWV infection appeared on the top leaves of pepper (Capsicum annuum L. 'Albaregia') and tomato (Solanum lycopersicum 'Kecskeméti 3') inoculated with Ps091. For molecular identification, total nucleic acids were extracted from Ps091-infected tobacco with a standard phenol-chloroform extraction method (2), and reverse transcription-PCR was conducted with TSWV N-gene specific, own designed primers (TSWV-S for: 5'-CCCAGCATTATGGCAAGCC-3', TSWV-S rev: 5'-TGATCTGGTCGAGGTTTTCCGCTAGCCC-3'). A tobacco plant infected with a reference pepper isolate, TSWV-Ca1 (1), and a healthy tobacco plant served as positive and negative controls, respectively. An approximately 300-bp DNA fragment was amplified from tobacco infected with Ps091 and TSWV-Ca1. The Ps091 amplicon was cloned, sequenced in both directions, and the sequence was deposited in GenBank (Accession No. HQ615692). Blast search analysis showed that TSWV-Ps091 had the highest identity (99%) with TSWV-P170RB strain (GenBank Accession No. DQ431238) in the cognate region. Since the latter isolate is a resistance breaking (RB) strain on pepper, pathogenicity of Ps091 on TSWV resistant pepper and tomato lines was studied. Mechanically inoculated pepper (C. annuum × C. chinense TSR F4 line) and tomato (S. lycopersicum 'Stevens') genotypes carrying the Tsw and Sw5 resistance genes, respectively, reacted with necrotic local lesions, but no systemic infections were detected by applying bioassays to N. clevelandii. These results demonstrate that Ps091 does not belong to the RB strains of TSWV. Back inoculations to pea ('Rajnai törpe') resulted in necrotic local spots as well as systemic stem and top necrosis, proving the causal relationship between TSWV-Ps091 and the pea disease observed in the field. Although TSWV has been known to cause epidemy in solanaceous crops and tobacco, to our knowledge, this is the first report of its natural occurrence on a legume plant, particularly on pea in Hungary. Because of the extreme severity of the disease caused on pea and high infection pressure, TSWV is a new threat to pea production in this country, where pea is a very important crop.

Identification strains of Bean Yellow Virus potyvirus (BYMV) on bean Phaseolus vulgaris in Iraq

everal methods were used to identify the virus, such as indicator plants, physical properties, manners transmission by aphids and ELISA test and among indicator plants two strains of BYMV were identified. The first one was showed a necrotic local lesion on bean while the second one was showed strong epinasty, veinal necrosis in inoculated leaves then it caused top necrosis at last severe systemic mottle. This two different symptoms gives a positive reaction at ELISA test and this test was indicated that the two symptoms is belong for two strains of bean yellow mosaic virus ( BYMV).The physical properties for the first strain about the Thermal Inactivating point (TIP) was 50-55ْc while the second strain was 60ْc and the dilution end point (DEP)for the first strain was 10-2 but it was 10-2 -10-3 for the second one and the longevity in vitro (LIV) for the first strain 48 hrs at room temperature and the main transmission by insect was achieved by several species of aphids.The double immunodiffution test in agar have been showed meeting of two precipitin line without cross in this two lines when used antiserum of the first strain of virus against the two sap of infected plants with both strains of virus and this test was used in the second strain against sap of the both infected plants too with the two strains of the virus and this test was additional indication that the two symptoms in bean were belonged to a two different strains to the same virus.

Moroccan watermelon mosaic virusnewly reported on zucchini squash in France

During the autumn of 2002, zucchini squash (Cucurbita pepo) plants showing severe mosaic and blisters on leaves, as well as fruit deformations, were observed near Agen, France. DAS-ELISA tests gave positive reactions for Moroccan watermelon mosaic virus (MWMV; genus Potyvirus), a virus not previously reported in France. Sample SO-06 was positive for MWMV but also for Cucurbit aphid borne yellows virus (CABYV; genus Polerovirus) and Watermelon mosaic virus (WMV; genus Potyvirus). MWMV was separated by non-persistent transmission using a single aphid (Myzus persicae) per test plant. A pure MWMV subculture was thus obtained (MWMV-Fr) and used for mechanical inoculation to differential hosts. Severe mosaic and leaf deformations were observed in zucchini squash, watermelon and cucumber, while top necrosis was observed in melon cv. Védrantais. In non-cucurbit hosts, symptomless systemic infections were detected in Ranunculus sardous and Lavatera trimestris, while only local lesions were observed in Chenopodium amaranticolor. To confirm the identification of MWMV, total RNA was extracted from infected plants using Tri-Reagent (Molecular Research Center) and tested using Takara One-Step RNA PCR kit with specific primers MWMV-5¢: AGCAAGCGCCATACTCTGA and MWMV-3¢: CAAACTCCATTAACATTCGG, designed to amplify a region of the polymerase (NIb) and coat protein (CP). RT-PCR products of the expected size of 627 bp were generated from infected plant extracts. No amplicon was produced from healthy plant extracts. An RT-PCR product amplified from isolate MWMV-Fr was directly sequenced (GenBank EF579942). This nucleotide sequence showed 97% identity to the corresponding region of the MWMV type strain from Morocco (GenBank AF305545; Lecoq et al., 2001). MWMV has been reported in Africa, Spain (Lecoq et al., 2001) and more recently in Italy (Roggero et al., 1998). MWMV could be an emerging threat for southern Europe. However, MWMV has not been detected again during intensive surveys conducted in southern France since 2004. This suggests that MWMV has not become established in France.

First report of the natural occurrence of eight viruses affecting soybeans in Iran

During the summer of 1999/2000 a survey of viruses infecting soybeans was conducted in five main soybean cultivation provinces of Iran (Golestan, Mazandaran, Ardebil, Lorestan and Khuzestan). A total of 3110 leaf samples were collected randomly from 80 soybean fields (30–50 samples per field). Samples were tested by the enzyme-linked immunosorbent assay (ELISA) for the presence of 13 viruses using antisera against Alfalfa mosaic virus (AlMV), Bean yellow mosaic virus (BYMV), Cucumber mosaic virus (CMV), Soybean mosaic virus (SMV), Tobacco mosaic virus (TMV), Tobacco ringspot virus (TRSV) and Tomato ringspot virus (ToRSV) (Sanofi Pytho-Diagnostics, 92430 Marnes-la-Coquette, France); Bean common mosaic virus (BCMV) (Adgen Ltd, Auchincruive, KA6 5HW, UK); Tobacco streak virus (TSV) (As-0171, PV-0309) and Tomato spotted wilt virus (TSWV) (As-0526, As-0580, PV-0526) (DSMZ, BBA Messeweg 11/12, D-38104 Braunschweig, Germany); Pea enation mosaic virus-1 (PEMV-1) (Iranian pea isolate provided by S. Farzadfar); Blackeye cowpea mosaic virus (BlCMV) (from Dr Pinnow, Department of Plant Pathology and Physiology, Clemson University, SC 29631, USA); and Peanut mottle virus (PeMoV) (Seed Pathology Institute, Flakkejerg, DK-4200 Slagelse, Denmark). The latter two viruses were tested for by immunodot ELISA, and the other viruses by double antibody sandwich-ELISA. Laboratory tests results indicated that the overall virus disease incidence was 15·7%. SMV was the most common virus, with an average of 13·3%, followed by TSWV (5·4%), TRSV (4·2%), TSV (4·1%), PEMV (2·9%), BYMV (2·2%), ToRSV (2·1%), TMV (1·5%), AlMV (1·3%), BCMV (0·8%) and CMV (0·6%). In addition, BlCMV was detected in selected samples with symptoms from Mazandaran and Lorestan, and PeMoV in samples from Golesta. Field symptoms associated with virus infection included mosaic, mottling, crinkle, vein clearing and vein necrosis with SMV; mosaic and mottling with AlMV, BCMV, BlCMV, BYMV, PEMV, PeMoV and TMV; top necrosis in most TRSV and ToRSV-infected plants; and chlorosis and necrosis with TSWV. Plants were frequently infected with more than one virus, however, so it was not possible to correlate specific symptoms with a particular virus. SMV, TSV, TRSV, ToRSV and TSWV have previously been recorded in soybean in Iran (Eskandari, 1978; Rahimian et al ., 1995; Golnaraghi et al. , 2001), and AlMV, BCMV, BYMV, CMV, PEMV-1 and PeMoV have previously been reported from other hosts (Kaiser et al ., 1971; Shahraeen & Bananej, 1995). However, this is the first report of naturally occurring infections of AlMV, BCMV, BlCMV, BYMV, CMV, PEMV-1, PeMoV and TMV in soybean fields in Iran.

First Report of a Tospovirus Infection of Peanuts in Iran.

During the summer of 2000, severe stunting, mosaic, bud necrosis, and chlorosis symptoms were observed on peanut (Arachis hypogaea cv. Gilan) plants growing in fields in the Golestan Province of Iran. Leaf extracts of peanut plants were infective (mechanical inoculation) causing necrotic local lesions on Chenopodium quinoa, C. amaranticolor, Gomphrena globosa, Phaseolus vulgaris cv. Talash, Vicia faba, and Vigna unguiculata cv. Mashad; systemic chlorotic spots were followed by systemic necrosis in Datura stramonium, D. metel, and Nicotiana rustica; chlorotic and necrotic spots were followed by top necrosis in Glycine max. About 2 weeks after inoculation, the chlorosis followed by stunting and bud necrosis observed in the field were reproduced in A. hypogaea cv. Gilan. Tomato spotted wilt virus (TSWV) was detected in the original peanut plants and in plant species that developed symptoms after inoculation with extracts from peanut plants, when analyzed by double-antibody sandwich enzyme-linked immunosorbent assay using TSWV-specific antisera (polyclonal antibody As-0526 and As-0580, DSMZ, Braunschweig, Germany). TSWV is one of the most important viruses in the world (2) and has been reported on potato (3) and tomato (1) in Iran. To our knowledge, this is the first report of TSWV infection of peanut in Iran.

Potential marker-assisted selection for bc-1 2 resistance to bean common mosaic potyvirus in common bean

Pyramiding epistatic resistance genes to improve long term disease resistance has challenged plant breeders. Indirect selection using tightly linked markers will often facilitate the breeding of desired epistatic resistance gene combinations. In common bean, the most effective strategy for broad spectrum control of the bean common mosaic virus disease is to combine I, bc-u, bc-1 2, bc-2 2, and bc-3 genes. We describe the use of near-isogenic lines and bulked segregant analysis to identify a marker tightly linked with the bc-1 2 gene. The recessive bc-1 2 gene conditions resistance to specific strains of bean common mosaic virus and bean common mosaic necrosis virus and is masked by the bc-2 2 and bc-3 genes. We identified a RAPD marker completely linked (0 recombinants) with bc-1 2, based on 72 F3 progeny generated from a cross between the contrasting near isogenic lines (I + bc-1/I + bc-1 2). Segregation in this I gene background revealed that bc-1 2 was dominant to bc-1 in conferring resistance to top necrosis in the allelic series Bc-1 > bc-1 2 > bc-1. To facilitate marker-assisted selection of bc-1 2 across breeding programs, the RAPD was converted to a SCAR marker, designated SBD51300. Tight linkage (0 recombinants) was confirmed in a second population of 58 F2 progeny co-segregating for SBD51300 and bc-1 2 gene from a different source. Based on a survey of 130 genotypes, the SCAR will be useful for MAS of bc-1 2 in most beans of Middle American origin and snap beans, but will have very limited utility in the case of kidney and cranberry beans. The SBD51300 marker mapped on linkage group B3, revealing independence of bc-1 2 from the I gene on B2 and bc-3 gene on B6, which supports the opportunity to readily combine genes for broad spectrum and pyramided resistance to bean common mosaic potyviruses in a single bean cultivar.

Examination of the Leaf-Drop Symptom of Virus-Infected Potato Using Anther Culture-Derived Haploids

ABSTRACT Necrotic lesions and vein necrosis characteristic of the hypersensitive response (HR) controlled by the dominant resistance gene Ny develop in potato cv. Pito after infection with potato virus Y ordinary strain (PVY masculine) at a low temperature (16/18 degrees C night/day). In contrast, at high temperatures (19/24 degrees C night/day), large coalesced lesions develop in the lower infected leaves, which wither and remain hanging from stems forming the leaf-drop symptom; mosaic symptoms with no necrosis also develop in the top leaves. The genetic basis of the leaf-drop symptom and its dependence on temperature were examined using a novel approach involving 58 haploids (2n = 24) derived from 'Pito' (2n = 48) through anther culture. These haploids and 'Pito' were graft-inoculated with PVY(O) at 19/24 to 25 degrees C (night/day). Necrotic symptoms were expressed in 28 haploids, of which 18 haploids (phenotype class N) developed top necrosis, vein necrosis, or both and necrotic lesions that are characteristic of HR. Ten haploids showed leaf drop similar to 'Pito' (phenotype class LD). Thirty haploids were susceptible and showed only mosaic symptoms (phenotype class S). These data indicated that necrosis was induced by a single dominant gene, Ny, in the simplex condition. However, the three distinct phenotypic classes (N, LD, and S) among the haploids grown under the same environmental conditions showed that another locus (gene) was involved in modifying the HR triggered by Ny. Data suggested that this locus contains a dominant temperature-dependent modifier (Tdm) gene that alters the expression of PVY-induced HR at higher temperatures, resulting in leaf drop.

Characteristics of a Potyvirus of the Bean Yellow Mosaic Virus Subgroup in Sesbania speciosa Germ Plasm.

A plant of Sesbania speciosa with leaf mosaic and distortion symptoms was identified in a germ plasm regeneration plot at Griffin, Georgia. The Sesbania virus produced mild or moderate mosaic symptoms on Glycine max cvs. Bragg and Tracy M, Lupinus albus, Nicotiana benthamiana, Pisum sativum cv. Perfected Wales, Phaseolus vulgaris cvs. Black Turtle, Bountiful, and Pinto, and did not infect N. tabacum. Bean yellow mosaic potyvirus (BYMV) and pea mosaic potyvirus (PMV) do not infect Perfected Wales pea and they produce mosaic, distortion, and necrosis on white lupine. The PMV strain tested produced much more severe symptoms on the three green beans, with top necrosis on Pinto. BYMV produced local latent infection of N. tabacum and BYMV and PMV produced mosaic with distortion on N. benthamiana. The Sesbania virus was seed-transmitted at a low rate in S. speciosa. Indirect-enzyme-linked immunosorbent assay tests with a general potyvirus monoclonal antibody and BYMV and white lupine mosaic virus (WLMV) polyclonal antisera were strongly positive. Tests of the Sesbania virus against a monoclonal antibody panel suggests that it is not BYMV or any of the previously described subgroup members, but is a member of the BYMV subgroup. This is the first report of a seedborne BYMV-like virus of Sesbania spp.

Combination and expression of two virus resistance mechanisms in interspecific somatic hybrids of potato

Solanum tuberosum cv. Pentland Dell expresses single gene-mediated hypersensitive resistance (HR) to potato virus Y (strain group PVY O), A (PVA 1) and X (PVX 3) and is resistant to cucumber mosaic virus (Fny-CMV). S. brevidens is resistant to these viruses, too, but resistance is functional through slow virus cell-to-cell movement. These two virus resistance mechanisms were combined by symmetric somatic hybridization. Six hybrid plants were regenerated from a single fusion callus and tested for virus resistance by graft-inoculation. Titers of PVY and PVA in the hybrids were higher than in S. brevidens. Only limited necrosis developed following infection with PVY and chlorotic lesions developed following infection with PVA in the hybrids, whereas top necrosis and necrotic lesions, respectively, developed in P. Dell. No virus or symptoms were observed in one hybrid inoculated with PVX and three hybrids inoculated with CMV. Other hybrids developed lethal necrosis following infection with PVX, and stunting, necrosis and yellow mosaic symptoms following infection with CMV, which was similar to P. Dell. S. brevidens contained moderate titers of PVX and CMV. It developed no symptoms following infection with PVX and only mild mosaic symptoms following infection with CMV. Altered resistance expression in the hybrids may be attributable to simultaneous expression of the two resistance mechanisms, interference in the expression of either resistance mechanism caused by the genes of the heterologous genome, and/or somaclonal variation.

Resistance to cucumber mosaic virus in potato

SummaryReactions to two subgroup I isolates (Fny‐CMV and Pf‐CMV) and two subgroup II isolates (A9‐CMV and LS‐CMV) of cucumber mosaic virus (CMV) were studied in three non tuber‐bearing wild potato species (Solanum spp.) of the series Etuberosa, and in two tuber‐bearing interspecific potato hybrids and four potato cultivars using graft‐inoculation. Three classes of phenotypic reactions (susceptible, hypersensitive, extreme resistance) were observed in the tuber‐bearing genotypes. Susceptible genotypes developed mosaic or severe mosaic with leaf malformation and had high CMV titres. Hypersensitive genotypes developed either top necrosis or vein necrosis and/or necrotic spots on apical leaves, and had low CMV titres. Extremely resistant genotypes had no symptoms and no CMV was detected. The hybrid 87HW13.7 (S. tuberosum×S. multidissectum) developed top necrosis specific to infection with Fny‐CMV. The hybrid ‘A6’ (S. demissum×S. tuberosum cv. Aquila) was hypersensitive to all CMV isolates tested. Extreme resistance was not functional against all CMV isolates. Neither hypersensitivity nor extreme resistance were related to the CMV subgroup.

Red Clover Mottle Virus Infection Affects Sink-Source Relationships and Starch Accumulation in Pea Plants

It has frequently been observed that starch accumulates in plant tissues after virus infection. In pea plants infected with red clover mottle comovirus, strain «O», virus replicates in the inoculated leaves and at the shoot apex where it induces lethal top necrosis. Concomitant with the onset of top necrosis, starch accumulates in the intervening leaves which remain substantially virus-free. This pattern of starch accumulation can be mimicked by removal of the apex in uninfected plants. We conclude that in this plant-virus interaction starch accumulation is an indirect consequence of virus infection associated with the removal of the physiological sink for photosynthate