Tomato Spotted Wilt Virus Research Articles

Twindemic Threats of Weeds Coinfected with Tomato Yellow Leaf Curl Virus and Tomato Spotted Wilt Virus as Viral Reservoirs in Tomato Greenhouses.

Tomato yellow leaf curl virus (TYLCV) and tomato spotted wilt virus (TSWV) are well-known examples of the begomovirus and orthotospovirus genera, respectively. These viruses cause significant economic damage to tomato crops worldwide. Weeds play an important role in the ongoing presence and spread of several plant viruses, such as TYLCV and TSWV, and are recognized as reservoirs for these infections. This work applies a comprehensive approach, encompassing field surveys and molecular techniques, to acquire an in-depth understanding of the interactions between viruses and their weed hosts. A total of 60 tomato samples exhibiting typical symptoms of TYLCV and TSWV were collected from a tomato greenhouse farm in Nonsan, South Korea. In addition, 130 samples of 16 different weed species in the immediate surroundings of the greenhouse were collected for viral detection. PCR and reverse transcription-PCR methodologies and specific primers for TYLCV and TSWV were used, which showed that 15 tomato samples were coinfected by both viruses. Interestingly, both viruses were also detected in perennial weeds, such as Rumex crispus, which highlights their function as viral reservoirs. Our study provides significant insights into the co-occurrence of TYLCV and TSWV in weed reservoirs, and their subsequent transmission under tomato greenhouse conditions. This project builds long-term strategies for integrated pest management to prevent and manage simultaneous virus outbreaks, known as twindemics, in agricultural systems.

Lavender Harbors More Viruses than Previously Thought: First Report of Raspberry Ringspot Virus and Phlox Virus M in Lavandula × intermedia.

Plants of the genus Lavandula are thought to be rarely infected by viruses. To date, only alfalfa mosaic virus, cucumber mosaic virus, tobacco mosaic virus, and tomato spotted wilt virus have been reported in this host. In this study, we identified for the first time raspberry ringspot virus (RpRSV) and phlox virus M (PhlVM) in lavender using herbaceous indexing, enzyme-linked immunosorbent assay, and high-throughput sequencing. Nearly complete genome sequences for both viruses were determined. Phylogenetic and serological characterizations suggest that the obtained RpRSV isolate is a raspberry strain. A preliminary survey of 166 samples indicated RpRSV was spread only in the lavender cultivar 'Grosso', while PhlVM was detected in multiple lavender cultivars. Although RpRSV raspberry strain may have spread throughout Auckland and nearby areas in New Zealand, it is very likely restricted to the genus Lavandula or even to the cultivar 'Grosso' due to the absence or limited occurrence of the nematode vector. Interestingly, all infected lavender plants, regardless of their infection status (by RpRSV, PhlVM, or both) were asymptomatic. RpRSV is an important virus that infects horticultural crops including grapevine, cherry, berry fruits, and rose. It remains on the list of regulated pests in New Zealand. RpRSV testing is mandatory for imported Fragaria, Prunus, Ribes, Rosa, Rubus, and Vitis nursery stock and seeds for sowing, while this is not required for Lavandula importation. Our study revealed that lavender could play a role not only as a reservoir but also as an uncontrolled import pathway of viruses that pose a threat to New Zealand's primary industries.

Morphological characterization and molecular marker-assisted selection for resistance to Tobacco mosaic virus (TMV) and Tomato spotted wilt virus (TSWV) in S2 population of capia pepper (Capsicum annuum L.)

Morphological characterization and molecular marker-assisted selection for resistance to Tobacco mosaic virus (TMV) and Tomato spotted wilt virus (TSWV) in S2 population of capia pepper (Capsicum annuum L.)

Virus-vectoring thrips regulate the excessive multiplication of tomato spotted wilt virus using their antiviral immune responses.

The tomato spotted wilt virus (TSWV) is a member of the Tospoviridae family and has an negative/ambisense single-stranded RNA genome. Frankliniella occidentalis and F. intonsa are known to be dominant pests in Capsicum annuum (hot pepper) and can cause damage to the plant either directly by feeding, or indirectly by transmitting TSWV in a persistent and propagative manner, resulting in serious economic damage. This study compared the immune responses of two different thrips species against TSWV infection by transcriptome analysis, which then allowed the assessment of antiviral responses using RNA interference (RNAi). Both adult thrips shared about 90 % of the transcripts in non-viruliferous conditions. Most signal components of the immune pathways were shared by these two thrips species, and their expression levels fluctuated differentially in response to TSWV infection at early immature stages. The functional assays using RNAi treatments indicated that the Toll and JAK/STAT pathways were associated with the antiviral responses, but the IMD pathway was not. The upregulation of dorsal switch protein one supported its physiological role in recognizing TSWV infection and triggering the eicosanoid biosynthetic pathway, which mediates melanization and apoptosis in thrips. In addition, the signal components of the RNAi pathways fluctuated highly after TSWV infection. Individual RNAi treatments specific to the antiviral signalling and response components led to significant increases in the TSWV amount in the thrips, causing virus-induced mortality. These findings suggest that immune signalling pathways leading to antiviral responses are operating in the thrips to regulate TSWV litres to prevent a fatal viral overload. This study also indicates the differential antiviral responses between the TSWV-transmitting F. occidentalis and F. intonsa.

Multiplex PCR methods for simultaneous detection of tomato brown rugose fruit virus, tomato spotted wilt virus and pepino mosaic virus

Multiplex <scp>PCR</scp> methods for simultaneous detection of tomato brown rugose fruit virus, tomato spotted wilt virus and pepino mosaic virus

Multigenic Hairpin Transgenes in Tomato Confer Resistance to Multiple Orthotospoviruses Including Sw-5 Resistance-Breaking Tomato Spotted Wilt Virus.

Tomato spotted wilt virus (TSWV) and related thrips-borne orthotospoviruses are a threat to food and ornamental crops. Orthotospoviruses have the capacity for rapid genetic change by genome segment reassortment and mutation. Genetic resistance is one of the most effective strategies for managing orthotospoviruses, but there are multiple examples of resistance gene breakdown. Our goal was to develop effective multigenic, broad-spectrum resistance to TSWV and other orthotospoviruses. The most conserved sequences for each open reading frame (ORF) of the TSWV genome were identified, and comparison with other orthotospoviruses revealed sequence conservation within virus clades; some overlapped with domains with well-documented biological functions. We made six hairpin constructs, each of which incorporated sequences matching portions of all five ORFs. Tomato plants expressing the hairpin transgene were challenged with TSWV by thrips and leaf-rub inoculation, and four constructs provided strong protection against TSWV in foliage and fruit. To determine if the hairpin constructs provided protection against other emerging orthotospoviruses, we challenged the plants with tomato chlorotic spot virus and resistance-breaking TSWV and found that the same constructs also provided resistance to these related viruses. Antiviral hairpin constructs are an effective way to protect plants from multiple orthotospoviruses and are an important strategy in the fight against resistance-breaking TSWV and emerging viruses. Targeting of all five viral ORFs is expected to increase the durability of resistance, and combining them with other resistance genes could further extend the utility of this disease control strategy. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Registration of ‘Georgia‐23RKN’ peanut

Registration of ‘Georgia‐23RKN’ peanut

Exploring the weed host range of resistance-breaking variants of tomato spotted wilt orthotospovirus (TSWV) across life cycles in Türkiye

Exploring the weed host range of resistance-breaking variants of tomato spotted wilt orthotospovirus (TSWV) across life cycles in Türkiye

Commodity risk assessment of Petunia spp. and Calibrachoa spp. unrooted cuttings from Kenya.

The European Commission requested the EFSA Panel on Plant Health to evaluate the probability of entry of pests (likelihood of pest freedom at entry), including both regulated and non-regulated pests, associated with unrooted cuttings of the genera Petunia and Calibrachoa produced under physical isolation in Kenya. The relevance of any pest for this opinion was based on evidence following defined criteria, based on the methodology used for High-Risk Plants adapted for the specificity of this assessment. Fourteen EU-regulated pests (Bemisia tabaci, cowpea mild mottle virus, Liriomyza huidobrensis, Liriomyza sativae, Liriomyza trifolii, potato leafroll virus, potato spindle tuber viroid, Ralstonia pseudosolanacearum, R. solanacearum, Scirtothrips dorsalis, tomato mild mottle virus, tomato spotted wilt virus, tomato yellow leaf curl virus and Xanthomonas vesicatoria) and six EU non-regulated pests (Aleurodicus dispersus, pepper veinal mottle virus, Nipaecoccus viridis, Phenacoccus solenopsis, Tetranychus neocaledonicus and tomato yellow ring virus) fulfilled all relevant criteria and were selected for further evaluation. For these pests, the risk mitigation measures proposed in the technical dossier from Kenya were evaluated, taking into account the possible limiting factors. Additionally, an expert judgement is given on the likelihood of pest freedom, taking into consideration the risk mitigation measures acting on the pest, including uncertainties associated with the assessment. The estimated degree of pest freedom varies among the pests evaluated, with T. neocaledonicus being the pest most frequently expected on the imported cuttings. The Expert Knowledge Elicitation indicated, with 95% certainty, that between 9942 and 10,000 bags containing unrooted cuttings of Petunia spp. and Calibrachoa spp. per 10,000 would be free of T. neocaledonicus.

Iris yellow spot orthotospovirus pathosystem, virus host and vector (Thrips tabaci)

Iris yellow spot orthotospovirus (IYSV) causes serious problems in the onion (Allium cepa) crop and is widely distributed in the producing areas of the country. In Mexico it was reported in 2010 as “yellow spot” on onion and other members of the genus Allium. Its main vector is Thrips tabaci, which causes direct damage by feeding and by being a vector of other viruses such as Tomato spotted wilt orthotospovirus and Impatiens necrotic spot orthotospovirus. Knowledge of the pathosystem of IYSV - Thrips tabaci - Allium cepa - weeds can contribute to an integrated management and awareness of pesticide use. The versatility of IYSV to infect more than 60 plant species (&gt;20 families), most of which are present in Mexico, coupled with the wide host range of the vector, makes the interaction complex and leads to a better understanding of the diversity of alternate hosts of the vector and/or IYSV. At present, information on weed hosts of IYSV and the vector is limited, but their knowledge will provide a greater understanding of the disease. It is important to have a comprehensive knowledge of the virus, main host, alternate hosts, and vector in the country, in order to channel future research to counteract this problem and minimize losses caused by IYSV in the onion crop mainly.

Knockdown of orthotospovirus-derived silencing suppressor gene by plant-mediated RNAi approach induces viral resistance in tomato

RNA interference (RNAi) shows significant effectiveness in conferring resistance to viral infections in various plants. The current study was conducted to develop transgenic tomato (Solanum lycopersicum cv. Rio Grande) lines expressing a 320 bp conserved inverted region of the integral 35S promoter region. The molecular cloning was done for the construction of expression vectors in a hairpin structure by the Tomato spotted wilt orthotospovirus (TSWV) species Orthotospovirus tomatomaculae, silencing suppressor (NSs) gene. It contains both sense and antisense orientation in a binary vector pFGC5941. Short hairpin RNA (shRNA) structures were employed to reduce the possibility of inducing endogenous non-specific antiviral responses, which usually target longer double-stranded RNAs (dsRNAs). To confirm the transgenic plants, molecular analysis was performed using TSWV gene-specific primers (TSWV-NSs). Based on the EHA105 Agrobacterium strain and the pFGC5941 vector carrying NSs and nptII genes in the T-DNA region, the results validate the insertion of kanamycin resistance into the regenerated transgenic plants. The virus source harboring TSWV was used to inoculate putative transgenic plants for evaluating the confirmation of successful transformation strategy for inducing virus resistance. Quantitative real-time polymerase chain reaction (qRT-PCR) assays were performed by using qRT-NSs primer pairs to determine the relative gene expression of all constructs (TSWV-NSs both sense and antisense orientation) after inoculations. In comparison to the control groups, which contained wild type control (non-transgenic tomato plant), empty pFGC5941 vector and the pFGC5941+sense construct, the expression of the NSs gene was noticeably reduced in the full clone (pFGC5941+sense + antisense) construct. For the validation of RNAi effectiveness, Nicotiana tabacum plants were also inoculated with viral constructs. Specifically, they displayed severe symptoms of TSWV in plants containing the pFGC5941+sense, pFGC5941 empty vector, and in wild-type tomato plants that are correlated with bioassay results. The lack of TSWV symptoms validated the hypothesis after careful observation of the expression of NSs genes in terms of pathogenicity. This research demonstrates the RNA interference effectiveness by targeting NSs gene as a reliable technique for achieving long lasting antiviral protection in tomatoes. The findings have practical relevance and the potential to be a tool for limiting tomato crop losses caused by TSWV worldwide.

Comparison of Field Performance of Georgia-16HO and Florunner Cultivars in the Presence of Tomato Spotted Wilt

Field experiments were conducted at Tifton, Georgia from 2019 to 2020 to compare the effects of new peanut (Arachis hypogaea L.) cultivar ‘Georgia-16HO’ with the former industry standard cultivar ‘Florunner’, and in-furrow applications of phorate or imidacloprid insecticides on severity of tomato spotted wilt (TSW) caused by Tomato spotted wilt virus (TSWV), resultant yield, and crop value. Incidence of TSW was much lower for Georgia-16HO than for Florunner in both years, with differences more obvious in 2019 when the virus pressure was higher. Yield was greater for Georgia-16HO than Florunner in both years with greater differences when disease pressure was higher. Across all treatments, adjusted crop value for Georgia-16HO was ~$1450 /ha greater than for Florunner in 2019 and ~$839 /ha greater in 2020.

Molecular characterization and genetic analysis of Orthotospovirus tomatomaculae (tomato spotted wilt virus) and cucumber mosaic virus infecting tomato and pepper in Türkiye

Many viral diseases threaten the sustainable production of tomato (Solanum lycopersicum) and pepper (Capsicum annuum), which are among the most produced vegetables in the world and Türkiye. Eskişehir province of Türkiye produces a significant amount of vegetables both in the greenhouse and in the open-field. However, there have been no previous comprehensive study on the presence of viruses in tomato and pepper fields. In this study, 123 of 170 samples (72.4%) collected from tomato and pepper fields in Eskişehir in 2019 were infected with different viruses listed. While Orthotospovirus tomatomaculae (tomato spotted wilt virus, TSWV), cucumber mosaic virus (CMV), potato virus Y (PVY), tomato mosaic virus (ToMV), tobacco mosaic virus (TMV) viruses were detected by DAS-ELISA, pepino mosaic virus (PepMV), tomato chlorosis virus (ToCV) and tobacco necrosis virus (TNV) viruses could not be detected in both host plants. To molecularly characterize the selected isolates, the complete nucleocapsid (N) gene region specific to TSWV and a partial capsid protein (CP) gene region specific to CMV were amplified via RT-PCR, followed by sequencing. Phylogenetic trees were constructed with NCBI GenBank isolates and newly sequenced isolates. Genetic structure-related analyses such as genetic diversity, genetic differentiation, gene flow, neutrality tests, selection pressure, and recombination were performed on populations. In the phylogenetic tree of the TSWV N gene, the isolates are divided into three clades of geographical origin. Genetic structure analyses revealed that TSWV populations exhibited genetic diversity. In the phylogenetic tree of the CMV CP gene, the isolates are divided into known subgroups. The analyses indicate the presence of high genetic diversity and suggest that Subgroup IB, one of the clades, may contain subgroups within itself. In addition, there are indications for the existence of different CMV subgroups in Türkiye. Although different approaches were used for both the TSWV N gene and CMV CP gene, no recombination event could be detected. This study, marking the initial identification of viruses in tomatoes and peppers within the Eskişehir region, is believed to hold substantial potential for advancing future research endeavors and enhancing disease management not only within Türkiye but also globally.

Genome-wide identification of cuticle protein superfamily in Frankliniella occidentalis provide insight into the control of both insect vectors and plant virus.

The structural cuticle proteins (CPs) play important roles in the development and fitness of insects. However, knowledge about CP gene superfamily is limited in virus-transmitting insect vectors, although its importance on transmission of plant virus has been gradually emphasized. In this study, the genome-wide identification of CP superfamily was conducted in western flower thrips Frankliniella occidentalis that is the globally invasive pest and plant virus vector pest. The pest transmits notorious tomato spotted wilt virus (TSWV) around the world, causing large damage to a wide array of plants. One hundred and twenty-eightF. occidentalis CP genes (FoCPs) were annotated in this study and they were classified into 10 distinct families, including 68 CPRs, 16 CPAP1s, 6 CPAP3s, 2 CPCFCs, 10 Tweedles, 4 CPFs, 16 CPLCPs, and 6 CPGs. The comprehensive analysis was performed including phylogenetic relationship, gene location and gene expression profiles during different development stages of F. occidentalis. Transcriptome analysis revealed more than 30% FoCPs were upregulated at least 1.5-fold when F. occidentalis was infected by TSWV, indicating their potential involvement in TSWV interactions. Our study provided an overview of F. occidentalis CP superfamily. The study gave a better understand of CP's role in development and virus transmission, which provided clues for reducing viral damages through silencing CP genes in insect vectors.

Effective plant virus enrichment using carbon nanotubes and microfluidics

Plant virus detection and identification in crops is a pillar for disease management, import of crop material, production of clean stock plants and basic plant virology studies. In this report, we present a platform for the enrichment and isolation of known or unknown viruses. This platform is based on carbon nanotube arrays inside a microfluidic device that can be a solution for the identification of low titer viruses from plants. Using our microfluidic devices, we achieved enrichment of two economically important viruses, the orthotospovirus, tomato spotted wilt orthotospovirus (TSWV) and the potyvirus, zucchini yellow mosaic virus (ZYMV). The carbon nanotube arrays integrated in these microfluidic devices are capable of trapping viruses discriminated by their size; the virus rich arrays can be then analyzed by common downstream techniques including immunoassays, PCR, HTS and electron microscopy. This procedure offers a simple to operate and portable sample preparation device capable of trapping viruses from raw plant extracts while reducing the host contamination.

Rapid detection of tomato spotted wilt virus by real-time RT-LAMP and in-field application

Tomato spotted wilt virus (TSWV) is considered one of the most threatening viruses worldwide for different economically important agricultural crops. In this scenario, it is important to perform an early detection by laboratory tests to prevent TSWV spread. A rapid and sensitive TSWV detection protocol based on real time reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed in this work, also using cost-effective and simplified sample preparation procedure, to assess the suitability of the RT-LAMP assay in field conditions on tomato and pepper samples. A set of six primers was designed within the nucleotide sequence region coding for the nucleocapsid protein (N) of segment S, targeting a 220-nucleotide sequence. Sensitivity, specificity, accuracy, and in-field application of the real-time RT-LAMP assay were evaluated. The developed real-time RT-LAMP assay proved to be one thousand and one hundred times more sensitive than end-point RT-PCR and real-time RT-PCR methods, respectively, detecting a total of 9.191 × 101 genome copies as minimum target, and no cross-reactivity were detected with other viruses belonging to Tospoviridae and Bromoviridae families used as outgroup. In addition, the in-field application of the assay using the rapid sample preparation gave adequate and reliable results within 60 minutes, with an acceptable reaction delay when compared to canonical RNA extraction. The in-field analyses showed an increase of TSWV-positive samples (37%) detection compared with end-point RT-PCR and real-time RT-PCR (32% and 29%, respectively), particularly on asymptomatic samples, confirming that the real-time RT-LAMP assay can be implemented as a routine test both in-field and laboratory conditions as a rapid and sensitive technique for TSWV detection.

Advanced methods for insect nets: red-colored nets contribute to sustainable agriculture

Development of advanced pest control methods that do not rely on insecticides is an important issue for sustainable agriculture. Particularly with regards to micro pests that are not only highly resistant to various insecticides but also because we are running out of options for which insecticide to use against them, resulting in enormous economic damage worldwide. Here we report that the effectiveness of the conventional insect net can be greatly advanced by changing their color to red that helps significantly reduce pesticide use. We demonstrate the red effect using Onion thrips, Thrips tabaci a main vector of Iris Yellow Spot Virus (IYSV) and Tomato Spotted Wilt Virus (TSWV) that cause serious damage to various vegetables. New red nets succeeded in suppressing the invasion rates and damages (white spots on the leaves) in a Welsh onion greenhouse with minimum use of pesticides. We discuss how red nets are compatible with labor-saving, sustainable agriculture and the future potential of “optical pest control” based on insect color vision and its behavioral response.

Comprehensive phytohormone metabolomic and transcriptomic analysis of tobacco (Nicotiana tabacum) infected by tomato spotted wilt virus (TSWV)

Tomato spotted wilt virus (TSWV) is ranked among the top 10 most destructive viruses globally. It results in abnormal leaf growth, stunting, and even death, significantly affecting crop yield and quality. Phytohormones play a crucial role in regulating plant-virus interactions. However, there is still limited research on the effect of TSWV on phytohormone levels, particularly growth hormones and genes involved in the phytohormone pathway. In our study, we combined phytohormone metabolomics and transcriptomics to examine the impact of TSWV infection on phytohormone content and gene expression profile. Metabolomic results showed that 41 metabolites, including major phytohormones and their precursors and derivatives were significantly altered after 14 days of TSWV inoculation tobacco plants cvK326, with 31 being significantly increased and 10 significantly reduced. Specifically, the levels of abscisic acid (ABA) and jasmonoyl-isoleucine (JA-Ile) were significantly reduced. The levels of indole-3-acetic acid (IAA) have remained unchanged. However, the levels of cytokinin isopentenyladenine (iP) and salicylic acid (SA) significantly increased. The transcriptome analysis revealed 2,746 genes with significant changes in expression. Out of these, 1,072 genes were significantly downregulated, while 1,674 genes were significantly upregulated. Among them, genes involved in ABA synthesis and signaling pathways, such as 9-cis-epoxycarotenoid dioxygenase (NCED), protein phosphatase 2C (PP2C), serine/threonine-protein kinase (SnRK2), and abscisic acid responsive element binding factor (ABF), exhibited significant downregulation. Additionally, expression of the lipoxygenase gene LOX, Jasmonate ZIM domain-containing protein gene JAZ, and transcription factor gene MYC were significantly down-regulated. In the cytokinin pathway, while there were no significant changes in the expression of the cytokinin synthesis genes, a significant downregulation of transcriptionally active factor type-B response regulators (type-B RRs) was observed. In terms of SA synthesis and signaling pathways, the isochorismate synthase gene ICS1 and the pathogenesis-related gene PR1 were significantly upregulated. These results can strengthen the theoretical foundation for understanding the interaction between TSWV and tobacco and provide new insights for the future prevention and control of TSWV.

First report of saffron latent virus in Crocus sativus from Hungary.

In early April of 2018 we sampled asymptomatic autumn flowering Crocus plants (Fig. S1.) in a private collection in Hajdú-Bihar county, Hungary. From each species (Cr. kotschyanus subsp. kotschyanus, Cr. sativus, Cr. speciosus) 200 mg leaf sample was collected from 5 neighboring shoot, which were treated as one sample. ELISA tests were carried out in duplicates using potyvirus-specific MAb PTY1 antibodies (Jordan and Hammond 1991) on the samples (Agdia, Elkhart, IN, USA). A sample was considered positive if the absorbance was at least three times greater than that of the negative control. Only one sample tested positive; the absorbance values of Cr. sativus leaves were 0.013 and 0.014, while the negative controls were 0.002 and 0.003, respectively. The samples were further tested by RT-PCR for potyviruses (Salamon and Palkovics 2005), tomato spotted wilt virus (TSWV) (Nemes and Salánki 2020) and nepovirus subgroup A (Digiaro et al. 2007). Total nucleic acid was extracted with the phenol-chloroform method of White and Kaper (1989), and reverse transcription was carried out with Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania) using random hexamer primer. The samples were negative for TSWV and nepovirus subgroup A, but a single PCR product of ~ 1700 nucleotide (nt) was amplified with potyvirus specific primers and cloned into pGEM®-T Easy vector (Promega, Madison, WI, USA). The 1726 nt long insert sequence, including the complete coat protein region was determined and deposited in the NCBI GenBank database (Accession No: OR425160). Digestion of the original PCR products with restriction enzyme SacI yielded only the predicted restriction fragments (364 / 1362 bp), indicating the presence of only a single potyvirus in the infected sample. BLASTn analysis of the CP cistron revealed the highest nt identities to saffron latent virus (SaLV) Iranian isolates (GenBank AccNo.: MN990394 - 85.44%, MN990415 - 85.39% and RefSeq: NC_036802 - 84.05%). For phylogenetic analyses MEGA11 (Tamura et al. 2021) was used. The resulting Maximum Likelihood tree (Fig. S2) showed that all Iranian SaLV isolates grouped together, while the Hungarian isolate is on an adjacent branch, separate from other virus species, and supported with 100% bootstrap values. From these results, it appears that the Hungarian isolate has been separated from the Iranian clade, and has evolved separately as a distinct lineage. We were unable to fulfill Koch's postulates as all available Crocus sativus plants were infected with SaLV. Latent potyvirus infection of Crocus species, by bean yellow mosaic virus (BYMV), iris mild mosaic virus (IMMV), iris severe mosaic virus (ISMV) and turnip mosaic virus (TuMV) has been reported by Grilli Caiola and Faoro (2011). SaLV was first reported from Iran (Parizad et al. 2017), but to our knowledge has never been reported from Europe or from any current EPPO member state. Since Crocus species can be asymptomatic virus reservoirs, it is important that any certification scheme for production should require laboratory tests to prove the health of the plants; or advise growers to keep possible high value susceptible crops such as breeding material and nuclear stocks at a distance from crocuses to mitigate virus transmission between stocks. It is also advisable to grow infected lots far from healthy stocks and protected wild hosts. To our knowledge, this is the first report of SaLV from Hungary and from Europe.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.