В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.