Tomatillo Plants Research Articles

Natural occurrence of tomato chlorosis virus on tomatillo (Physalis philadelphica) in the United States.

Tomatillo (Physalis philadelphica L.) is an annual plant native to Mexico and Guatemala, and cultivated in other tropical and subtropical regions. In October 2023, tomatillo plants with interveinal yellowing of leaves, marginal chlorosis, leaf thickening, and leaf rolling symptoms (Figure 1) were observed at Colquitt and Tift County, Georgia, US. The disease incidence ranged from 80-100 % which reduced fruit quality and marketability. Twenty tomatillo leaves exhibiting severe symptoms were collected, and, sub-sampled of the leaves were pooled into microcentrifuge tubes. Further, MagMAX 96 viral RNA isolation kit (Thermo Fisher Scientific, US), was used for the extraction of (n=4) total nucleic acid (TNA) (Kavalappara et al. 2021). Symptomatic leaves were tested for the presence of insect-transmitted viruses such as begomovirus (tomato yellow leaf curl virus, TYLCV), potyvirus (turnip mosaic virus, TuMV), crinivirus (tomato infectious chlorosis virus, TICV; tomato chlorosis virus, ToCV), and tospovirus (orthotospovirus tomatomaculae, TSWV). Polymerase chain reaction (PCR) was performed for detecting TYLCV, using gene-specific primers (Kumar et al., 2023). However, for ToCV, TuMV and TICV detection, cDNA was prepared using 100 ng of TNA as a template, followed by the PCR ( Liu et al., 2012). Moreover, the detection of TSWV was conducted using immuno-strips (Adgia, US) following the manufacturer's instructions. ToCV was detected from all the tested samples, while TuMV, TICV, TYLCV and TSWV were not detected in any symptomatic tissues. In addition, RT-PCR was performed using gene-specific primers targeting the RNA-dependent RNA polymerase (RdRP) gene and the heat-shock protein 70 (Hsp70) gene of ToCV. The PCR amplicon of 439 bp encoding Hsp70 and 643 bp corresponding to RdRP was gel-purified and Sanger sequenced (Azenta Life Sciences, US). BLASTn analysis shows RdRP gene from ToCV-tomatillo (OR905600) has 100 % identity with ToCV of RNA1 segment (RdRP, GenBank accession no. AY903447, Florida, US), while Hsp70 gene (OR900219) has 100 % identity with ToCV of RNA2 segment (Hsp70, GenBank accession no. LC778246, Cairo, Egypt). In addition, the symptomatic tomatillo leaves were studied for transmission assay using tomato, employing non-viruliferous whiteflies (Bemisia tabaci) with 48 h of acquisition access period. Further, two weeks post-infection, the presence of ToCV was detected from the test plants while other whitefly-transmitted viruses remins undetected. In 2023, ToCV is widespread in tomato-growing counties, infecting commercially grown tomato cultivars with intermediate resistance against TYLCV-IL (Israel strain). However, tomatillo plants infected with TuMV in California (Liu et al., 2012), TSWV in Georgia, (Díaz-Pérez and Pappu 2000) and TYLCV in Mexico (Gámez-Jiménez et al. 2009) were reported. This study suggests that tomatillo could be a permissive host for ToCV while restrictive to other prevalent viruses in the region. A recent investigation speculates a potential synergistic interaction between ToCV and TYLCV-IL, exacerbating the breakdown of host resistance in tomato (Fiallo-Olivé et al. 2019, Kumar et al. 2023). To the best of our knowledge, this is the first report for the natural incidence of ToCV on tomatillo within the US. The findings will contribute to developing more effective management strategies against emerging viral threats.

Combined Effect of the Potassium Dose and Plant Biofertilization by Acinetobacter calcoaceticus on the Growth, Mineral Content, Nutritional Quality, Antioxidant Activity, and Metabolomic Features of Tomatillo Fruits (Physalis ixocarpa Brot.).

An Acinetobacter calcoaceticus UTMR2 strain was evaluated in tomatillo plants (Physalis ixocarpa Brot.) using a factorial design with different potassium doses (100, 75, 50 and 0% of the recommended dose). In addition to the agronomic parameters, an analysis of the physicochemical, antioxidant, and metabolomic properties of the fruit was performed. The application of the inoculant affected several parameters of the plant (chlorophyll, weight, and contents of several mineral elements) as well as of the fruit (yield, maturity index, FRAP antioxidant capacity, and contents of protein, fiber, and fat). A multivariate analysis was performed by means of a PCA and a heatmap, indicating that the inoculant induced a strong modulating activity in tomatillo plants for the evaluated parameters, with a remarkable effect at low K doses (0 and 50%). The inoculated treatment at 75% of the K dose resulted in similar plant and fruit characteristics to the fully fertilized control. On the other hand, the biofertilized treatment with no K addition resulted in the highest values in the plant and fruit parameters. In addition, from the metabolomics analysis of the fruits at 75% of the K dose, the up-regulation of 4,4″-bis(N-feruloyl)serotonin, salvianolic acid K, and chlorogenic acid was observed, which may have a role in anti-senescence and resistance mechanisms. In conclusion, the rhizobacterial strain had a positive effect on plant growth, nutritional quality, bioactive compounds, and antioxidant activity of tomatillo fruits at reduced doses of K fertilizer, which gives support for its consideration as an effective biofertilizer strain.

Effects of Plant Covers and Mulching on the Biometric Parameters, Yield and Nutritional Value of Tomatillos (Physalis ixocarpa Brot. Ex Hornem.)

The aim of this study, which involved a field experiment conducted in north-eastern Poland, is to evaluate the phytometric parameters, yield, and biological value of fruit of three tomatillo cultivars grown in soil mulched with black PE (polyethylene) film and covered with PE film and non-woven PP (polypropylene) fabric. A two-factor field experiment was conducted in 2015 and 2017–2018 in the Agricultural Experiment Station owned by the University of Warmia and Mazury in Olsztyn. In the control treatment, tomatillo plants were grown without protective covers or mulch. Tomatillo fruits were harvested gradually, upon physiological maturity, which was determined based on changes in the color of the peel and calyx, and the aroma. The growth and development of tomatillos were evaluated based on plant measurements performed in the field. The chemical composition of tomatillo fruits was analyzed at the stage of full fruiting. During the three-year study, the weight, vertical diameter, and horizonal diameter of fruit were highest in cv. ‘Rio Grande Verde’ and lowest in cv. ‘Purple’. The combined use of mulch and plant covers accelerated fruit ripening. The total and marketable yields of tomatillo fruit were highest in cv. ‘Rio Grande Verde’ and lowest in cv. ‘Purple’. The fruit of cv. ‘Purple’ had the highest content of dry matter, total sugars, extract, β-carotene, and total polyphenols.

LEAF-FEEDING PROCESSING OF PLANTS OF THE TOMATILLO BIOPROOFICIANS UNDER THE CONDITIONS OF THE RIGHT-BANK FOREST-STEPPE OF UKRAINE

The article is devoted to the study of the effect of foliar treatment of Tomatillo plants with the use of drugs of bacterial origin. The paper scientifically substantiates the influence of biologicals on the morphological and biometric parameters of the plant. It was investigated that the emergence of seedlings in varieties Lichtaryk and Pineapple was observed for 7-8 days. After diving and two treatments of plants with drugs, their positive effect on the growth and development of Tomatillo, especially in the phase of budding, flowering and fruiting. A short period of bud formation on the plant was characterized by a variety of Tomatillo Lantern from the use of Biomag. Thus, the beginning of the formation of buds occurred on 66 days on the Lantern variety. A similar effect of the biological product was found during the flowering phase and fruit set. As a result of the activity of Azotobacter chorococum bacteria, the growth and development phases of the Lantern variety are accelerated by 1-3 days compared to the control variant. The use of biological products has had a positive effect on the biometric parameters of the plant. When using bacteria p. Saccharomyces, Azotobacter chroococcum, Paenibacillus polymyxa, Enterobacter nimipressuralis, plant height and stem diameter depended on the type of biological product used. The height of the plant ranged from 82,8 cm to 89,6 cm in the variety Lantern and from 86,8 cm to 91,3 cm in the variety Pineapple. As a result of spraying the plants with Azotobacterin or Rostmoment, the height of the Tomatillo plant exceeded the height of the plant of the variant where biological products were not used. In these variants, the excess of plant height relative to the control was 8,2% for the variety Lantern and 4,3 % for the variety Pineapple, respectively. The diameter of the stem was in the range of 1,9-2,0 cm. Due to the activity of the bacteria Azotobacter chroococcum, Paenibacillus polymyxa, Enterobacter nimipressuralis or yeast p. Saccharomyces and products of their metabolism, revealed a positive effect of biologicals on the increase in leaf area and dry matter content of the leaf. As a result of cultivation of the cultivar Lichtarik and application of Rostmoment or Biopolitsid the area of leaves was at the level of 79,5 thousand м2/ha and 77,6 thousand м2/ha. Growth moment, for the cultivation of the variety Lantern, helped to increase the dry matter content of the leaf by 16,4 %. Treatment of Lantern plants with liquid humus-based concentrate Humisol provided the highest weight of Tomatillo fruit, which was at the level of 8,4 g, and the use of Humisol or Rostmoment for growing varieties Lantern and Pineapple increases the diameter of Tomatillo fruit by 6,9-10,3 %. Humisol, due to humic and fulvic acids, natural phytohormones affects the growth processes of the plant more intensively, which provided in the formation of the largest mass of fruits and their diameter. High yield is characterized by the Tomatillo variety Lantern with five applications of Humisol or Biopolicide, where its value is 33,3 t/ha and 32,0 t/ha. Key words: morphological features, biometric indicators, tomatillo, fruit yield, marketability.

First Report of ‘Candidatus Phytoplasma trifolii’-Related Strain Associated With a New Disease in Tomatillo Plants in Zacatecas, Mexico

First Report of ‘<i>Candidatus</i> Phytoplasma trifolii’-Related Strain Associated With a New Disease in Tomatillo Plants in Zacatecas, Mexico

First Report of ‘Candidatus Phytoplasma trifolii’-Related Strain Associated With a New Disease in Tomato Plants in Zacatecas, Mexico

Tomatillo (Physalis ixocarpa) is an important crop in Mexico with a total of 698,016 tons on 42,882 ha in 2016. In July 2015, symptoms of yellowing, stunted growth, foliar deformation, and phyllody were observed in approximately 12% of tomatillo plants from 25 ha of commercial crops in Zacatecas, Mexico (22°43′17.1″ N, 102°41′06.5″ W). Total DNA was extracted from nine symptomatic and four symptomless tomatillo plants. Direct and nested PCR assays targeting the 16S rRNA gene were used to confirm the association of phytoplasma with the symptomatology. The primers used for direct PCR were P1 5′-AAGAGTTTGATCCTGGCTCAGGATT-3′ and Tint 5′-TCAGGCGTGTGCTCTAACCAGC-3′ (Smart et al. 1996), and for nested PCR, R16F2n 5′-GAAACGACTGCTAAGACTGG-3′ and R16R2 5′-TGACGGGCGGTGTGTACAAACCCCG-3′ (Gundersen and Lee 1996). No PCR products were obtained from the symptomless plants. The nested PCR amplicons (1.2 kb) amplified from all symptomatic plants were cloned separately and directly sequenced. BLAST analysis of the 16S rDNA sequences revealed that they shared 100% sequence identity to each other and 99.0% sequence identity with those of the 16SrVI group, ‘Candidatus Phytoplasma trifolii’ strains. Computer simulated RFLP analysis of the Zacatecas tomatillo phytoplasma sequence (GenBank accession no. MG775048) was performed using iPhyClassifier (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi) and RFLP profiles were compared with each phytoplasma group and subgroup (Zhao et al. 2013) confirming that the analyzed sequence shared 98.9% identity with the reference strain (AY390261). Finally, virtual RFLP patterns were identical to those of the group 16SrVI, subgroup A. Although some reports associate phytoplasmas of the group 16SrVI with diseases in other solanaceous crops such as chili pepper and tomato in Mexico (Mauricio-Castillo et al. 2015; Salas-Munoz et al. 2016), there are no reports about the presence of Ca. P. trifolii related to tomatillo diseases. To our knowledge, this is the first report of Ca. P. trifolii associated with symptomatic tomatillo plants. The presence of phytoplasmas belonging to 16SrVI group on tomatillo could therefore represent a serious threat for this valuable crop in Mexico.

RNA1-Independent Replication and GFP Expression from Tomato marchitez virus Isolate M Cloned cDNA.

Tomato marchitez virus (ToMarV; synonymous with Tomato apex necrosis virus) is a positive-strand RNA virus in the genus Torradovirus within the family Secoviridae. ToMarV is an emergent whitefly-transmitted virus that causes important diseases in tomato (Solanum lycopersicum) in Mexico. Here, the genome sequence of the ToMarV isolate M (ToMarV-M) was determined. We engineered full-length cDNA clones of the ToMarV-M genomic RNA (RNA1 and RNA2), separately, into a binary vector. Coinfiltration of both triggered systemic infections in Nicotiana benthamiana, tomato, and tomatillo (Physalis philadelphica) plants and recapitulated the biological activity of the wild-type virus. The viral progeny generated from tomato and tomatillo plants were transmissible by the whitefly Bemisia tabaci biotype B. Also, we assessed whether these infectious clones could be used for screening tomato cultivars for resistance to ToMarV and our results allowed us to differentiate resistant and susceptible tomato lines. We demonstrated that RNA1 of ToMarV-M is required for the replication of RNA2, and it can replicate independently of RNA2. From this, ToMarV-M RNA2 was used to express the green fluorescent protein in N. benthamiana plants, which allowed us to track cell-to-cell movement. The construction of full-length infectious cDNA clones of ToMarV-M provides an excellent tool to investigate virus-host-vector interactions and elucidate the functions of torradovirus-encoded proteins or the mechanisms of replication of torradovirus genomic RNA.

RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta.

First Report of Turnip mosaic virus in Tomatillo (Physalis philadelphica) in California.

Tomatillo is an important vegetable in Mexican cuisine. It is of Mesoamerica origin and now is grown widely in the Western Hemisphere. In 2011, 2% of commercially grown tomatillo plants in San Benito County, California exhibited severe stunting with foliage showing mosaic symptoms and leaf distortion. The fruits on infected plants were mottled and unmarketable. Flexuous filamentous-shaped virus particles of 800 to 850 nm long and 11 to 12 nm wide were observed from sap of the symptomatic plants with a transmission electron microscope. Sap from the diseased tomatillo plants reacted positively in an immunostrip assay for potyvirus (Agdia Inc., Elkhart, IN), indicating a potyvirus was associated with the disease. The causal agent was mechanically transmitted from the diseased field plants to six virus-free greenhouse tomatillo plants and all inoculated plants induced identical symptoms. The causal agent was also transmitted to Chenopodium quinoa and C. murale (chlorotic local lesions) and Nicotiana clevelandii, N. tabacum, and Physalis wrightii (systemic symptoms). The disease was also transmitted to tomatillo plants by the green peach aphid (Myzus persicae) in a nonpersistent manner (1-min acquisition access period and 1-min transmission access period with no latent period). To further identify the causal agent, total nucleic acids were extracted by a cetyltrimethylammoniumbromide (CTAB) method (2) and tested by reverse transcription-PCR using potyvirus degenerate primers CIFor and CIRev (1). An amplicon of approximately 700 bp from the diseased tomatillo was cloned and sequenced. Analysis of the 631-bp partial CI sequence (GenBank Accession No. JN601884) showed that the virus had 93.6% nucleotide identity and 100% amino acid identity with cognate regions of Turnip mosaic virus (TuMV) (GenBank Accession No. D10927). Our results indicated that the disease was caused by TuMV. To our knowledge, this is the first report of TuMV in tomatillo. Since TuMV has a wide host range and is readily transmitted by green peach aphids, TuMV could be a new threat to tomatillo production in California.

First Report of Tomato yellow leaf curl virus Infecting Tomato, Tomatillo, and Peppers in Guatemala.

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts.

Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico.

Root Zone Temperature, Plant Growth, and Fruit Yield of Tomatillo as Affected by Plastic Film Mulch

Tomatillo (Physalis ixocarpa Brot. ex Hornem) is a popular crop in Mexico and other Latin American countries. There is an increasing demand for this vegetable in the United States, particularly from the growing Latino population. However, there is limited information about tomatillo production. The objectives of this study were to determine the effects of plastic mulches on plant growth, yield, and root zone temperature in two cultivars of tomatillo. The study was conducted in Spring and Summer 2000. The design was a randomized complete block with a split plot arrangement, where plastic film mulch (black, gray, and silver mulches, and bare soil) was the main plot and cultivar (`Toma Verde' and `Verde Puebla]) the subplot. In the spring, mulch treatments had little effect on plant growth during the first 30 days after transplanting and there were no significant differences in fruit yields. In the summer planting, both early growth and fruit yields were greatest with the silver and gray mulch treatments and lowest on bare soil. Plant growth during the establishment was related with subsequent plant growth and yield. In mature plants, vegetative top fresh weight and total fruit yield were higher (P &lt; 0.01) in the spring than in the summer. Total fruit yield (both seasons), marketable yield (spring) and cull yield (spring) were lower in `Toma Verde' than in `Verde Puebla'. Root zone temperatures (RZTs) in the spring (mean = 26.4 °C) were lower than in the summer (mean = 29.3 °C). In both seasons, mean RZT was highest under black mulch and lowest in bare soil. In the summer, plant growth and fruit yields tended to decrease with increasing RZTs. Tomatillo plants grown on mulches with a mean seasonal RZT of 30 °C had fruit yields that were 65% (`Toma Verde') or 50% (`Verde Puebla') lower respectively than those of plants on mulches with a RZT of 27 °C. There were no significant differences in foliar concentrations of N, Ca, Mg, S, B, Zn, Cu and Na among mulches. Foliar concentrations of the majority of mineral nutrients were not related with the mean RZT for the season.

Pepper huasteco virus and Pepper golden mosaic virus are Geminiviruses Affecting Tomatillo (Physalis ixocarpa) Crops in Mexico.

Whitefly-transmitted geminivirus diseases cause important losses in several horticultural crops in all areas in Mexico (1). Tomatillo is important in the Mexican diet since it is widely used to prepare many types of salsas and other dishes. As a result, tomatillo, also known as tomate verde (green tomato), is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Morelos, Puebla, and Michoacán. Leaf samples of 105 tomatillo plants exhibiting yellowing, yellowing mosaic, leaf curl, bunchy top, and stunting were collected from the states of Puebla, Morelos, Estado de México, and Sinaloa. Symptomatic plants were associated with the presence of whiteflies in many fields and suggested a viral etiology. Total DNA extracted from symptomatic tomatillo plants was used as a template in a polymerase chain reaction (PCR)-based geminivirus detection procedure. MP16 and MP82 primers (2) were used to direct the amplification of a segment from the stem-loop structure in the intergenic region (IR) to a conserved region in the coat protein (CP) of begomoviruses (2). Sixty-nine percent (72/105) of the samples produced the expected PCR fragment (400 to 450 bp). Similar results were obtained with a dot-blot hybridization procedure using as a probe the component A of Pepper huasteco virus (PHV) under low stringency conditions. More than 50 PCR products were cloned and sequenced. Sequence analysis (nucleotide level for the IR; amino acid level for the CP) revealed that the tomatillo-infecting geminiviruses clustered into two main groups. The first group showed a high percent identity (average of 95.3% at the CP N terminus) to PHV, whereas the second showed a similarly high percent (average 93.8%) identity to Pepper golden mosaic virus (PepGMV, previously called Texas pepper geminivirus. Both PepGMV and PHV were found in all sampled areas. Although mixed infections (differentiated by the respective IR probes) of PHV and PepGMV were common (61%), single infections were also detected (PHV 27%; PepGMV 10%). The presence of begomoviruses in tomatillo crops has been previously reported (1); however, their identity as PHV and PepGMV was not confirmed.

Agrobacterium-mediated transformation of tomatillo (Physalis ixocarpa) and tissue specific and developmental expression of the CaMV 35S promoter in transgenic tomatillo plants

A protocol for the Agrobacterium-mediated transformation of tomatillo was developed. Up to 40 transgenic plants could be obtained in experiments using 60 cotyledon expiants. The transformed nature of the regenerated plants was confirmed by NPT II and Southern blot hybridization analysis. Using the b-glucuronidase system the tissue specific and developmental patterns of expression of the Cauliflower Mosaic Virus 35S promoter were determined in transgenic tomatillo plants. It was found that this promoter is developmentally regulated during fruit and seed formation.