Secretion Levels Of TNF-α Research Articles

Effects of indoleamine 2,3‐dioxygenases in carbon tetrachloride‐induced hepatitis model of rats

Indoleamine 2,3-dioxygenase (IDO) converts tryptophan to l-kynurenine, and it is noted as a relevant molecule in promoting tolerance and suppressing adaptive immunity. In this study, to investigate the effects of IDO in carbon tetrachloride (CCl(4) )-induced hepatitis model, the levels of IDO enzymic activities in the mock group, the control group and the 1-methyl-D-tryptophan (1-MT)-treated group were confirmed by determination of l-kynurenine concentrations. Serum alanine aminotransferase levels in 1-MT-treated rats after CCl(4) injection significantly increased compared with those in mock and control groups. In CCl(4)-induced hepatitis models, tumour necrosis factor-α (TNF-α) is critical in the development of liver injury. The mRNA expression and secretion levels of TNF-α in the liver from 1-MT-treated rats were more enhanced compared with those in the mock and the control groups. Moreover, the levels of cytokine and chemokine from mock, control group and 1-MT-treated rats after treated with CCl(4) were analyzed by ELISA, and the level of interleukin-6 was found to increase in 1-MT-treated rats. It was concluded that the deficiency of IDO exacerbated liver injury in CCl(4)-induced hepatitis and its effect may be connected with TNF-α and interleukin-6.

Anti-tumour and immunomodulating activities of diosgenin, a naturally occurring steroidal saponin

Diosgenin is a naturally occurring steroidal saponin abundantly present in many medical plants. In this study, diosgenin could significantly inhibit the growth of sarcoma-180 tumour cells in vivo, and remarkably increase thymus and spleen weights of S-180-bearing mice and upgrade the secretion level of TNF-α in serum. Moreover, diosgenin could stimulate lymphocyte transformation and enhance phagocytic capability of macrophages in vitro, and remarkably promoted the secretion of NO and TNF-α in macrophages. These results suggested that diosgenin could improve both specific and non-specific cellular immune responses, and the anti-tumour effects of diosgenin were achieved by immunostimulating properties instead of direct cytotoxicity.

Inhibitory effect of Schisandra chinensis leaf polysaccharide against L5178Y lymphoma

Abstract A water-soluble polysaccharide WSLSCP was extracted from leaves of Schisandra chinensis and purified by DEAE-cellulose and Sepharose CL-6B chromatography. In the present investigation, the physicochemical properties, antitumor and immunomodulating activities of WSLSCP were valuated. The results showed WSLSCP could significantly inhibit the growth of L5178Y lymphoma cells in vivo, and upgrade the secretion level of TNF-α in serum. Moreover, the survival rate of tumor-bearing mice treated with WSLSCP was significantly improved. WSLSCP could enhance phagocytic capability of macrophages in vitro, and remarkably promoted the secretion of NO and TNF-α of macrophages. These results suggested WSLSCP could significantly enhance functions of immune system, and the antitumor effects of WSLSCP were achieved by immunostimulating properties.

Immunomodulatory Activities of Chitin Microparticles on Leishmania major-infected Murine Macrophages

Chitin microparticles (CMPs) are found to be potent macrophage stimulators; however, their immunomodulatory effects on the parasite-infected macrophages have not yet been studied. To address this issue, we used a Leishmania major-infected murine macrophage model and characterized the regulatory effects of CMPs on the parasite-infected cells. Mouse peritoneal macrophages were prepared and infected with L. major (MRHO/IR/1975/ER) standard strain. Following cell treatment with CMPs (500 μg/mL) for 48 h, percent of infected macrophages was determined by Giemsa staining and compared with untreated cells. To find the potential mechanisms of the activity of CMPs, TNF-α and accumulated nitrite in the culture supernatants of the treated and untreated cells were also measured by ELISA and colorimetric Griess assays, respectively. According to the obtained results, chitin microparticles reduced the exvivo parasite infectivity by ∼12%. However, this inhibitory effect was not directly related to the increased biosynthesis and release of nitric oxide (NO) by macrophages. Instead, we observed a significant increase in the level of TNF-α secretion due to cell treatment with CMPs. Interestingly, this overexpression of TNF-α did not impair cell viability, suggesting the anti-apoptotic effects of the CMPs. These findings show that chitin microparticles have immunomodulatory effects on L. major-infected macrophages and further provide motivations for future studies on their invivo effects.

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity.

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.

Extracellular products from virulent strain of Edwardsiella tarda stimulate mouse macrophages (RAW264.7) to produce nitric oxide (NO) and tumor necrosis factor (TNF)-α

We have previously found that high virulent strain (NUF251) of Edwardsiella tarda, but not low virulent strain (NUF194), was able to survive and multiply within Japanese flounder ( Paralichthys olivaceus) peritoneal macrophages. Further studies demonstrated that NUF251 induced much higher levels of NO and TNF-α productions than NUF194 in both Japanese flounder peritoneal macrophages and mouse macrophage cell line RAW264.7. In this study, we examined the effects of extracellular products (ECP) from two strains of E. tarda on RAW264.7 cells in terms of the induction of NO and TNF-α. ECP from NUF251 stimulated RAW264.7 cells to induce NO production in a concentration-dependent manner. The activity of NUF251-ECP completely disappeared by heat-treatment (at 100 °C for 5 min), but it could not be removed by dialysis. Polymyxin B, an endotoxin inhibitor, had no effect on NUF251-ECP-induced NO production. These results suggest that active agents in NUF251-ECP responsible for NO induction may be heat-labile high molecular weight substances rather than the cell wall derived endotoxin like substances. Since NO synthase (NOS) inhibitor, l-NAME, suppressed NUF251-ECP-induced NO production, inducible NO synthase (iNOS) in RAW264.7 cells may be a main source of NO. Furthermore, NUF251-ECP-induced high level of TNF-α secretion from RAW264.7 cells. Both NO and TNF-α productions induced by NUF251-ECP were significantly blocked by a JNK inhibitor. In contrast to NUF251-ECP, no significant activities of NUF194-ECP to induce NO and TNF-α productions were detected. SDS-PAGE and subsequent proteomic analysis of ECP from both strains suggested that NUF251-specific protein, which has sequence homology with flagellin, is present in NUF251-ECP as a main component. Our results suggest that the high virulent strain (NUF251) of E. tarda may specifically produce an exotoxin capable of inducing high levels of NO and TNF-α from macrophages through the activation of JNK system, and most probable candidate for such exotoxin might be a flagellin-like protein.

TLR4-mediated activation of mouse macrophages by Korean mistletoe lectin-C (KML-C)

Korean mistletoe lectin (KML-C) is an adjuvant that activates systemic and mucosal immune cells to release cytokines including TNF-α, which induces immunity against viruses and cancer cells. Although the immunomodulatory activity of KML-C has been well established, the underlying mechanism of action of KML-C has yet to be explored. When mouse peritoneal macrophages were treated with KML-C, both transcription and translation of TLR4 were upregulated. KML-C-induced TLR4 downstream events were similar to those activated by LPS: the upregulation of interleukin-1 receptor-associated kinase-1 (IRAK1); resulting in macrophage activation and TNF-α production. When TLR4 was blocked using a TLR4-specific neutralizing antibody, TNF-α production from the macrophages was significantly inhibited. Moreover, TLR4-deficient mouse macrophages treated with KML-C also secreted greatly reduced level of TNF-α secretion. Finally, TLR4 molecules were co-precipitated with KML-C, to which agarose beads were conjugated, indicating that those molecules are associated. These data indicate that KML-C activates mouse macrophages to secrete TNF-α by interacting with the TLR4 molecule and activating its signaling pathways.

Induction of macrophage death by clinical strains of Mycobacterium kansasii

Mycobacterium kansasii is a facultative intracellular pathogen causing pulmonary disease in immunocompetent patients. Little is known about the host defense against M. kansasii and its intracellular survival strategy inside macrophages. In the present study, we obtained six clinical isolates from patients with M. kansasii pulmonary disease and investigated the intracellular growth and cytotoxic effects of M. kansasii inside mouse bone marrow-derived macrophages (BMDM) as well as cytokine secretion from BMDM. Interestingly, two isolates, SM-1 and 2693-20, displayed faster growth rates and higher levels of TNF-α secretion from macrophages when compared to the other strains. In addition, SM-1 and 2693-20 also induced massive cell death in BMDM and THP-1 acute monocytic leukemia cells, while the slow growing strains induced significantly lower levels of cell death. This cytotoxicity was mainly caused by necrosis, not apoptosis and it was TNF-α-independent. Caspase inhibitors failed to block M. kansasii-induced macrophage death. In addition, necrosis caused by the fast growing strains was accompanied by the loss of mitochondrial membrane potential (ΔΨ m). When dissipation of ΔΨ m was inhibited by the classical mitochondrial permeability transition (MPT) inhibitor cyclosporine A (CsA), macrophage necrosis was reduced. These results suggest that clinical isolates of M. kansasii that grow faster in macrophages induce higher levels of necrosis in a ΔΨ m loss-dependent manner.

In vitro secretion of TNF-α from bone marrow mononuclear cells incubated on amino group modified TiO2 nano-composite under ultrasound irradiation

Abstract It is recently known that titanium dioxide (TiO 2 ) can be excited by ultrasound and release of OH radicals on the surface. In this study, secretion of an indirect angiogenic factor, tumor necrosis factor-α (TNF-α), from bone marrow mononuclear cells (BM-MNC) incubated on amino group modified TiO 2 nano-particles covalently coated on polyester fabric (TiO 2 /PET) under ultrasonic irradiation was examined in vitro . The cell viability and TNF-α secretion were measured under ultrasound irradiation condition with 255 mW/cm 2 of intensity, which is below the highest output (1 W/cm 2 ) specified in the safety standard for a medical ultrasonic diagnostic apparatus. The living cell number on the TiO 2 /PET and original PET with/without continuous ultrasound irradiation was unchanged statistically by ANOVA test. TNF-α secretion level from BM-MNC remarkably increased on the TiO 2 /PET under ultrasonic irradiation without cell damage. It was, therefore, thought that the high level of TNF-α secretion on the TiO 2 nano-composite by ultrasound irradiation was due to oxidative stress induced from OH radicals on TiO 2 .

Reduced TNF-α and IFN-γ responses to Central Asian strain 1 and Beijing isolates of Mycobacterium tuberculosis in comparison with H37Rv strain

Pakistan ranks eighth in terms of tuberculosis burden worldwide, with an incidence of 181/100000. The predominant genotypes of Mycobacterium tuberculosis are reported to be the Central Asian strain 1 (CAS1) and Beijing families.Mycobacteriumtuberculosis down-regulates host pro-inflammatory cytokines, which are essential for protection against infection. There is currently little information regarding the interaction of the CAS1 genotype with host cells. We studied the growth rates of CAS1 and Beijing clinical isolates, and their ability to induce cytokines compared with the laboratory reference strain H37Rv. Host responses were studied using a THP-1 monocytic cell line model and an ex vivo whole blood assay. Growth rates of CAS1 and Beijing isolates were significantly lower (P=0.011) compared with H37Rv. All clinical isolates induced significantly lower levels of TNF-alpha secretion (P=0.003) than H37Rv in THP-1 cells and in the whole blood assay of healthy donors (n=8). They also induced lower IFN-gamma secretion in the whole blood assay (P<0.001). A positive correlation was observed between the growth indices (GI) of H37Rv, Beijing and CAS1 strains and the TNF-alpha responses they induced [Pearson's correlation coefficient (R(2)): 0.936, 0.775 and 0.55, respectively], and also between GI and IFN-gamma production (R(2): 0.422, 0.946, 0.674). These findings suggest that reduced growth rate, together with down-modulation of pro-inflammatory cytokines, is a contributory mechanism for the predominance of the CAS genotype.

The level of TNF-alpha secretion of PBMC in patients with chronic hepatitis C and nonalcoholic fatty liver

To study the roles of TNF-alpha secretion of PBMC in patients with chronic hepatitis C and Nonalcoholic fatty liver. The level of TNF-alpha secretion of PBMC in patients with chronic hepatitis C and Nonalcoholic fatty liver was detected by ELISA after culturing for 72 hours in vitro, as well as patients with chronic hepatitis C and the normal control. (1) Compared with the normal control, the level of TNF-alpha in group with chronic hepatitis C and in group with chronic hepatitis C and Nonalcoholic fatty liver notably increased. (2) Compared with the group with chronic hepatitis C, the level of TNF-alpha in group with chronic hepatitis C and Nonalcoholic fatty liver also notably increased. It suggested TNF-alpha takes important roles in the infection course of chronic hepatitis C with Nonalcoholic fatty liver.

Curcumin enhances non-inflammatory phagocytic activity of RAW264.7 cells

Present study was performed to assess the effect of curcumin treatment on macrophage functions using RAW264.7 cells, a murine macrophage cell line. Phagocytic activity of RAW264.7 cells was enhanced by the treatment with curcumin for 48h while the nitric oxide synthesis from RAW264.7 cells following lipopolysaccharide exposure was blocked. The incubation of RAW264.7 cells with curcumin dose-dependently inhibited the stimulatory responses of macrophage triggered by lipopolysaccharide; the enhanced secretion of inflammatory cytokines such as TNF-α and IL-1β and the up-regulated expression of surface antigens like CD14 and CD40. Curcumin alone, however, was able to increase the basal level of TNF-α secretion and elevated markedly the expression of CD14 and slightly CD40. The marked enhancement of both phagocytic activity and CD14 was detectable as early as 75min after curcumin treatment which is the minimum time period required for the phagocytosis and CD14 measurement, suggesting a signaling pathway distinct from that triggered by apoptotic cells. In conclusion, this study elucidates that curcumin treatment enhances the phagocytic activity with blocking nitric oxide synthesis, a scavenger function of macrophages in non-inflammatory condition. In addition, this enhancement of phagocytic activity is triggered directly by the signals from curcumin itself not by apoptotic cells.

In Vitro Effects of the Reduced Form of Coenzyme Q10 on Secretion Levels of TNF-α and Chemokines in Response to LPS in the Human Monocytic Cell Line THP-1

Ubiquinol-10 (QH2), the reduced form of Coenzyme Q10 (CoQ10) serves as a potent antioxidant of lipid membranes. Because many antioxidants reveal potent anti-inflammatory effects, the influence of QH2 on lipopolysaccharide (LPS)-induced pro-inflammatory cytokines and chemokines were determined in the human monocytic cell line THP-1. Stimulation of cells with LPS resulted in a distinct release of Tumour necrosis factor-alpha (TNF-α), Macrophage inflammatory protein-1 alpha (MIP-1α), Regulated upon activation, normal T cell expressed and secreted (RANTES) and Monocyte chemotattractant protein-1 (MCP-1). The LPS-induced responses were significantly decreased by pre-incubation of cells with QH2 to 60.27 ± 9.3% (p = 0.0009), 48.13 ± 6.93% (p = 0.0007) and 74.36 ± 7.25% (p = 0.008) for TNF-α, MIP-1α and RANTES, respectively. In conclusion, our results indicate anti-inflammatory effects of the reduced form of CoQ10 on various proinflammatory cytokines and chemokines in vitro.

Characterization of the main placental cytokine profiles from HIV-1-infected pregnant women treated with anti-retroviral drugs in France

Cytokines are involved in regulating HIV-1 infection. They are also placental environment major components. We assessed the potential impact of HIV-1 infection and/or anti-retroviral drugs on the placental cytokine profiles that may be involved in controlling HIV-1 placental dissemination. Placental explants were obtained after elective caesarean section from anti-retroviral-treated HIV-1-infected pregnant women and from HIV-1 non-infected pregnant women. The main placental cytokines were assessed for protein secretion in the supernatants of 24-h placental culture explants and/or in uncultured placental explants for mRNA expression levels. The cytokine profiles were different between the HIV-1-infected and the non-infected groups. Higher medians of leukaemia inhibiting factor (LIF), tumour necrosis factor (TNF)-alpha and interleukin (IL)-8 secretion were found in the 24-h culture supernatant of term placenta from HIV-1-infected women. High median levels of IL-16 and regulated upon activation normal T cell expressed and secreted (RANTES) levels were found in both groups. The mRNA expression medians were lower for TNF-alpha and IL-8 and higher for stromal cell-derived factor-1 (SDF-1) in uncultured placental explants from HIV-1-infected women. In the HIV-1-infected group, but not in the non-infected group, the secretion levels of TNF-alpha and IL-8, as well as their mRNA expression levels, were highly positively correlated; furthermore, their secretion levels were correlated positively with LIF and IL-10 secretion levels. We found no correlation between the cytokine levels and the immunovirological status of the HIV-1-infected mothers or the type or duration of treatment. These results highlight the potential impact of HIV-1 and of the anti-retroviral treatments on the placental cytokines pattern, independently of their anti-viral activity.

Aggravated infection in mice co-administered with Mycobacterium tuberculosis and the 27-kDa lipoprotein

We have previously reported that mice immunized with the mycobacterial 27-kDa lipoprotein were more susceptible to Mycobacterium tuberculosis ( Mtb) challenge. We also showed that 27-kDa lipoprotein abrogated the protection afforded by the BCG vaccine when administrated together, suggesting that the 27-kDa lipoprotein may modulate the course of experimental mycobacterial infection. In this study, we address the role of the 27-kDa lipoprotein in modulating the immune response to mycobacteria. Our results show that co-administration of BALB/c mice with Mtb and the 27-kDa lipoprotein ( Mtb+27kDa), but not its non-acylated form, increases the susceptibility of mice to Mtb infection. Significantly lower DTH reaction and splenocyte proliferation to PPD stimulation were also observed in Mtb+27kDa-infected mice compared to Mtb-infected mice. Furthermore, during infection, splenocytes and purified T cells lost their ability to proliferate in response to concanavalin A stimulation more rapidly in the Mtb+27kDa-infected mice, which was accompanied by high IFN-γ and NO production, but low TNF-α secretion levels. Addition of l-NMMA, anti-IFN-γ and anti-TNF-α antibodies restored in vitro proliferative responses of T cells from Mtb+27kDa-infected mice. Short-term l-NMMA treatment of Mtb+27kDa-infected mice prevented the 27-kDa-mediated immunosuppression and increase in susceptibility to Mtb. Altogether, these data suggest that the 27-kDa lipoprotein plays a role in Mtb infection by inducing increased suppression of the immune response due to elevated NO production.

ERK-dependent induction of TNFα expression by the environmental contaminant benzo(a)pyrene in primary human macrophages

Polycyclic aromatic hydrocarbons (PAHs) such as benzo(a)pyrene (BP) are toxic environmental contaminants known to enhance production of pro-inflammatory cytokines such as IL-1β. The present study was designed in order to determine whether TNFα, another cytokine acting in inflammation, may also constitute a target for these chemicals. Both TNFα mRNA and TNFα secretion levels were found to be enhanced in human BP-treated macrophages. Dioxin, a contaminant activating the aryl hydrocarbon receptor (AhR) like PAHs, was also shown to increase TNFα expression. BP-mediated TNFα induction was however not suppressed by AhR antagonists, making unlikely the involvement of the typical AhR signalling pathway. BP-exposure of macrophages did not enhance NF-κB DNA binding activity, but it activated the MAP kinase ERK1/2. In addition, the use of chemical inhibitors of extracellular signal-regulated protein kinase (ERK) activation fully abrogated induction of TNFα production in BP-treated macrophages. These data likely indicate that PAHs enhance TNFα expression in human macrophages through an ERK-related mechanism. Such a regulation may contribute to confer pro-inflammatory properties to these widely-distributed environmental contaminants.

Evaluation of Bronchoalveolar Lavage Fluid Phospholipids and Cytokine Release by Alveolar Macrophages as Prognostic Markers in Sarcoidosis

Background: The clinical course of sarcoidosis is unpredictable and reliable laboratory prognostic parameters are lacking. Objectives: The aim of the present study was to estimate the prognostic value of bronchoalveolar lavage fluid (BALF) phospholipids and cytokine production by alveolar macrophages (AM) in pulmonary sarcoidosis. Methods: We investigated BALF parameters in 64 subjects (55 patients with sarcoidosis and 9 healthy volunteers as controls). After a period of 12 months, the total sarcoidosis study population was divided into three groups according to radiological, functional and laboratory dynamics: the group with a favorable (n = 15), the one with an unfavorable (n = 16) and the one with an intermediate clinical course of the disease (n = 24). Results: The group of patients with a poor clinical outcome was characterized by a lower percentage of lymphocytes in BALF [20% (4–56%)], rather small amounts of cytokines [TNF-α: 1.5 ng/ml/10⁶(0.08–8.6), IL-6: 5.75 ng/ml/10⁶ (1.7–22.5)] and a significant decrease in BALF phospholipids [total lipid phosphorus (TLP): 29.9 µmol/l (13.8–68.3) as compared to 67.5 µmol/l (33.2–127.2) in controls]. Patients with a favorable clinical outcome were shown to have higher lymphocytosis (40%, range 6–64, p < 0.05 versus poor outcome), intensive TNF-α and IL-6 release by AM, and close to normal phospholipid content in BALF. Conclusions: The level of TNF-α secretion by AM <3.9 ng/ml/10⁶ and total lipid phosphorus in BALF less than 30 µmol/l may serve as markers of poor prognosis in pulmonary sarcoidosis.

An intrinsic thyrotropin-mediated pathway of TNF-α production by bone marrow cells

AbstractRecent studies have identified a role for thyroid-stimulating hormone (TSH; ie, thyrotropin) as an inductive signal for tumor necrosis factor-α (TNF-α) secretion by bone marrow (BM) cells, although the features of that activation pathway have not been defined. Using intracellular TSH staining and enzyme-linked immunoassay for detection of secreted TSH, we demonstrate that TSH synthesis in BM cells occurs within CD45+(leukocyte common antigen) hematopoietic cells and that the majority of that activity resides in a component of CD11b+BM cells that are not mature T cells, B cells, or Thy-1+cells in the BM. Conversely, TSH-responsive BM cells defined by expression of TSH receptor (TSHR) using flow cytometry were selectively associated with a nonerythroid CD11b−lymphocyte precursor population. In vitro culture of magnetic-activated cell sorted CD11b−and CD11b+cells with titrated amounts of purified TSH resulted in significantly higher levels of TNF-α secretion from CD11b−BM cells compared to non-TSH–treated cells, with no appreciable change in TNF-α production from CD11b+cells. These findings are the first to demonstrate TSH production by BM hematopoietic cells, and they demonstrate that TSH may be involved in the regulation of TNF-α by CD11b−BM cells. They also indicate that TSH-mediated regulation of TNF-α secretion within the BM most likely operates through an intrinsic network of TSH production and use between different types of BM cells, and they suggest that local TSH may be an important homeostatic regulator of hematopoiesis mediated by TNF-α.

Serum components enhance bacterial lipopolysaccharide-induced tissue factor expression and tumor necrosis factor-alpha secretion by bovine alveolar macrophages in vitro.

We have compared the effect of bacterial lipopolysaccharide (LPS) in combination with normal adult bovine serum (NBS), fetal bovine serum (FBS), or a bovine serum fraction on tissue factor expression and tumor necrosis factor alpha (TNF-alpha) secretion by bovine alveolar macrophages. At a concentration of 1 ng/ml, bacterial LPS alone failed to induce measurable tissue factor expression by the macrophages, but the presence of FBS, NBS, or a fraction of normal pooled bovine serum isolated by ion-exchange chromatography (fraction 2) markedly potentiated the effect of LPS. A protein concentration of 64 micrograms/ml NBS, 192 micrograms/ml FBS, and only 640 ng/ml fraction 2 was required to induce maximal tissue factor expression on the macrophages in combination with 1 ng/ml LPS. Comparison of quantities of added serum protein required to induce maximal potentiating effects indicated that fraction 2 was 100 times more potent than whole NBS and 300 times more potent than whole FBS. We similarly found that TNF-alpha secretion by macrophages exposed to LPS was responsive to serum and was highly responsive to fraction 2. LPS alone (1 ng/ml) induced a relatively low level of TNF-alpha secretion by the macrophages, and the presence of FBS, NBS, or fraction 2 potentiated the effect of LPS. A concentration of 64.0 micrograms/ml NBS, 320.0 micrograms/ml FBS, and 3.2 micrograms/ml fraction 2 serum protein induced near-maximal TNF-alpha secretion by the macrophages. Comparison of the concentration of serum protein required to induce these potentiating effects indicated that fraction 2 was approximately 20 times more potent than whole NBS and 100 times more potent than whole FBS. The stimulatory effect of LPS plus fraction 2 serum proteins was dependent on the CD14 receptor, as monoclonal antibodies directed against CD14 (My4, 60bd; 10 micrograms/ml) inhibited tissue factor expression and TNF-alpha secretion by the macrophages.