Sheet Of Tissue Research Articles

Growth and shrinkage of tissue sheets on substrates: buds, buckles, and pores

Abstract Many tissues take the form of thin sheets, being only a single cell thick, but millions of cells wide. 
These tissue sheets can bend and buckle in the third dimension. In this work, we investigated the growth and shrinkage of suspended and supported tissue sheets using particle-based simulations. We construct a minimum model, combining particle-based tissue growth and meshless membrane models, to simulate the growth of tissue sheets with mechanical feedback. Free suspended growing tissues exhibit wrinkling when growth is sufficiently fast. Conversely, tissues on a substrate form buds when the adhesion to the substrate is weak and/or when the friction with the substrate is strong. These buds undergo a membrane-mediated attraction and subsequently fuse. The complete detachment of tissues from the substrate and straight buckled bump formation are also obtained at very weak adhesion and/or fast growth rates. In the tissue shrinkage, tissue pores grow via Ostwald ripening and coalescence. The reported dynamics can also be applied in research on the detachment dynamics of different tissues with weakened adhesion.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Three-dimensional characteristics of the alveolar capillary network in infant and adult human lungs.

A comprehensive understanding of vascular development in the human lung is still missing. Therefore, samples of infant (n = 5, 26 days to 18 months postnatally) and adult (n = 5, 20 to 40 years) human lungs were subjected to unbiased stereological estimation of the total number of capillary loops. Serial sections were segmented to visualize the alveolar capillary network (ACN) in 3D. The number of capillary loops increased in parallel to lung volume from 26 days to 18 months, while in adults, it was not correlated to lung volume. In infant lungs, two capillary layers were separated by a connective tissue sheet with a growing number of interconnections. In adults, the mature ACN was almost, but not completely, single-layered. Here, the connective tissue was thinner but still centrally positioned, suggesting the persistence of interconnected parts of both layers of the previously double-layered ACN. Small parts of the capillaries remain double-layered and seem to be grouped around the thin connective tissue sheet, suggesting a different mechanism of microvascular maturation than simple fusion of the two layers. These spots are a potential basis for further alveolarization after completion of bulk formation. The 3D data offer a new conceptual approach to microvascular maturation of the lung. Microvascular maturation rather results from reduction than simple fusion of capillary fragments. Adult lungs maintain small double-layered capillary spots. These could offer a potential source of regeneration. The data are important to better understand normal and pathological lung development.

Water absorption of commercial and laboratory tissue sheets

Water absorption of commercial and laboratory tissue sheets

Improved whole-mount immunofluorescence protocol for consistent and robust labeling of adult Drosophila melanogaster adipose tissue.

Energy storage and endocrine functions of the Drosophila fat body make it an excellent model for elucidating mechanisms that underlie physiological and pathophysiological organismal metabolism. Combined with Drosophila's robust genetic and immunofluorescence microscopy toolkits, studies of Drosophila fat body function are ripe for cell biological analysis. Unlike the larval fat body, which is easily removed as a single, cohesive sheet of tissue, isolating intact adult fat body proves to be more challenging, thus hindering consistent immunofluorescence labeling even within a single piece of adipose tissue. Here, we describe an improved approach to handling Drosophila abdomens that ensures full access of the adult fat body to solutions generally used in immunofluorescence labeling protocols. In addition, we assess the quality of fluorescence reporter expression and antibody immunoreactivity in response to variations in fixative type, fixation incubation time, and detergent used for cellular permeabilization. Overall, we provide several recommendations for steps in a whole-mount staining protocol that results in consistent and robust immunofluorescence labeling of the adult Drosophila fat body.

Effect of Basic Fibroblast Growth Factor in Perifascial Areolar Tissue Transplant

Abstract Background: Perifascial areolar tissue (PAT) transplant is a technique in which a sheet of connective tissue on the fascia is harvested and transplanted to the wound bed. PAT engraftment fails when the exposed area of tendons, bones, or artificial materials is large. On the other hand, combination of tissue transplant and basic fibroblast growth factor (bFGF) improves the survival rate of the transplanted tissue. Methods: A wound model was created in which the artificial material was exposed on rats' backs. All the rats underwent PAT transplant, but the rats were divided into two groups according to the PAT processing method beforehand. In one group, the PAT was immersed in water for injection before transplant (bFGF[–] group), and in the other group, the PAT was immersed in bFGF product (bFGF[+] group). Specimens were collected 7 days after surgery to assess the histologic thickness of the PAT and the gene expression in the PAT. Results: The thickness of the PAT in the tissue slices was significantly higher in the bFGF(+) group than in the bFGF(–) group. Expressions of CD34 and COL3A1 were significantly higher in the bFGF(+) group than in the bFGF(–) group. Conclusion: The results of this study indicate that adding bFGF to the PAT transplant may promote PAT engraftment and wound healing by increasing angiogenesis and may increase granulation formation, which may result in a stronger covering that prevents the prosthesis from being exposed.

Massive field-of-view sub-cellular traction force videography enabled by Single-Pixel Optical Tracers (SPOT)

We report a massive field-of-view and high-speed videography platform for measuring the sub-cellular traction forces of more than 10,000 biological cells over 13 mm2 at 83 frames per second. Our Single-Pixel Optical Tracers (SPOT) tool uses 2-dimensional diffraction gratings embedded into a soft substrate to convert cells' mechanical traction force into optical colors detectable by a video camera. The platform measures the sub-cellular traction forces of diverse cell types, including tightly connected tissue sheets and near isolated cells. We used this platform to explore the mechanical wave propagation in a tightly connected sheet of Neonatal Rat Ventricular Myocytes (NRVMs) and discovered that the activation time of some tissue regions are heterogeneous from the overall spiral wave behavior of the cardiac wave.

Abstract 6971: The impact of lecithin retinol acyltransferase in squamous cell carcinoma: Tissue formation, cell mechanics, and gene transcription

Abstract Squamous cell carcinoma, along with several other cancers, has been found to lack expression of lecithin retinol acyltransferase (LRAT), a protein which catalyzes retinol esterification and thereby mediates retinoic acid biosynthesis. When expression of LRAT was reintroduced in squamous cell carcinoma, the protein promoted cell differentiation in addition to retinoid status normalization—whether this effect was dependent on the known enzymatic activity of LRAT in retinol esterification, versus another function, has not yet been established. Cell elasticity differences have also been reported between squamous cell carcinoma and normal keratinocytes. In this study, the role of LRAT expression and activity was evaluated in human squamous cell carcinoma cell line SCC13. LRAT was integrated into the genome of SCC13 via retroviral transduction, both as wild-type LRAT and LRAT with a cysteine-to-serine mutation at the active site for retinol esterification (C161-S). In these transformed cell lines, LRAT promoted formation of a cohesive sheet of tissue which remained intact after its removal from the tissue culture plastic surface, as evaluated at two weeks post-confluence. SCC13 alone produced tissue which easily fragmented during this scraping assay. In an evaluation of cell elasticity with shear modulation force microscopy, relative cell modulus measurements of pre-confluent SCC13 with LRAT expression were found to be significantly greater and consistent with the cell modulus of human keratinocytes (DO33). These effects persisted with mutation of the retinol esterification active site, suggesting that LRAT possesses an additional function which has yet to be described. Variation in transcription levels of multiple genes—urokinase-type plasminogen activator, plasminogen activator inhibitor 1, tissue inhibitor of metalloproteinases 1, and kallikrein 5—was also found based on LRAT expression and level of confluence. These findings suggest that the presence of LRAT influences tissue formation, cell elasticity, and gene transcription in SCC13. Citation Format: Emily Peterson, Kuan-Che Feng, Jay Gao, Miriam Rafailovich, Marcia Simon. The impact of lecithin retinol acyltransferase in squamous cell carcinoma: Tissue formation, cell mechanics, and gene transcription [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6971.

Waste management in a tissue paper mill: a practical approach

The principles of sustainability, together with the Sustainable Development Goals (SDGs) defined by the United Nations (UN), are essential tools for achieving and maintaining quality of life for the coming years. The sector can make use of these objectives, and the process can become more efficient, with less water consumption and reduced waste. Using virgin cellulose fiber derived from eucalyptus or even recyclable white paper as raw material, this production method is responsible for producing paper with characteristics such as softness, low grammage and good liquid absorption, with products such as toilet paper, napkin, among others. Within the manufacturing process, several procedures can be responsible for the appearance of lint and paper dust, being a type of waste in this industry. Among these, we can mention the increase in fines content, resulting from the fiber refining process, initial mechanical treatment of the paper raw material, which provides the product with resistance. The paper crepe formation procedure is responsible for making the tissue sheet acquire characteristics such as softness and volume, but which can lead to the creation of waste. Through a simple approach related to the balance of process materials, with the analysis of process inputs and outputs, the aim of this work is to estimate the amount of material lost in a tissue paper machine. It is a fundamental preliminary assessment for making decisions regarding waste management.

Modeling mutation-specific arrhythmogenic phenotypes in isogenic human iPSC-derived cardiac tissues

Disease modeling using human induced pluripotent stem cells (hiPSCs) from patients with genetic disease is a powerful approach for dissecting pathophysiology and drug discovery. Nevertheless, isogenic controls are required to precisely compare phenotypic outcomes from presumed causative mutations rather than differences in genetic backgrounds. Moreover, 2D cellular models often fail to exhibit authentic disease phenotypes resulting in poor validation in vitro. Here we show that a combination of precision gene editing and bioengineered 3D tissue models can establish advanced isogenic hiPSC-derived cardiac disease models, overcoming these drawbacks. To model inherited cardiac arrhythmias we selected representative N588D and N588K missense mutations affecting the same codon in the hERG potassium channel gene KCNH2, which are reported to cause long (LQTS) and short (SQTS) QT syndromes, respectively. We generated compound heterozygous variants in normal hiPSCs, and differentiated cardiomyocytes (CMs) and mesenchymal cells (MCs) to form 3D cardiac tissue sheets (CTSs). In hiPSC-derived CM monolayers and 3D CTSs, electrophysiological analysis with multielectrode arrays showed prolonged and shortened repolarization, respectively, compared to the isogenic controls. When pharmacologically inhibiting the hERG channels, mutant 3D CTSs were differentially susceptible to arrhythmic events than the isogenic controls. Thus, this strategy offers advanced disease models that can reproduce clinically relevant phenotypes and provide solid validation of gene mutations in vitro.

Segmental aplasia of the paramesonephric duct in a New Zealand white rabbit and a review of the literature.

In females, the paramesonephric (syn: Müllerian) duct gives rise to the uterine tubes, uterus, cervix, and part of the vagina. Segmental uterine aplasia resulting from a paramesonephric duct abnormality has been reported in a range of species including bovids, canids, felids, equids, camelids, and lagomorphs. Here we document segmental aplasia of the left paramesonephric duct in a New Zealand white rabbit. The proximal 70 mm of the left uterine tube was present and terminated in adipose tissue. A 10 × 2 × 1-mm tag of cream tissue was present and was composed of sheets of adipose tissue and streams of smooth muscle, but otherwise, there was no evidence of the left uterine horn, supporting a diagnosis of unilateral uterine aplasia (uterus unicornis) analogous to a human class II (unicornuate uterus) lesion of the "no horn" subtype. In addition, our case had a concurrent uterine tube fimbrial cyst, minor cysts in the left kidney, and mammary gland hyperplasia with secretory activity. We suggest the adoption of a uniform classification system specifically for lagomorph uterine anomalies. Large-scale multi-center studies documenting prevalence of such lesions would facilitate identification of trends in laterality and other factors.

Development of a thick and functional human adipose-derived stem cell tissue sheet for myocardial infarction repair in rat hearts

BackgroundHeart failure (HF) is a major cause of death worldwide. The most effective treatment for HF is heart transplantation, but its use is limited by the scarcity of donor hearts. Recently, stem cell-based therapy has emerged as a promising approach for treating myocardial infarction. Our research group has been investigating the use of human induced pluripotent stem cell-derived cardiomyocyte patches as a potential therapeutic candidate. We have successfully conducted eight cases of clinical trials and demonstrated the safety and effectiveness of this approach. However, further advancements are necessary to overcome immune rejection and enhance therapeutic efficacy. In this study, we propose a novel and efficient technique for constructing mesenchymal stem cell (MSC) tissue sheets, which can be transplanted effectively for treating myocardial infarction repair.MethodsWe applied a one-step method to construct the human adipose-derived mesenchymal stem cell (hADSC) tissue sheet on a poly(lactic-co-glycolic acid) fiber scaffold. Histology, immunofluorescence, and paracrine profile assessment were used to determine the organization and function of the hADSC tissue sheet. Echocardiography and pathological analyses of heart sections were performed to evaluate cardiac function, fibrosis area, angiogenesis, and left ventricular remodeling.ResultsIn vitro, the hADSC tissue sheet showed great organization, abundant ECM expression, and increased paracrine secretion than single cells. In vivo, the hADSC tissue sheet group demonstrated improved cardiac functional recovery, less ventricular remodeling, decreased fibrosis, and enhanced angiogenesis than the MI group.ConclusionsWe developed thick and functional hADSC tissue sheets via the one-step strategy. The hADSC tissue sheet showed excellent performance in treating myocardial infarction in the rat model.Graphical

Abstract 13022: Myocardial Restoration and Functional Recovery Through Transplantation of Vascularized Cardiac Microtissues Derived From Human Induced Pluripotent Stem Cells in a Rat Model of Myocardial Infarction

Introduction: Cardiac regenerative therapy is acknowledged as a promising strategy for treating individuals suffering from severe heart failure. To address the current constraints of stem cell therapy, which primarily relies on indirect paracrine effects for functional improvement, the ideal goal would be to restore the damaged myocardium in the diseased heart. To achieve this, the transplantation of biomimetic heart tissues that closely resemble the natural structure of the heart is highly anticipated. Methods: We successfully generated 3-dimensional vascularized cardiac microtissues (VCMs) using human induced pluripotent stem cells (hiPSCs) through dynamic culture on thin cardiac tissue sheets (CTSs) composed of hiPSC-derived cardiomyocytes and vascular cells. These VCMs exhibited a robust vascular network comprising human vascular cells. Subsequently, we transplanted CTSs (n=6) or VCMs (n=6) onto an athymic rat model of myocardial infarction (MI), while a sham operation was performed on another group (n=6). To assess cardiac function, we employed cardiac magnetic resonance imaging. The survival of grafts, extension of fibrotic scars, neovascularization in the MI border zone, and the formation of a human vascular network within the engrafted region were evaluated through histopathology and light sheet fluorescence microscopy with tissue clearing techniques. Results: Functional analyses demonstrated that the VCM group exhibited the highest left ventricular ejection fraction (Sham: 36.5±0.9%, CTS: 43.5±2.9%, VCM: 55.2±2.5%, p < 0.01). Histopathological evaluation revealed that the VCM group had a larger engraftment area, along with the smallest scar extension and the highest vascular density in the myocardial infarction border zone. Furthermore, LSFM revealed the presence of vascular networks originating from human cells within the engrafted VCMs. Conclusions: The transplantation of hiPSC-derived VCMs demonstrated remarkable therapeutic potential in a rat model of MI, leading to the formation of a vascular network by human cells. This approach might hold great promise as an effective strategy for efficiently restoring the damaged myocardium in hearts afflicted with disease.

MoS2 Nanoflakes based Kilohertz Electrochemical Capacitors

AbstractAn ultra‐fast electrochemical capacitor (EC) designed for efficient ripple current smoothing was fabricated using vertically oriented MoS2 (VOM) nanoflakes deposited on freestanding carbonized cellulose (CC) sheets as electrodes. The daily used cellulose tissue sheets were transformed into electrode scaffolds through a rapid pyrolysis process within a preheated furnace, on which VOM nanoflakes were formed in a conventional hydrothermal process. With these ~10 μm thick VOM‐CC electrodes, ultrafast ECs with tunable frequency response and specific capacitance density were fabricated. The ECs with a cell‐level areal capacitance density of 0.8 mF/cm2 at 120 Hz were demonstrated for ripple current filtering from 60 Hz to 60 kHz. At a lower frequency response level, EC cell with a large capacitance density of 4.8 mF/cm2 was also demonstrated. With the facile and easily scaled up process to producing the nanostructured electrode, the miniaturized VOM‐CC based ECs have the potential to substitute the bulky aluminum electrolytic capacitors for current smoothing and pulse power applications.

Cardiac Electrophysiology Meshfree Modeling through the Mixed Collocation Method

We present the meshfree mixed collocation method (MCM) for cardiac electrophysiology simulation. Capitalizing on the meshfree property of MCM, we introduce an immersed grid approach for automated generation of meshfree node grids from medical image data. This approach allows us to avoid the time-consuming mesh generation and processing that mesh-based methods like the finite element method (FEM) require. We employ the MCM to solve the cardiac monodomain model considering electrical propagation in 2D tissue sheets, 3D tissue slabs, and a realistic biventricular anatomy. We demonstrate that the solutions obtained by the MCM are in good agreement with the FEM, particularly when immersed grid is used. These findings confirm the suitability of the MCM for cardiac electrophysiology simulation and make the MCM a promising alternative to the FEM for cardiac electrical investigations.

Pulmonary Atresia (PA) with Anomalous Origin of the Pulmonary Artery

Pulmonary atresia with ventricular septal defect is a severe form of congenital cyanotic heart disease (TOF) but its not very common form. Here main pulmonary does not arises from common arterial trunk. In pulmonary atresia there is no proper formation ofthe pulmonary valve which allows blood from the heart to thelung of patient. Instead of opening and closing of the valve,a solid sheet of tissue develops. Therefore blood cannot flow by its normal path to take oxygen from the lung. Instead, inadequate blood travels to the lung through other natural routes within the heart and its arteries and presenting degree of pulmonary atresia or discontinuity in arteries. MDCT gave structural details in this regard. So, role of MDCT play an important role to evaluate the details important information needed in preoperative evaluation for surgical policy in atretic patients. Here we discuss a case of pulmonary atresia (PA) with anomalous origin of the pulmonary artery.KYAMC Journal Vol. 14, No. 02, July 2023: 102-104.

An Engineered Dermal Substitute with Mesenchymal Stem Cells Enhances Cutaneous Wound Healing.

The treatment of refractory cutaneous wounds remains to be a clinical challenge. There is growing evidence to show that mesenchymal stem cells (MSCs) have great potential in promoting wound healing. However, the therapeutic effects of MSCs are greatly dampened by their poor survival and engraftment in the wounds. To address this limitation, in this study, MSCs were grown into a collagen-glycosaminoglycan (C-GAG) matrix to form a dermis-like tissue sheet, named engineered dermal substitute (EDS). When seeded on C-GAG matrix, MSCs adhered rapidly, migrated into the pores, and proliferated readily. When applied onto excisional wounds in healthy and diabetic mice, the EDS survived well, and accelerated wound closure, compared with C-GAG matrix alone or MSCs in collagen hydrogel. Histological analysis revealed that EDS prolonged the retention of MSCs in the wounds, associated with increased macrophage infiltration and enhanced angiogenesis. RNA-Seq analysis of EDS-treated wounds uncovered the expression of abundant human chemokines and proangiogenic factors and their corresponding murine receptors, suggesting a mechanism of ligand/receptor-mediated signals in wound healing. Thus, our results indicate that EDS prolongs the survival and retention of MSCs in the wounds and enhances wound healing.

Cavitation processes in a space filled with loose mesenchymal tissues: a comparison between the retrosternal space and the middle ear tympanic cavity in human fetuses.

During the expansion of the pleural cavity in early fetuses, a thick sheet of loose mesenchymal tissue (SLMT) appears between the lung bud and body wall. Subsequently, the growing lung bud invades into the SLMT and the latter becomes fragmented to disappear. To compare this with the tympanic cavity filled with loose mesenchymal tissues, the present study aimed to demonstrate the development, establishment, and breaking of the SLMT in the retrosternal space. Although the retrosternal tissue was almost absent or very thin at 7 weeks, the SLMT appeared behind the manubrium sterni at 8 weeks. Accordingly, at 9-10 weeks, cavitation occurred in the SLMT to expand the pleural cavity. Therefore, the volume of SLMT was not determined by the adjacent structures such as the pericardium and sternum. Likewise, mesenchymal tissues filling the middle ear disappeared after 26 weeks. There were considerable individual variations in the timing of beginning and location of the tympanic cavitation. However, in contrast to the retrosternal SLMT, the volume of the future tympanic cavity is determined by the adjacent hard tissue and tympanic membrane much earlier than the cavitation. The mesenchymal tissue carried abundant vessels in the middle ear but none or few veins in the retrosternal SLMT. The concept that the lung bud invades into the splanchnic mesoderm to expand the pleural cavity seems oversimplified. Mechanical stresses from the pleural cavity might induce retrosternal cavitation, while a loss in blood supply might cause tympanic cavitation.

Lacertus Syndrome: an Outcome Analysis After Lacertus Release

The lacertus fibrosus or bicipital aponeurosis is a sheet of ligamentous tissue just distal to the elbow joint and can be a compression point for the median nerve. Essentially, lacertus syndrome is a subset of pronator syndrome and an uncommon diagnosis by itself. Surgical release of the lacertus consists of a small 2-cm incision that can be performed under local anesthesia. This study aimed to evaluate the outcome of lacertus release in resolving median nerve symptoms. This retrospective study was performed at Prince Court Medical Centre, Kuala Lumpur, Malaysia, from January 2020 until June 2021. Ninety-three patients who presented with numbness of fingers, hand, or upper limb; forearm pain; and muscle weakness. They were diagnosed with lacertus syndrome on the basis of local tenderness at the lacertus fibrosus with either weakness of flexor pollicis longus and flexor digitorum profundus of the index finger or paresthesia over the thenar eminence. The patients underwent 3 months of hand therapy, and those with no symptom improvement were offered lacertus release performed by a single surgeon. The surgical technique consists of a surgical incision starting from a point 2 cm distally and 2 cm radially to the medial epicondyle. The incision projects 2 cm distally in an oblique fashion toward the radial styloid. A wide-awake local anesthesia no tourniquet (WALANT) technqiue was utilized and 20 mL of local anesthesic was injected subcutaneously around this region at least 20 minutes before the surgery. Careful dissection was made subcutaneously, and the lacertus fibrosus was identified as a thickened, shiny white structure and released. The Quick Disabilities of the Arm, Shoulder, and Hand (QuickDASH) score, grip strength, and pinch strength were tested before and after surgery. At 6 months after surgery, the QuickDASH score was again assessed with a WALANT satisfactory questionnaire. A total of 93 patients were included in the study. The mean age of the patients was 38.7 years, and most were women (77.4%). The mean operating time was 70 minutes. The mean preoperative QuickDASH score was 53, which significantly reduced immediately after surgery to 7.8 (P < .001) and remained low at 6 months after surgery (10.6). The mean grip strength showed a significant increase from a preoperative mean of 16 kg to a postoperative mean of 24 kg (P < .001). Pinch strength also significantly increased from a preoperative mean of 9 kg to 13 kg after surgery (P < .001). Lacertus syndrome remains an underdiagnosed disease that can be treated efficiently with a directed minimal surgical incision under wide-awake local anesthesia. Lacertus release appears to significantly reduce pain and numbness with markedly improved hand grip and pinch strength. The corresponding QuickDASH scores also improved significantly after surgery. This study is vital to our understanding of proximal median nerve entrapment and to accurately diagnose it. Therapeutic III.

Method for studying water removal and air penetration during through air drying of tissue in laboratory scale

Energy use, together with consumption of raw materials, machine clothing, and wet end chemicals, are some of the most critical aspects in successful tissue making today. This work was aimed at developing a laboratory-scale method of estimating dewatering mechanisms, vacuum efficiency, and energy use of Through Air Drying (TAD) of tissue. When compared to pilot data, the results of the new laboratory method for investigating dewatering during TAD were in the same magnitude, around 24 to 26% dryness after vacuum dewatering, and 27 to 29% dryness after TAD molding. Sheet properties, such as caliper and surface profile, were evaluated and compared to commercial tissue sheets. The results indicate that it will be possible to precisely measure accurate dryness development and penetrated air volume for tissue sheet forming and TAD molding at a laboratory scale. This can contribute to the efforts of implementing a circular forest-based bioeconomy by increasing the fundamental understanding of dewatering of tissue paper materials, which is facilitated by improvements in energy use. The new method developed in this work will make it easier to assess ideas that are difficult to bring to pilot scale or full scale before learning more of the dewatering capabilities. The authors are convinced that improved knowledge of tissue dewatering mechanisms, forming, and material transport during and after TAD dewatering can increase the efficiency of the industrial manufacturing processes.