Tilapia Populations Research Articles

Finding of the Blue Tilapia <i>Oreochromis aureus</i> (Cichlidae) in the Gorky Reservoir (Volga River)

A new find of blue tilapia Oreochromis aureus (Steindachner, 1864) from the Volga River, area of the Kostroma state district power station (57.46736 N, 41.18503 E) is described. Data on morphology and nucleotide diversity (COI, 16S and 18 loci) for O. aureus are given. It is assumed that the vector of invasion is associated with human activity. There is a high probability of the formation of a large population of blue tilapia in this area.

On the Species Identification of Two Non-Native Tilapia Species, Including the First Record of a Feral Population of Oreochromis aureus (Steindachner, 1864) in South Korea.

Tilapia is an invasive species that has become widely distributed around the world. In Korea, introduced tilapia into its aquatic ecosystem for the first time with a species from Thailand in 1955, and later additionally introduced two more species from Japan and Taiwan, thus securing a total of three species of tilapia (O. niloticus, O. mossambicus and O. aureus) as food resources. Since then, O. niloticus has been reported to inhabit certain streams with thermal effluent outlets. Morphological species identification is very difficult for tilapia and a combined analysis of morphological and molecular-based species identification is therefore necessary. This study investigated a tilapia population that inhabits a thermal effluent stream (Dalseo Stream) in Daegu Metropolitan City, Korea, in order to conduct a morphological and genetic species identification of this population. In total, 37 tilapia individuals were sampled. The results of the morphological and genetic species identification analyses found that two species, O. aureus and O. niloticus, inhabit the Dalseo Stream. In Korea, the habitat of the O. niloticus natural population has been reported, but the O. aureus natural population has not been reported. Thus, we observed for the first time that a new invasive species, O. aureus, inhabits a stream in Korea. They are known to cause disturbances to aquatic organisms (e.g., fish, aquatic insects, plankton, aquatic plants) and the habitat environment (e.g., water quality, bottom structure). Accordingly, it is important to study the ecological effects of O. aureus and O. niloticus on the corresponding freshwater ecosystem closely and to prepare a management plan to prevent the spread of these species, as they are notoriously invasive.

Effect ofhigh temperatures onsex ratio anddifferential expression analysis (RNA-seq) ofsex-determining genes inOreochromis niloticus from different river basins inBenin.

The high temperature sex reversal process leading to functional phenotypic masculinization during development has been widely described in Nile tilapia (Oreochromis n iloticus) under laboratory or aquaculture conditions and in the wild. In this study, we selected five wild populations of O. niloticus from different river basins in Benin and produced twenty full-sib families of mixed-sex (XY and XX) by natural reproduction. Progenies were exposed to room temperature or high (36.5°C) temperatures between 10 and 30 days post-fertilization (dpf). In control groups, we observed sex ratios from 40% to 60% males as expected, except for 3 families from the Gobé region which showed a bias towards males. High temperature treatment significantly increased male rates in each family up to 88%. Transcriptome analysis was performed by RNA-sequencing (RNA-seq) on brains and gonads from control and treated batches of six families at 15 dpf and 40 dpf. Analysis of differentially expressed genes, differentially spliced genes, and correlations with sex reversal was performed. In 40 dpf gonads, genes involved in sex determination such as dmrt1, cyp11c1, amh, cyp19a1b, ara, and dax1 were upregulated. In 15 dpf brains, a negative correlation was found between the expression of cyp19a1b and the reversal rate, while at 40 dpf a negative correlation was found between the expression of foxl2, cyp11c1, and sf1 and positive correlation was found between dmrt1 expression and reversal rate. Ontology analysis of the genes affected by high temperatures revealed that male sex differentiation processes, primary male sexual characteristics, autophagy, and cilium organization were affected. Based on these results, we conclude that sex reversal by high temperature treatment leads to similar modifications of the transcriptomes in the gonads and brains in offspring of different natural populations of Nile tilapia, which thus may activate a common cascade of reactions inducing sex reversal in progenies.

Genetic diversity of a cichlid fish population after 100 years of isolation

AbstractHigh rates of species radiation have been recorded in Cichlids of East African lakes. The current study focused on a population of Nile tilapia (Oreochromis niloticus) found in a crater lake (Lake Crocodile) that occurs within the Central Island of Lake Turkana. The population separated from Lake Turkana about 100 years ago and has since then existed in isolation. This study aimed at assessing the existence of genetic differences between the Lake Crocodile Nile tilapia population and other closely related Nile tilapia populations from Lake Turkana, Lake Baringo and River Suguta. Genetic differences between the populations were evaluated using two mtDNA markers, and 16 microsatellite markers. Significant genetic differences (p > 0.05) were observed between the Lake Crocodile population and the other studied populations within the region. Despite the shared ancestry between Lake Crocodile and Lake Turkana, genetic differences were observed between the two populations. This can mostly be attributed to the lack of gene flow and environmental differences between the two populations.

Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria

This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.

A global review of problematic and pathogenic parasites of farmed tilapia

AbstractOver the past 80 years, tilapia have been translocated globally for aquaculture; active production is recorded in >124 countries. Of 7 million tonnes of tilapia produced in aquaculture, 79% is from 79 countries outside the natural range of tilapia. Capture fisheries account for a further 723,627 tonnes of tilapia, and >47% of this is landed from established invasive populations outside Africa. Tilapias host a rich fauna of parasites, many of which have been translocated with their hosts. This review summarises >2500 host–parasite records from 73+ countries and >820 recorded tilapia translocations (provided in the supplementary materials). This work focuses on the notable pathogens that threaten the health of cultured populations of tilapia, providing a description of their pathology and includes species that also have substantial impacts on wild tilapia populations, where relevant. For each major parasite taxonomic group, we highlight which parasites have been translocated or have been acquired from the new environments into which tilapia have been introduced, together with remarks on standard treatment approaches and research on them and their management and control. Regarding the theme ‘Tilapia health:quo vadis?’, Africa has enormous potential for aquaculture growth, but substantial knowledge gaps about tilapia parasites in many African states remain, which creates associated production and biosecurity risks. For each parasitic group, therefore, the risks of parasite translocation to new regions as tilapia aquaculture industries expand are highlighted.

Evaluation of Growth Performance and Improving Genetic Gain of Blue Tilapia (<I>Oreochromis aureus</I>) Fourth-generation (F-4) at Brackish Water Pond

Highlight Reseacrh The study showed that the selected F-4 blue tilapia had a better growth pattern than the control (non-selection) F-4 blue tilapia The difference in performance between the two populations of blue tilapia is an illustration of the genetic improvement that is passed on from parents to offspring as a result of the selective breeding The realized heritability value of the weight character of F-4 blue tilapia in the high category There was an increase in growth in the F-4 blue tilapia population with a positive response to selection Abstract Breeding program in order to increase genetic improvement in blue tilapia have not been widely carried out at brackish water ponds. This study aimed to evaluate the increase in growth and genetic gain of F-4 blue tilapia from family selection in ponds with 25-30 gL-1 salinity. The parent used for the formation of F-4 is the selected parent F-3 and as a control using the non-selected parent F-3. Spawning was carried out in a full-sib mating design using the family selection method. The ratio of male and female broodstock is 1: 2. Spawning and nursery activities of F-4 blue tilapia are carried out in freshwater. The enlargement test was carried out in the net cage 5m x2.5m x1 m which was installed in the ponds with a salinity of 25-35 g l-1 for 120 days, at a stocking density of 10 fish m-2. At the end of maintenance, a selection process is carried out on the weight traits. Parameters observed included growth, survival, and genetic values. The results showed that the growth and survival in the F-4 blue tilapia population, male and female selected populations, had a higher value than in the non-selected population. The realized heritability value of the population growth character of the F-4 blue fish is in the high category. The difference in the average weight of the selected blue tilapia and the control was equivalent to an increase in genetic value added by 15.06% (male population) and 17.92% (female population).

Tilapia Lake Virus Vaccine Development: A Review on the Recent Advances.

Tilapia tilapinevirus (or tilapia lake virus, TiLV) is a recently emerging virus associated with a novel disease affecting and decimating tilapia populations around the world. Since its initial identification, TiLV has been reported in 17 countries, often causing mortalities as high as 90% in the affected populations. To date, no therapeutics or commercial vaccines exist for TiLV disease control. Tilapia exposed to TiLV can develop protective immunity, suggesting that vaccination is achievable. Given the important role of vaccination in fish farming, several vaccine strategies are currently being explored and put forward against TiLV but, a comprehensive overview on the efficacy of these platforms is lacking. We here present these approaches in relation with previously developed fish vaccines and discuss their efficacy, vaccine administration routes, and the various factors that can impact vaccine efficacy. The overall recent advances in TiLV vaccine development show different but promising levels of protection. The field is however hampered by the lack of knowledge of the biology of TiLV, notably the function of its genes. Further research and the incorporation of several approaches including prime-boost vaccine regimens, codon optimization, or reverse vaccinology would be beneficial to increase the effectiveness of vaccines targeting TiLV and are further discussed in this review.

Effect of natural and synthetic androgen hormone on sex reversal of Nile Tilapia (Oreochromis niloticus).

The present study aimed to produce a monosex population of all male Nile tilapia (Oreochromis spp.) using 17α-methyl testosterone and common carp testes (as a source of natural androgen). Trial was conducted into two consecutive phases, the first was fry (4-5 days old)administration with negative control (without hormone) and positive control (with hormone) feed viz., MT1:60mg/kg, MT2:70mg/kg (17α-MT), carp testis CT1:70% and CT2:80% for 30 days to reverse the sex of male fish and the second phase was nursing the fingerlings for two months on control diet (32% Crude protein).Results revealed a significant growth rate (P<0.05) in the control group where final weight (4.8±0.34ab) and weight gained was recorded as 0.66±0.03ac. In proximate chemical composition of body meat, CT2 treatment showed maximum retention of crude protein, crude fat, and ash whereas dry matter showed maximum retention in MT2 and CT1 treatments. Morphological and histological examination revealed significant difference (p<0.05) in phenotypic males of Nile tilapia fed with the highest percent in MT-treated diet (MT2) of 95±0.58a while MT1, CT2 and CT1 had males of 85±6.0b, 70±5.0b and 65±6.5b, respectively. It was concluded that synthetic androgen (17αMT) was more effective for masculinization but natural androgen scan be an alternative method to produce male tilapia population in an environment-friendly manner as they are inexpensive, eco-friendly, and radially available. These results suggested that synthetic and natural androgen supplementation in the diet plays a significant role in improving growth performance and body composition.

Sex reversal dynamics of Nile Tilapia (Oreochromis niloticus) and impact on growth performance

AbstractNile Tilapia (Oreochromis niloticus) is one of the most economically important freshwater aquaculture species globally. However, reproduction during grow-out is a major problem that hinders fish growth. Therefore, production of all-male populations of tilapia has been developed to address the problem and is also identified as one of the most effective techniques of increasing tilapia growth. Various methods have been used to produce all males in Nile Tilapia i.e. use of hormone treatment (17- α-methyltestosterone), use of temperature shock and the recent YY technology. The latter two methods have limited documentation and usage in Kenya. The current study compared effectiveness of temperature and hormone sex reversed O. niloticus fry and influence on growth in hapa nets over a period of 3 months. Nile Tilapia fry of 3 days old after egg yolk absorption were sex reversed using hormone for 21 days and temperature shock for a period of 14 days. Hormone use involved making a dose of 60 mg kg-1 of feed while temperature shock involved raising temperature from 28°C to between 30 °C and 34 °C. Analysis of Specific Growth Rate using one-way analysis of variance, ANOVA, showed no significant difference between hormone and temperature induced sex reversed fish (F = 0.0975, P = 0.7705). Sex reversal efficacy rates of 91.18% and 92.86% were attained using 17- α-methyltestosterone hormone and temperature shock, respectively. The results indicate that temperature shock could be a replacement for Tilapia sex reversal without any negative consequences on growth.

Polymorphism of Sex Determination Amongst Wild Populations Suggests its Rapid Turnover Within the Nile Tilapia Species.

Sex-determining regions have been identified in the Nile tilapia on linkage groups (LG) 1, 20 and 23, depending on the domesticated strains used. Sex determining studies on wild populations of this species are scarce. Previous work on two wild populations, from Lake Volta (Ghana) and from Lake Koka (Ethiopia), found the sex-determining region on LG23. These populations have a Y-specific tandem duplication containing two copies of the Anti-Müllerian Hormone amh gene (named amhY and amhΔY). Here, we performed a whole-genome short-reads analysis using male and female pools on a third wild population from Lake Hora (Ethiopia). We found no association of sex with LG23, and no duplication of the amh gene. Furthermore, we found no evidence of sex linkage on LG1 or on any other LGs. Long read whole genome sequencing of a male from each population confirmed the absence of a duplicated region on LG23 in the Lake Hora male. In contrast, long reads established the structure of the Y haplotype in Koka and Kpandu males and the order of the genes in the duplicated region. Phylogenies constructed on the nuclear and mitochondrial genomes, showed a closer relationship between the two Ethiopian populations compared to the Ghanaian population, implying an absence of the LG23Y sex-determination region in Lake Hora males. Our study supports the hypothesis that the amh region is not the sex-determining region in Hora males. The absence of the Y amh duplication in the Lake Hora population reflects a rapid change in sex determination within Nile tilapia populations. The genetic basis of sex determination in the Lake Hora population remains unknown.

Population genomics of introduced Nile tilapia Oreochromis niloticus (Linnaeus, 1758) in the Democratic Republic of the Congo: Repeated introductions since colonial times with multiple sources.

During colonial times, Nile tilapia Oreochromis niloticus (Linnaeus, 1758) was introduced into non-native parts of the Congo Basin (Democratic Republic of the Congo, DRC) for the first time. Currently, it is the most farmed cichlid in the DRC, and is present throughout the Congo Basin. Although Nile tilapia has been reported as an invasive species, documentation of historical introductions into this basin and its consequences are scant. Here, we study the genetic consequences of these introductions by genotyping 213 Nile tilapia from native and introduced regions, focusing on the Congo Basin. Additionally, 48 specimens from 16 other tilapia species were included to test for hybridization. Using RAD sequencing (27,611 single nucleotide polymorphisms), we discovered genetic admixture with other tilapia species in several morphologically identified Nile tilapia from the Congo Basin, reflecting their ability to interbreed and the potential threat they pose to the genetic integrity of native tilapias. Nile tilapia populations from the Upper Congo and those from the Middle-Lower Congo are strongly differentiated. The former show genetic similarity to Nile tilapia from the White Nile, while specimens from the Benue Basin and Lake Kariba are similar to Nile tilapia from the Middle-Lower Congo, suggesting independent introductions using different sources. We conclude that the presence of Nile tilapia in the Congo Basin results from independent introductions, reflecting the dynamic aquaculture history, and that their introduction probably leads to genetic interactions with native tilapias, which could lower their fitness. We therefore urge avoiding further introductions of Nile tilapia in non-native regions and to use native tilapias in future aquaculture efforts.

Assessing the effect of probiotics on tilapia lake virus-infected tilapia: Transmission and immune response.

Probiotics have been used to alleviate disease transmission in aquaculture. However, there are limited studies on probiotic use in modulating tilapia lake virus (TiLV). We assessed commercially available probiotic supplements used in TiLV-infected tilapia and performed mortality and cohabitation assays. We developed a mechanistic approach to predict dose-response interactions of probiotic effects on mortality and immune gene response. We used a susceptible-infected-mortality disease model to assess key epidemiological parameters such as transmission rate and basic reproduction number (R0 ) based on our viral load dynamic data. We found that the most marked benefits of probiotics are significantly associated with immune system enhancements (~30%) and reductions in disease transmission (~80%) and R0 (~70%) in tilapia populations, resulting in a higher tolerance of farming densities (~400 fold) in aquaculture. These findings provide early insights as to how probiotic use-related factors may influence TiLV transmission and the immune responses in TiLV-infected tilapia. Our study facilitates understanding the mode of action of probiotics in disease containment and predicting better probiotic dosages in diet and supplements to achieve the optimal culturing conditions. Overall, our analysis assures that further study of rationally designed and targeted probiotics, or mechanistic modelling is warranted on the basis of promising early data of this approach.

Mosaic or melting pot: The use of monogeneans as a biological tag and magnifying glass to discriminate introduced populations of Nile tilapia in sub-Saharan Africa

The origin of introduced Nile tilapia stocks in sub-Saharan Africa is largely unknown. In this study, the potential of monogeneans as a biological tag and magnifying glass is tested to reveal their hosts' stocking history. The monogenean gill community of different Nile tilapia populations in sub-Saharan Africa was explored, and a phylogeographic analysis was performed based on the mitogenomes of four dactylogyrid species (Cichlidogyrus halli, C. sclerosus, C. thurstonae, and Scutogyrus longicornis). Our results encourage the use of dactylogyrids as biological tags. The magnifying glass hypothesis is only confirmed for C. thurstonae, highlighting the importance of the absence of other potential hosts as prerequisites for a parasite to act as a magnifying glass. With the data generated here, we are the first to extract mitogenomes from individual monogeneans and to perform an upscaled survey of the comparative phylogeography of several monogenean species with unprecedented diagnostic resolution.

Accuracy of genotype imputation to whole genome sequencing level using different populations of Nile tilapia

A cost-effective strategy to obtain ultra-dense genomic information is to sequence part of population and perform imputation from lower density genotypes to sequence level for the remaining animals. The aims of this study were to evaluate the feasibility of genotype imputation from medium density to sequence level in Nile tilapia and to investigate the impacts of size and origin of reference population in the accuracy of imputation. Genomic DNA was extracted from fin-clip samples of 326 animals from 3 different populations (PA, PB and PC). After sequencing, alignment, variant calling and quality control of genotypes, approximately 4.6 million of single-nucleotide polymorphisms (SNPs) in common to all populations were retained and used for further imputation analyses. Four scenarios were evaluated to assess imputation accuracy on each population, including: two reference sizes (10 or 90% of animals of each reference population) and two reference origins (two different populations only or all three populations used as reference). The animals in the validation set had part of their genotypes masked keeping only 49,216 SNPs available and the accuracy of imputation was assessed using the correlation between the imputed and observed genotypes (R2). Imputation was carried out using FImpute3 software. At individual level, the R2 showed intermediate values ranging from 0.37 ± 0.04 to 0.56 ± 0.07 for PA, 0.43 ± 0.05 to 0.58 ± 0.08 for PB and 0.43 ± 0.05 to 0.58 ± 0.07 for PC. An increase in the R2 was observed when 90% of animals from the same population were used as reference in comparison to only 10% (0.37 ± 0.04 to 0.54 ± 0.07 for PA, 0.43 ± 0.05 to 0.57 ± 0.07 for PB and 0.43 ± 0.05 to 0.58 ± 0.07 for PC). At SNP level, the use of all three populations as reference yielded the best results in terms of number of SNPs imputed with accuracy greater than 0.8. On average, 676,233 ± 142,291, 666,559 ± 52,648 and 592,187 ± 89,663 SNPs were imputed with accuracy >0.8 for PA, PB and PC, respectively. Considering only these highly accurate imputed SNPs, the average imputation accuracy of samples was equal to 0.95 ± 0.06 for PA and 0.92 ± 0.07 for PB and PC, for scenarios that included more animals as reference (90% of same population as reference, two and three populations). There were no significant differences for R2 between scenarios that used 90% of animals from the same population and used animals from the three population as reference showing that the strategy of using information from other population to increase the reference population had minor effect on accuracy of imputation. In conclusion, it was feasible to impute from 50 K to approximately 700 K with high accuracy using tilapia sequence data. We also expect that the use of more animals from these populations or animals from ascending lines as reference could help in the imputation process to obtain millions of imputed SNPs with high accuracy.

Anticipating the Effects of Increasing Rivers’ Water Salinity for Sustainable Conservation of Tilapia Resources in Rural Coastal Zone of Benin, West Africa

The current research aimed at using the application of multi-factor models to support fisheries management decisions for successful resources’ conservation. The study was based on the tilapia species Coptodon guineensis, which is among the most widely exploited in Benin coastal zone. In an attempt to suggest conservation strategies, the phenotypic variability of 356 accessions of this species was assessed in relation with water salinity, and several interactions. The fish were collected through small-scale experimental fishing using cast nets and gillnets. The findings indicated that the salinity observed in the sampled rivers is due, at proportions ranging from 0.13% to 47%, to the sea surface salinity (SSS) of the Atlantic Ocean, suggesting a leading inland origin of the salinity of these rivers. The evidence also showed that the tilapia populations have been relatively adapted to the increasing water salinity of the sampled rivers. The fish species*river type and fish species*fish sex interactions had significant effects on phenotypic characteristics rather than river type*fish sex interaction. For an efficient conservation of these populations, two conservation areas (Lake Nokoué and Porto-Novo lagoon vs Lake Toho and Grand-Popo lagoon), could be considered for this tilapia species.&#x0D; Keywords: Aquatic salinization, population adaptation, growth parameters, interaction patterns

First identification of two co-existing genome-wide significant sex quantitative trait loci (QTL) in red tilapia using integrative QTL mapping.

Red tilapia (Oreochromis spp.) is one of the most popular fish in China due to its bright red appearance, fast growth rate, and strong adaptability. Understanding the sex determination mechanisms is of vital importance for the selection of all-male lines to increase aquacultural production of red tilapia. In this research, the genetic architecture for sex from four mapping populations (n=1 090) of red tilapia was analyzed by quantitative trait loci (QTL)-seq, linkage-based QTL mapping, and linkage disequilibrium (LD)-based genome-wide association studies. Two genome-wide significant QTL intervals associated with sex were identified on ChrLG1 (22.4–23.9 Mb) and ChrLG23 (32.0–35.9 Mb), respectively. The QTL on ChrLG1 was detected in family 1 (FAM1), FAM2, and FAM4, and the other QTL on ChrLG23 was detected in FAM3 and FAM4. Four microsatellite markers located within the QTL were successfully developed for marker-assisted selection. Interestingly, three (lpp, sox14, and amh) of the 12 candidate genes located near or on the two QTL intervals were abundantly expressed in males, while the remaining genes were more highly expressed in females. Seven genes (scly, ube3a, lpp, gpr17, oca2, cog4, and atp10a) were significantly differentially expressed between the male and female groups. Furthermore, LD block analysis suggested that a cluster of genes on ChrLG23 may participate in regulating sex development in red tilapia. Our study provides important information on the genetic architecture of sex in red tilapia and should facilitate further exploration of sex determination mechanisms in this species.

Identification of Pmel17 for golden skin color using linkage mapping in Mozambique tilapia

Fish color is an important trait involved in many biological functions and related to commercial value of fish. However, our understanding of the molecular mechanisms underlying color variations in fish species is limited. In this study, we found 12 natural golden mutants in a Mozambique tilapia population. Analysis of the inheritance pattern of the golden and blackish skin colors in nine backcross families revealed that the golden phenotype is a recessive mutant determined by a single locus and follows simple Mendelian inheritance. Using linkage mapping, fine mapping and analyses of gene expressions, we uncovered that the Pmel17 gene was responsible for golden and black skin colors. Further sequence analysis of the gene discovered that an insertion in 3′ UTR of Pmel17 was fully associated with the golden skin color in 1835 tilapias. Expression analysis showed that Pmel17 with the insertion reduced the transcripts of Pmel17. These results indicate that the insertion in 3′ UTR of Pmel17 is responsible for the golden skin color in tilapia. The insertion can be used as a reliable DNA marker to accelerate the breeding for golden color.

Whole genome resequencing data enables a targeted SNP panel for conservation and aquaculture of Oreochromis cichlid fishes

Cichlid fish of the genus Oreochromis form the basis of the global tilapia aquaculture and fisheries industries. Broodstocks for aquaculture are often collected from wild populations, which in Africa may be from locations containing multiple Oreochromis species. However, many species are difficult to distinguish morphologically, hampering efforts to maintain good quality farmed strains. Additionally, non-native farmed tilapia populations are known to be widely distributed across Africa and to hybridize with native Oreochromis species, which themselves are important for capture fisheries. The morphological identification of these hybrids is particularly unreliable. Here, we describe the development of a single nucleotide polymorphism (SNP) genotyping panel from whole-genome resequencing data that enables targeted species identification in Tanzania. We demonstrate that an optimized panel of 96 genome-wide SNPs based on FST outliers performs comparably to whole genome resequencing in distinguishing species and identifying hybrids. We also show this panel outperforms microsatellite-based and phenotype-based classification methods. Case studies indicate several locations where introduced aquaculture species have become established in the wild, threatening native Oreochromis species. The novel SNP markers identified here represent an important resource for assessing broodstock purity in hatcheries and helping to conserve unique endemic biodiversity.

Association of genetic markers with sex determination in Thai red tilapia

The objectives of this study were to verify the polymorphism on sex-linked marker loci and to assess their associations with phenotypic sex characteristics in red tilapia. Four sex-linked genetic markers of Amh, SCAR4, SCAR5, and Oni3161 were genotyped in the Thai red tilapia population. The Amh marker was significantly associated with the phenotypic sex of red tilapia with an accuracy of 46.2%. No significant association of SCAR4, SCAR5, and Oni3161 marker polymorphisms with phenotypic sex characteristics was observed in this study. However, the combinations of these two, three, and four markers were increasingly associated with phenotypic sex characteristics for red tilapia with an accuracy of 62.8, 68.4, and 72.4%, respectively. These results indicate that these combined genetic markers were associated with the phenotypic sex of red tilapias. These findings confirmed the importance of these genetic markers as candidate markers for sex determination in the Thai red tilapia population.