Thymidine Phosphorylase Gene Research Articles

Thymidine Phosphorylase Expression Is Associated With Response to Capecitabine Plus Irinotecan in Patients With Metastatic Colorectal Cancer

To evaluate the clinical activity and toxicity of capecitabine plus irinotecan as first-line therapy for patients with metastatic colorectal cancer (mCRC), and to describe the association of expression of thymidine phosphorylase (TP), thymidylate synthase (TS), and dihydropyrimidine dehydrogenase (DPD) with antitumor activity. Patients with previously untreated mCRC received irinotecan days 1 and 8 intravenously, and capecitabine days 2 to 15 orally in 21-day cycles. Doses were irinotecan 125 mg/m2 and capecitabine 1,000 mg/m2 bid (n = 15; cohort 1), or irinotecan 100 mg/m2 and capecitabine 900 mg/m2 bid (n = 52; cohort 2). Tissues from primary and metastatic sites were assessed for TP, TS, and DPD gene and protein expression. An unacceptable level of GI toxicity in the first 15 patients led to a protocol modification in starting doses. The response rate was 45% (30 of 67 patients). Overall survival was associated with TP expression assessed by immunohistochemistry in both primary tumors (P = .045) and metastases (P = .001). Objective tumor response was associated with TP expression in primary tumors (odds ratio, 4.77; 95% CI, 1.25 to 18.18), with a similar trend in metastases (odds ratio, 8.67; 95% CI, 0.95 to 79.1). TP gene expression in primary tumors was also associated with response. These data indicate that capecitabine plus irinotecan is an active regimen against mCRC. The biomarker analysis (including metastatic tissue) was feasible in a multicenter setting, and provides preliminary evidence that TP expression may be a predictive marker for response.

Lymph Node Status and TS Gene Expression Are Prognostic Markers in Stage II/III Rectal Cancer After Neoadjuvant Fluorouracil-Based Chemoradiotherapy

According to the CAO/ARO/AIO-94 trial of the German Rectal Cancer Study Group, preoperative combined fluorouracil (FU) -based long-term chemoradiotherapy (CT/RT) is recommended for patients with International Union Against Cancer (UICC) stage II/III rectal cancer. However, despite the local benefit of neoadjuvant treatment, the overall prognostic value remains uncertain in comparison with adjuvant CT/RT. Furthermore, the prognostic value of molecular biomarkers, such as thymidylate synthase (TS), thymidine phosphorylase (TP), and dihydropyrimidine dehydrogenase (DPD), all of which are involved in the FU metabolism, is unknown in neoadjuvant settings. We assessed the impact of standardized preoperative CT/RT and intratumoral TS, TP, and DPD levels on patient outcome. Forty patients with rectal cancer pretherapeutic UICC stage II/III, receiving preoperative FU-based CT/RT (CAO/ARO/AIO-94 trial) followed by standardized surgery, including total mesorectal excision, were investigated. Downsizing, downstaging, tumor regression, as well as TS, TP, and DPD gene expression of post-treatment surgical specimens were correlated with disease-free survival (DFS) and overall survival (OS). Significant downsizing (P < .001) and downstaging (P = .001) were achieved with preoperative CT/RT. During a median follow-up of 49 months (95% CI, 43 to 58 months), the cancer recurrence rate was 28.2%. DFS and OS were significantly increased in patients with downstaging (P < .001 and P = .003, respectively), compared with patients without downstaging. All patients who developed cancer recurrence had a persistent positive lymph node status after preoperative CT/RT (P < .001) and a significantly higher TS gene expression (P = .035) compared with those patients without recurrence. Persistent positive lymph node status and high intratumoral TS expression after preoperative CT/RT are predictive of an unfavorable prognosis in rectal cancer UICC stage II/III.

Thymidylate synthase expression in oral squamous cell carcinoma predicts response to S-1

The purpose of this research was to evaluate the predictive value of expression of thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD), thymidine phosphorylase (TP), or orotate phosphoribosyltransferase (OPRT) genes for response to S-1. Twenty-five patients with oral squamous cell carcinoma (OSCC) received S-1 80 mg/m2/day. Pretreatment tumor biopsies were analyzed for TS, DPD, TP or OPRT mRNA expression by real-time reverse transcription-PCR. TS protein expression was evaluated by immunohistochemistry using a polyclonal TS antibody. Twenty-five patients were evaluable for response and gene expression. Six of the 25 (24%) achieved complete remission and 4 of the 25 (16%) had a partial response. Median TS/beta-actin was 2.51 (range 0.98-7.07). Median TS/beta-actin was 1.26 in responding patients and 3.43 in non-responders (P=0.0001). Ten of 11 patients with TS/beta-actin <1.80 and 0 of 15 with higher values responded (P<0.0001). Overall survival was 29.7 months in patients with TS/beta-actin <1.80 and 41.7 months in patients with higher values (P=0.0013). No correlations were seen between expression of DPD, TP or OPRT mRNA and response or survival. Weak TS staining was seen in 6 of 25 tumors evaluable for immunohistochemistry, including 5 responders. All 4 of the patients with both weak staining and TS/beta-actin <1.80 responded. High TS mRNA expression predicts non-response to S-1. On the other hand, high levels of DPD or TP mRNA and low levels of OPRT mRNA are not associated with S-1 resistance. TS mRNA expression is considered to be a useful prognostic factor in OSCC patients with S-1 single-agent therapy.

5‐fluorouracil‐related gene expression levels in primary colorectal cancer and corresponding liver metastasis

Gene expression levels of thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD), thymidine phosphorylase (TP) and orotate phosphoribosyl transferase (OPRT) have been shown to be associated with response to 5-fluorouracil-based therapies. Analyzing these gene expression levels in liver metastases is important to obtain the best prediction of therapy. Our aim was to determine how TS, DPD, TP and OPRT gene expression levels in primary colorectal cancer (CRC) were related to those in liver metastases. Formalin-fixed, paraffin-embedded tumor specimens from 31 pairs of primary CRC and corresponding liver metastases were dissected by using laser-captured microdissection. RNA was extracted and cDNA was prepared by reverse-transcription. Quantitation of target gene and internal reference gene was performed using real-time PCR. No significant difference was seen between median mRNA expression levels of TS, DPD, TP and OPRT in primary cancer and those in corresponding liver metastases (median value: TS 1.48 vs. 1.43; p=0.92, DPD 0.19 vs.0.12; p=0.10, TP 1.20 vs. 0.98; p=0.39, OPRT 1.17 vs. 0.95; p=0.10). When matched tissue sets were compared on an individual basis, there was a significant correlation for TS mRNA expression between primary cancer and corresponding liver metastases (rs=0.52, p=0.0026). However, no correlation was seen between matched sets for DPD, TP or OPRT. Significant correlation was seen between DPD and TP expression levels in both primary CRC (rs=0.38, p=0.03) and liver metastases (rs=0.72, p<0.0001). A good prediction of TS mRNA levels in liver metastases can be obtained by measuring those of primary CRC, although no correlation was seen for DPD, TP and OPRT.

Abdominal pain related to mitochondrial neurogastrointestinal encephalomyopathy syndrome may benefit from splanchnic nerve blockade

Patients diagnosed with abdominal pain related to mitochondrial neurogastrointestinal encephalopathy (MNGIE) may benefit from splanchnic nerve blockade. MNGIE, varying in age of onset and rate of progression, is caused by loss of function mutation in thymidine phosphorylase gene. Gastrointestinal dysmotility, pseudo-obstruction and demyelinating sensorimotor peripheral neuropathy (stocking-glove sensory loss, absent tendon reflexes, distal limb weakness, and wasting) are the most prominent manifestations. Patients usually die in early adulthood (mean 37.6 years; range 26-58 years). We report a case of an 18-year-old patient with MNGIE. Our patient's abdominal pain was relieved after splanchnic nerve blockade.

Mitochondrial Neurogastrointestinal Encephalomyopathy: Evidence of Mitochondrial DNA Depletion in the Small Intestine

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive disease clinically defined by gastrointestinal dysmotility, cachexia, ptosis, ophthalmoparesis, peripheral neuropathy, white-matter changes in brain magnetic resonance imaging, and mitochondrial abnormalities. Loss-of-function mutations in thymidine phosphorylase gene induce pathologic accumulations of thymidine and deoxyuridine that in turn cause mitochondrial DNA (mtDNA) defects (depletion, multiple deletions, and point mutations). Our study is aimed to define the molecular basis of gastrointestinal dysmotility in a case of MNGIE. By using laser capture microdissection techniques, we correlated histologic features with mtDNA abnormalities in different tissue components of the gastrointestinal wall in a MNGIE patient and ten controls. The patient's small intestine showed marked atrophy and mitochondrial proliferation of the external layer of muscularis propria. Genetic analysis revealed selective depletion of mtDNA in the small intestine compared with esophagus, stomach, and colon, and microdissection analysis revealed that mtDNA depletion was confined to the external layer of muscularis propria. Multiple deletions were detected in the upper esophagus and skeletal muscle. Site-specific somatic point mutations were detected only at low abundance both in the muscle and nervous tissue of the gastrointestinal tract. Analysis of the gastrointestinal tract from 10 controls revealed a non-homogeneous distribution of mtDNA content; the small intestine had the lowest levels of mtDNA. Atrophy, mitochondrial proliferation, and mtDNA depletion in the external layer of muscularis propria of small intestine indicate that visceral myopathy is responsible for gastrointestinal dysmotility in this MNGIE patient.

Gene Expression of 5-Fluorouracil Metabolic Enzymes in Head and Neck Squamous Cell Carcinomas

Objective: To measure the gene expression of the metabolic enzymes of 5 fluorouracil (thymidylate synthase, dihydropyrimidine dehydrogenase, thymidine phosphorylase, and orotate phosphoribosyltransferase) to assess the efficacy of 5 fluorouracil inpatients with head and neck cancerPatients and Methods: Tissue specimens of 64 patients with head and neck cancer (41 men and 23 women with a mean age of 62.6 years) who had been surgically treated from April 1997 to March 2004 were included in this study. The mRNA expressions of thymidylate synthase, dihydropyrimidine dehydrogenase, thymidine phosphorylase, and orotate phosphoribosyltransferase genes were examined from the surgically resected tissues using the Danenberg tumour profile method. The mRNA levels of the 4 enzymes were compared between tumour tissues and adjacent healthy tissues.Results: All specimens showed that thymidylate synthase, thymidine phosphorylase, and orotate phosphoribosyltransferase levels were significantly higher in the primary tumours than in the adjacent healthy tissues, while the levels of dihydropyrimidine dehydrogenase were significantly lower in the primary tumours than in the adjacent healthy tissues.Conclusion: Prediction of the efficacy of 5 fluorouracil therapy in the treatment of head and neck cancer from the measurement of mRNA levels of its metabolic enzymes appears to be feasible and possibly beneficial. Key words: Head and neck neoplasms, Orotate phosphoribosyltransferase, Thymidine phosphorylase, Thymidylate synthase

Molecular Characterization of Established Human Colon Carcinoma Cell Lines (HCT-8) Made Resistant to 5-Fluorouracil by Different Selection Schedules

To provide some insight into molecular mechanisms of 5 fluorouracil (5-FU) clinical resistance in colorectal cancer, we hypothesized that different in vitro exposure schedules of human colorectal cancer cell lines mimicking clinical infusion or bolus regimens could lead to differential gene expression. Resistant HCT-8 colon cancer cell lines (HCT-8/FUI/15R and HCT-8/FUB/2R) were selected from parental sensitive HCT-8 cells by long-term and short-term exposure schedules, respectively. Expression levels of the 437 genes evaluated by the Atlas Select cDNA Expression Human Tumor Array were not substantially different between HCT-8/FUB/2R and HCT-8 cell lines except for three genes downregulated in the resistant subline. Several genes were differentially expressed in HCT-8/FUI/15R cells compared to the parental cell line: 43 genes, including three chemoresistance-related genes, were upregulated, and three genes were downregulated. HCT-8/FUB/2R cells were substantially more resistant to 5-FU in comparison to HCT-8/FUI/15R cells after both 4- and 72-h exposures. No substantial differences were observed among resistant and parental cells in sensitivity to SN-38, the active metabolite of irinotecan, and oxaliplatin. Analysis of the mRNA levels of thymidylate synthase, thymidine phosphorylase, and bcl-2 genes evaluated by reverse transcription and real time PCR (RT-PCR) assay showed comparable results in resistant sublines and sensitive parental cells, whereas expression of the dihydropyrimidine dehydrogenase gene was markedly increased in both resistant cell lines compared to parental cells.

Molecular factors of 5-fluorouracil metabolism in colorectal cancer: Analysis of primary tumor and lymph node metastasis

Thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD) and thymidine phosphorylase (TP) are predictive markers for tumor response to 5-fluorouracil-based therapies. To determine whether gene expression values measured in primary cancer tissue would be useful for prediction of response of lymph node metastases, the expressions of these genes were quantitatively analyzed in 35 pairs of primary colorectal cancer (CRC) and corresponding lymph node metastases using real-time PCR. DPD and TP mRNA levels were significantly lower in the primary colorectal tumor and lymph node metastases compared with the normal adjacent stroma tissue (p<0.01), whereas TS mRNA levels were significantly higher in the primary tumor and lymph node metastases than in the normal adjacent tissue (p<0.001). Median gene expression levels of TP and TS did not differ significantly between primary colorectal tumor and corresponding lymph node metastasis but median DPD gene expression levels in the lymph node metastases were significantly higher compared to matched primary colorectal tumors (p=0.015). There was a significant correlation for DPD, TP and TS gene expression levels between primary colorectal tumor specimens and the matched lymph node metastasis. These results suggest that biopsies of the tumor of origin may be valid for determining predictive markers for chemotherapy response in patients with metastatic CRC.

Thymidine Phosphorylase Gene Mutation is not a Primary Cause of Mitochondrial Neurogastrointestinal Encephalomyopathy (MNGIE)

The authors identified a patient with mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), who completely fulfilled the clinical criteria with low thymidine phosphorylase (TP) activity. However, the same homozygotic S471L TP gene mutation was also found in her unaffected mother, but with normal TP activity. To elucidate the pathogenesis of MNGIE, we performed the analysis below. We analyzed the TP gene mutation in the proband and 145 unrelated individuals by direct sequence and restriction fragment length polymorphism (RFLP). TP activity was determined by the spectrophotometric method for each TP S471L genotype. Among 145 normal persons, the S471L homozygote mutants were identified in 2.76% and their enzyme activity was normal. TP gene mutation is not a primary cause of MNGIE, but with a mitochondrial deletion mutation, a single nucleotide polymorphism (SNP) of the TP gene may be crucial in the pathogenesis of MNGIE.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Digestive smooth muscle mitochondrial myopathy in patients with mitochondrial-neuro-gastro-intestinal encephalomyopathy (MNGIE): Report of 3 cases and review of the literature

We report 3 new cases of Mitochondrial-Neuro-Gastro-Intestinal Encephalomyopathy (MNGIE) (or Pseudo-Obstruction-Leukoencephalopathy-Intestinal-Pseudoobstruction Syndrome [POLIP]), a rare disease that associates chronic intestinal pseudo-obstruction (CIPO) and neurological symptoms. A review of the 72 reported cases together with these 3 cases revealed that this condition was associated with (a) a specific cluster of neurological symptoms including leukoencephalopathy (96%), polyneuropathy (96%), ophthalmoplegia (91%) and hearing loss (55%); (b) a CIPO syndrome with the presence of small bowel diverticulae (53%); and (c) mitochondrial cytopathy in 36 of the 37 tested patients (2 of our 3 cases), and thymidine phosphorylase gene mutations in all the 37 tested patients (2 of our cases). The etiology of POLIP/MNGIE syndrome appears therefore to be due to a mitochondrial cytopathy secondary to thymidine phosphorylase gene mutation(s). In 3 cases, including 2 of our 3 patients, mitochondrial abnormalities were evidenced at the ultrastructural level in digestive smooth muscle demonstrating that the pathogenesis of gastrointestinal involvement was directly related to mitochondrial alterations in digestive smooth muscle cells.

The role of thymidylate synthase and dihydropyrimidine dehydrogenase in resistance to 5-fluorouracil in human lung cancer cells

The expressions of thymidylate synthase (TS) and intracellular metabolic enzymes have been reported to be associated with the sensitivity and/or resistance to 5-fluorouracil (5-FU). However, since the role of these enzymes in the mechanism of resistance to 5-FU has not been fully examined in lung cancer, in the present study we measured the expression levels of TS, dihydropyrimidine dehydrogenase (DPD), thymidine phosphorylase (TP), and orotate phosphoribosyltransferase (OPRT) genes in lung cancer cell lines by real-time PCR, and the sensitivity to 5-FU using the MTS assay. The expression of DPD was significantly correlated with the concentration of 5-FU for 50% cell survival in 15 non-small-cell lung cancer (NSCLC) cell lines (p<0.05), but the expressions of TS, TP, and OPRT were not. Treatment with 5-chloro-2,4-dihydroxypyridine, an inhibitor of DPD, altered the sensitivity to 5-FU in DPD-expressing RERF-LC-MT cells, indicating that modulation of DPD activity could increase the 5-FU sensitivity in lung cancer. In contrast, TS expression was dramatically higher in a 5-FU-resistant small-cell lung cancer cell line than in the parent cell line, whereas the expressions of DPD, TP, and OPRT genes were not markedly different. In order to examine the effect of other cytotoxic agents on TS and DPD expression, we compared the expressions of both genes between cisplatin-, paclitaxel-, gemcitabine-, or 7-ethyl-10-hydroxycamptothecin-resistant lung cancer cells and their respective parent cells, but found no differences between any pair of resistant subline and the corresponding parent cell line. Our results indicate that degradation of 5-FU due to DPD is an important determinant in 5-FU sensitivity, while induction of TS contributes to acquired resistance against 5-FU in lung cancer. Therefore, the expression levels of TS and DPD genes may be useful indicators of 5-FU activity in lung cancer.

5-fluorouracil related gene expression levels in primary colorectal cancer and corresponding liver metastases

3568 Background: The most commonly used chemotherapeutic drug for colorectal cancer (CRC) is 5-fluorouracil (5-FU). Thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD), thymidine phosphorylase (TP), orotate phosphoribosyl transpherase (OPRT) are involved in the metabolic pathway of 5-FU and have been shown in several studies to be associated with response to 5-FU-based therapies. Since liver metastases are the main cause of death for most of CRC patients, it is reasonable to expect that measurement of these gene expression levels in liver metastases would provide the best prediction of therapy benefit, but in most cases, only biopsies of the patient’s primary tumor are readily available for analysis. Our aim was to determine how TS, DPD, TP, and OPRT gene expression levels in primary CRC were related to those in liver metastases. Methods: Thirty-one pairs of primary CRC and corresponding liver metastases were analyzed. (18 males and 13 females: Median age 66 (range 45–85)). Formalin-fixed, paraffin-embedded tumor specimens were dissected by using laser-captured microdissection. RNA was extracted and cDNA was prepared by reverse-transcription. Quantitation of target gene and internal reference gene was performed using real-time PCR (Taqman PCR). Results: No significant difference was seen between median mRNA expression levels of TS, DPD, TP, and OPRT in primary cancer and those in corresponding liver metastases (Median value: TS 1.48 vs. 1.43; p=0.92, DPD 0.19 vs.0.12; p=0.10, TP 1.20 vs. 0.98; p=0.39, OPRT 1.17 vs. 0.95; p=0.10, Wilcoxon signed rank test). When matched tissue sets were compared on an individual basis, there was a significant correlation for TS mRNA expression between primary cancer and corresponding liver metastases (rs=0.52, p=0.0026, Spearman rank correlation coefficient). However, no correlation was seen between matched sets for DPD, TP, or OPRT. Significant correlation was seen between DPD and TP expression levels in both primary CRC (rs=0.38, p=0.03) and liver metastases (rs=0.72, p<0.0001). Conclusions: A good prediction of TS mRNA levels in liver metastases can be obtained by measuring those of primary CRC, although no correlation was seen for DPD, TP, and OPRT. No significant financial relationships to disclose.

Thymidylate synthase (TS), dihydropyrimidine dehydrogenase (DPD), ERCC1, &amp; thymidine phosphorylase gene expression in primary &amp; metastatic (met) colorectal cancer (CRC) tissue in patients (pts) treated on a phase I trial of oxaliplatin (OX) &amp; capecitabine (Xel)

3549 Background: Overexpression of TS/DPD & ERCC1 in tumor tissue have been associated with insensitivity to 5-FU and OX therapy, respectively, while high TP levels predict for increased sensitivity to Xel. Methods: When feasible, biopsies of met tumor were taken in pts before OX (130 mg/m2 d1)/Xel (1200–3000 mg/m2 d1–5,8–12) q 3wk. Microdissected met & archival primary tumors were analyzed for gene expression (vs b-actin) of these 4 targets by real-time QRT-PCR. Survival (Surv) & time to treatment failure (TTF) were analyzed by log-rank. Gene expression v outcome was assessed using median (med), 25th & 75th percentiles for each target. Results: 90 pts participated. The med # prior chemotherapies was 2; 96% had prior 5-FU; 78% had prior irinotecan. Med mRNA levels were higher in met v primary tumor (table); rank sum analysis of paired samples showed (med): TS, 4.2 vs 2.2, p<0.001; DPD, 1.7 vs 0.4, p=0.005; ERCC1, 2.3 vs 1.1, p=0.002; TP, 6.3 vs 3.9 p=0.018. Pts whose tumor had ERCC1 >75th % had shorter TTF (med 162 d vs 85 d, p=0.026); pts with TP >75th % tended to have longer TTF (med 194 d vs 146 d, p=0.072). Individual mRNA levels in met tumor did not correlate with Surv, but pts whose tumors had both TS & ERCC1 < med had longer Surv (med 502 vs 296 days, p=0.038). Conclusions: In this study, target gene expression in primary tumor did not reflect levels in met tissue. In pre-treated CRC pts, mRNA levels of TP & ERCC1 in met tumor had some predictive value for TTF with OX/Xel therapy. Low levels of TS & ERCC1 predicted for improved Surv. Author Disclosure Employment or Leadership Consultant or Advisory Role Stock Ownership Honoraria Research Funding Expert Testimony Other Remuneration Response Genetics, Sanofi-Synthelabo Response Genetics

Interferons upregulate thymidine phosphorylase expression via JAK-STAT-dependent transcriptional activation and mRNA stabilization in human glioblastoma cells

Overexpression of the angiogenic enzyme thymidine phosphorylase (TP) in tumor cells and/or infiltrating macrophages correlates with increased microvessel density and poor prognosis in various tumor types including glioma. The present study examined how the TP gene expression is regulated by different types of interferons (IFNs) in human T98G and A172 glioblastoma cells. Both type I (alpha, beta) and type II (gamma) IFNs upregulated TP mRNA and protein expression while inhibiting cell proliferation. IFN-induced TP mRNA accumulation was not inhibited by the protein synthesis inhibitor cycloheximide, but was strongly blocked by the transcription inhibitor actinomycin D, as well as by transcription factor decoy oligodeoxynucleotides containing the putative IFN response element or the gamma-activated sequence in the TP promoter. The Janus kinase (JAK) inhibitor AG-490 blocked both IFN-induced STAT1 (signal transducers and activators of transcription 1) phosphorylation and TP expression. All IFNs increased the stability of TP mRNA as well. In addition, IFN-evoked TP enzyme activity enhanced the cytotoxicity of 5-fluorouracil (5-FU). These findings indicate that TP expression may be upregulated by IFNs via the JAK-STAT signaling pathway and both transcriptional and posttranscriptional mechanisms. Combined treatment with IFN and 5-fluorouracil may be a useful therapeutic strategy for malignant gliomas.

Thymidine Phosphorylase Gene Transfer Inhibits Vascular Smooth Muscle Cell Proliferation by Upregulating Heme Oxygenase-1 and p27 KIP1

Thymidine phosphorylase (TP) reportedly promotes endothelial cell migration and induces heme oxygenase (HO)-1 expression. However, its effect on vascular smooth muscle cells (VSMCs) is poorly understood. In this study, we examined the effect of TP on VSMCs in vitro and in vivo. Phagemid vector encoding human TP gene was transfected into rat VSMCs, and a clone overexpressing TP was selected (C2). C2 showed a slower migration and proliferation than VSMCs cloned with empty vector (pC) under basal, serum-stimulated, and hypoxic conditions. This decrease in proliferation correlated with TP-induced HO-1 expression and was reversed by inhibitors of either TP or HO activity. Furthermore, in C2, the cyclin-dependent kinase inhibitor (p27KIP1) was much more abundant than in pC, and the cell cycle was arrested at the G1 phase. TP or HO activity inhibitors decreased p27(KIP1) expression in C2 to the level seen in pC. Adventitial TP gene delivery significantly reduced neointimal VSMC migration and neointima formation in balloon-injured rat carotid arteries. TP overexpression upregulated HO-1 expression and consequently increased p27(KIP1) in cultured VSMCs, and inhibited VSMC migration and proliferation in vitro and in vivo. TP represents a promising target for treating vascular obstructive disease.

Thymidine phosphorylase gene mutations in patients with mitochondrial neurogastrointestinal encephalomyopathy syndrome

The mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) syndrome is characterized by the association of gastrointestinal and neurological symptoms. It is a rare autosomal recessive mitochondrial disorder with multiple mitochondrial DNA deletions and/or depletion. It is caused by thymidine phosphorylase (TP) gene mutations resulting in a complete abolition of TP activity. We tested 31 unrelated patients presenting either with a complete MNGIE syndrome (8 patients), a severe intestinal pseudo-obstruction (10 patients), and multiple deletions and/or depletion of mitochondrial DNA (13 patients). All the tested patients presenting with a complete MNGIE had increased thymidine levels in plasma and urine, and no TP activity. The group with pseudo-obstruction syndrome had normal or partial reduction of TP activity. We found pathogenic mutations on TP gene only in the MNGIE syndrome group: all the MNGIE patients were compound heterozygous or homozygous for mutations in the TP gene. Eight of these mutations are yet unreported, confirming the lack of genotype/phenotype correlation in this syndrome. Enzymatic activity and thymidine level are thus rapid diagnosis tests to detect MNGIE affected patients prior to genetic testing for patients with gastrointestinal symptoms.

A novel thymidine phosphorylase mutation in a Spanish MNGIE patient

A 29-year-old Spanish man presented with chronic intestinal pseudo-obstruction, progressive external ophthalmoplegia, peripheral neuropathy, and diffuse leukoencephalopathy. This combination of clinical features is characteristic of mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). Genetic analysis revealed a novel 18-base pair (bp) duplication ( 5044–5061dup) in exon 8 of the thymidine phosphorylase (TP) gene. The mutation is predicted to produce a 6 amino acid insertion in the alpha–beta-domain of the protein. This 18-bp insertion in the thymidine phosphorylase gene is the first duplication mutation identified in MNGIE.

Lack of gastrointestinal symptoms in a 60-year-old patient with MNGIE

Mitochondrial neurogastrointestinal encephalopathy (MNGIE) is an autosomal recessive multisystem disorder caused by mutations in the thymidine phosphorylase gene ( TP ).1 The disease is characterized by onset between the first and fifth decades of life, ptosis, progressive external ophthalmoparesis, peripheral neuropathy, and leukoencephalopathy.1,2⇓ Gastrointestinal (GI) involvement is a major hallmark of the disease, and all reported patients have GI dysmotility.2-4⇓⇓ We report a 60-year-old woman born after a normal pregnancy. She had bilateral ptosis since childhood and tremor affecting hands and head since age 2 years. She was 145 cm tall and weighed 41 kg at age 60 years. Neurologic examination at age 60 years showed bilateral ptosis with bilateral external ophthalmoplegia. Optic fundi were normal without retinitis. Strength was normal, but she had areflexia. She also had action and rest tremor. Her maternal grandfather and her daughter had tremor. Echocardiography revealed a mild thickening in the septum heart muscle. She had no GI symptoms. A radionuclide gastric emptying test showed mild gastroparesis. Laboratory data showed elevated venous lactate at rest (4.1 mmol/L; normal, 0.9 to 2.7). Brain MRI revealed diffuse hyperintense signal affecting the white matter of the cerebral hemispheres, midbrain, and pons. Abundant cytochrome c oxidase (COX)-negative ragged-red fibers and lipid droplets were found in biceps muscle biopsy (figure). The patient’s sister had short stature, and the patient’s …