Temporal Lobe Epilepsy Rats Research Articles

Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model

EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis remain poorly understood. Here we investigated the expression pattern and cellular distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, double-labeled immunofluorescence and Western blot analysis. Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE.

The effect of Vitamin E on learning and memory deficits in intrahippocampal kainate-induced temporal lobe epilepsy in rats.

Objective:Since temporal lobe epilepsy (TLE) is associated with learning and memory impairment, we investigated the beneficial effect of Vitamin E on the impaired learning and memory in the intrahippocampal kainate model of TLE in rats.Materials and Methods:Rats were divided into sham, Vitamin E-treated sham, kainate, and Vitamin E-treated kainate. Intrahippocampal kainate was used for induction of epilepsy. Vitamin E was injected intraperitoneal (i.p.) at a dose of 200 mg/kg/day started 1 week before surgery until 1 h presurgery. Initial and step-through latencies in the passive avoidance test and alternation behavior percentage in Y-maze were finally determined in addition to measurement of some oxidative stress markers.Results:Kainate injection caused a higher severity and rate of seizures and deteriorated learning and memory performance in passive avoidance paradigm and spontaneous alternation as an index of spatial recognition memory in Y-maze task. Intrahippocampal kainate also led to the elevation of malondialdehyde (MDA) and nitrite and reduced activity of superoxide dismutase (SOD). Vitamin E pretreatment significantly attenuated severity and incidence rate of seizures, significantly improved retrieval and recall in passive avoidance, did not ameliorate spatial memory deficit in Y-maze, and lowered MDA and enhanced SOD activity.Conclusion:Vitamin E improves passive avoidance learning and memory and part of its beneficial effect is due to its potential to mitigate hippocampal oxidative stress.

The Role and Effects of ANXA1 in Temporal Lobe Epilepsy: A Protection Mechanism?

BackgroundThe endogenous protein annexin A1 (ANXA1) is an anti-inflammatory mediator in the brain that is thought to contribute to the progression of many neurological conditions. However, its exact role in temporal lobe epilepsy (TLE) remains unclear. We hypothesized that ANXA1 exerts negative actions on TLE by alleviating inflammatory damage in neurons. To identify the potential mechanism of TLE by assessing ANXA1 expression in TLE rats.Material/MethodsTLE was induced in rats (n=70) via an intraperitoneal injection of lithium chloride (LiCl) and pilocarpine (PILO). The control group (n=10) received an injection of the equivalent amount of saline. ANXA1 expression was detected via immunohistochemistry and Western blotting.ResultsSuccessful establishment of the TLE model in rats resulted in epileptic seizures. ANXA1 was immunohistochemically detected as brownish yellow particles in the dentate gyrus and the CA1 region of the door zone; this expression was predominantly localized to the cytoplasm of glia rather than neurons. ANXA1 expression was stronger in TLE rats compared with the control group. ANXA1 expression in TLE was also assessed via Western blotting, and compared between groups at various time points. ANXA1 expression was significantly increased in the acute (the first 24 h) and chronic (after 1 month) phases (P<0.001) but significantly decreased during the recovery phase (72 h, 1 week, and 2 weeks) (P<0.001). These findings suggest that ANXA1 expression is correlated with TLE activity.ConclusionsOur data suggest that ANXA1 plays an important role in TLE by alleviating inflammatory damage and protecting neurons.

Exposure to Mozart music reduces cognitive impairment in pilocarpine-induced status epilepticus rats.

Patients with temporal lobe epilepsy (TLE) often display cognitive deficits. However, current epilepsy therapeutic interventions mainly aim at how to reduce the frequency and degree of epileptic seizures. Recovery of cognitive impairment is not attended enough, resulting in the lack of effective approaches in this respect. In the pilocarpine-induced temporal lobe epilepsy rat model, memory impairment has been classically reported. Here we evaluated spatial cognition changes at different epileptogenesis stages in rats of this model and explored the effects of long-term Mozart music exposure on the recovery of cognitive ability. Our results showed that pilocarpine rats suffered persisting cognitive impairment during epileptogenesis. Interestingly, we found that Mozart music exposure can significantly enhance cognitive ability in epileptic rats, and music intervention may be more effective for improving cognitive function during the early stages after Status epilepticus. These findings strongly suggest that Mozart music may help to promote the recovery of cognitive damage due to seizure activities, which provides a novel intervention strategy to diminish cognitive deficits in TLE patients.

Novel combinations of phenotypic biomarkers predict development of epilepsy in the lithium-pilocarpine model of temporal lobe epilepsy in rats.

The discovery and validation of biomarkers in neurological and neurodegenerative diseases is an important challenge for early diagnosis of disease and for the development of therapeutics. Epilepsy is often a consequence of brain insults such as traumatic brain injury or stroke, but as yet no biomarker exists to predict the development of epilepsy in patients at risk. Given the complexity of epilepsy, it is unlikely that a single biomarker is sufficient for this purpose, but a combinatorial approach may be needed to overcome the challenge of individual variability and disease heterogeneity. The goal of the present prospective study in the lithium-pilocarpine model of epilepsy in rats was to determine the discriminative utility of combinations of phenotypic biomarkers by examining their ability to predict epilepsy. For this purpose, we used a recent model refinement that allows comparing rats that will or will not develop spontaneous recurrent seizures (SRS) after pilocarpine-induced status epilepticus (SE). Potential biomarkers included in our study were seizure threshold and seizure severity in response to timed i.v. infusion of pentylenetetrazole (PTZ) and behavioral alterations determined by a battery of tests during the three weeks following SE. Three months after SE, video/EEG monitoring was used to determine which rats had developed SRS. To determine whether a biomarker or combination of biomarkers performed better than chance at predicting epilepsy after SE, derived data underwent receiver operating characteristic (ROC) curve analyses. When comparing rats with and without SRS and sham controls, the best intergroup discrimination was obtained by combining all measurements, resulting in a ROC area under curve (AUC) of 0.9592 (P<0.01), indicating an almost perfect discrimination or accuracy to predict development of SRS. These data indicate that a combinatorial biomarker approach may overcome the challenge of individual variability in the prediction of epilepsy.

Injectable phenytoin loaded polymeric microspheres for the control of temporal lobe epilepsy in rats.

Epilepsy is a prevalent neurological disorder with a high frequency of drug resistance. While significant advancements have been made in drug delivery systems to overcome anti-epileptic drug resistance, efficacies of materials in biological systems have been poorly studied. The purpose of the study was to evaluate the anti-epileptic effects of injectable poly(epsilon-caprolactone) (PCL) microspheres for controlled release of an anticonvulsant, phenytoin (PHT), in an animal model of epilepsy. PHT-PCL and Blank-PCL microspheres formulated using an oil-in-water (O/W) emulsion solvent evaporation method were evaluated for particle size, encapsulation efficiency, surface morphology and in-vitro drug release profile. Microspheres with the most suitable morphology and release characteristics weresubsequently injected into the hippocampus of a rat tetanus toxin model of temporal lobe epilepsy. Electrocorticography (ECoG)from the cerebral cortex were recorded for all animals. The number of seizure events, severity of seizures, and seizure duration were then compared between the two treatment groups. We have shown that small injections of drug-loaded microspheres are biologically tolerated and released PHT can control seizures for the expected period of time that is in accord with in-vitro release data. The study demonstrated the feasibility of polymer-based delivery systems incontrolling focal seizures.

Myocyte-specific enhancer binding factor 2A expression is downregulated during temporal lobe epilepsy

Myocyte-specific enhancer binding factor 2A (MEF2A) is a multifunctional nuclear protein that regulates synaptogenesis, dendritic morphogenesis, and neuronal survival. This study aimed to investigate the expression pattern of MEF2A in epileptogenic processes. MEF2A expression was detected in 20 temporal neocortex tissue samples from patients with temporal lobe epilepsy (TLE) and 20 samples from trauma patients without epilepsy by real-time quantitative polymerase chain reaction, immunohistochemistry, double-label immunofluorescent staining, and western blot analysis. In addition, the expression patterns of MEF2A in the hippocampus and adjacent cortex of a lithium–pilocarpine-induced TLE rat model and control rats were examined. MEF2A was found to be expressed in the nuclei of neurons but not in the dendrites of neurons and astrocytes. MEF2A expression was significantly downregulated in temporal neocortex of humans and rats with TLE compared to the control groups. In addition, in the lithium–pilocarpine-induced TLE model, MEF2A expression dynamically decreased within 2 months. Taken together, these data suggest that MEF2A is involved in the pathogenesis of TLE.

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6h to 3days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

Up-regulated cytoplasmic FMRP-interacting protein 1 in intractable temporal lobe epilepsy patients and a rat model

Cytoplasmic FMRP-interacting protein 1 (CYFIP1) is a multifunctional protein which expresses highly at excitatory synapses and can locally regulate actin cytoskeletal dynamics, spine morphology and synaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor lateral diffusion. Altered synaptic actin plays a role in the pathogenesis of epilepsy. The aim of this study was to investigate the expression pattern of CYFIP1 in temporal lobe epilepsy (TLE). Protein and mRNA expression levels were compared in temporal lobe tissue from patients with TLE versus trauma patients without TLE using quantitative real-time polymerase chain reaction (qRT-PCR), double-label immunofluorescence and Western blot analysis. We have further determined the expression pattern of Cyfip1 mRNA and protein in the hippocampus and adjacent cortex of a common rat model of TLE, lithium–pilocarpine treatment, compared to control rats. CYFIP1 expression was significantly up-regulated in the temporal neocortex of patients with intractable TLE and pilocarpine-treated rats compared to control groups. CYFIP1 localizes to the cytoplasm of neurons, and is not expressed in the astrocytes. Furthermore, CYFIP1 expression levels increased significantly in the two months after pilocarpine treatment, which corresponds to the period of epileptogenesis. Thus, our results indicate that CYFIP1 may be involved in the pathogenesis of TLE.

Grouping Pentylenetetrazol-Induced Epileptic Rats According to Memory Impairment and MicroRNA Expression Profiles in the Hippocampus.

Previous studies have demonstrated a close relationship between abnormal regulation of microRNA (miRNA) and various types of diseases, including epilepsy and other neurological disorders of memory. However, the role of miRNA in the memory impairment observed in epilepsy remains unknown. In this study, a model of temporal lobe epilepsy (TLE) was induced via pentylenetetrazol (PTZ) kindling in Sprague-Dawley rats. First, the TLE rats were subjected to Morris water maze to identify those with memory impairment (TLE-MI) compared with TLE control rats (TLE-C), which presented normal memory. Both groups were analyzed to detect dysregulated miRNAs in the hippocampus; four up-regulated miRNAs (miR-34c, miR-374, miR-181a, and miR-let-7c-1) and seven down-regulated miRNAs (miR-1188, miR-770-5p, miR-127-5p, miR-375, miR-331, miR-873-5p, and miR-328a) were found. Some of the dysregulated miRNAs (miR-34c, miR-1188a, miR-328a, and miR-331) were confirmed using qRT-PCR, and their blood expression patterns were identical to those of their counterparts in the rat hippocampus. The targets of these dysregulated miRNAs and other potentially enriched biological signaling pathways were analyzed using bioinformatics. Following these results, the MAPK, apoptosis and hippocampal signaling pathways might be involved in the molecular mechanisms underlying the memory disorders of TLE.

Seizure dynamics: a computational model based approach demonstrating variability in seizure mechanisms

Epilepsy is a neurological disorder that affects approximately 1% of the world's population. At present, the underlying mechanisms involved in seizure generation and termination are not fully understood. A computational model-based approach to provide further insights into physiological changes occurring in the brain prior to, during, and post seizure is presented. We demonstrate that an unscented Kalman filter [1] can be used to fit physiological parameters of a neural mass model [2] to recorded EEG. This technique elucidates physiological changes in recorded EEG that cannot be determined with standard EEG analysis methods. Neural mass models consist of interconnected populations of neurons. They describe the interaction between populations by the mean membrane potential generated by synapses and the firing rate produced by populations. To demonstrate the ability of this framework to elucidate mechanism involved in seizures, we make use of an in vivo model of temporal lobe epilepsy in rats. For the in vivo model, tetanus toxin is injected into the rat hippocampus, which results in spontaneously occurring seizures. The effect of the tetanus toxin lasts over a period of 6-8 weeks. We insert a twisted pair electrode into the rat hippocampus to record local field potentials (LFPs). The LFPs are used as the observations for the unscented Kalman filter [3]. The neural mass model considered has been shown to be a good phenomenological model of hippocampal EEG; however it cannot capture high frequency dynamics. We estimated physiological parameters (synaptic gains) that govern dynamics from four seizures in four animals, based upon recorded LFP 150 seconds prior to and post seizure, as well as during the seizure. The estimation results show that, for three of the four animals, the mechanisms involved in their seizures are similar. For the fourth animal, the estimated physiology prior to, during, and post seizure vary drastically. When comparing the physiological dynamics between animals, we found that the estimation results predicted that there are different mechanisms involved in seizure initiation, evolution, and termination in each animal. The common element in all the results, except for a single estimated seizure, was an increase in excitation at seizure initiation and a decrease at seizure termination. In the in vivo model, the similarity between physiological dynamics observed when considering a single animal, demonstrates that there may be a single mechanism involved in the generation and termination of seizures. However, when considering multiple seizures from different animals, the estimation results show clear differences between the mechanisms involved in seizures. Changes in the estimated synaptic gains at seizure transitions differed between ictal events in an individual rat. This is an unexpected result, as the methodology to model epilepsy in the rats was identical. The estimation results show that it is possible for different mechanisms to be involved in seizures. It is possible that this framework could be used to understand why certain patients are refractory to standard epilepsy treatments. It may further be possible to use this framework to also understand why certain patients become unresponsive to treatment over time.

(R)-[11C]PK11195 brain uptake as a biomarker of inflammation and antiepileptic drug resistance: Evaluation in a rat epilepsy model

Neuroinflammation has been suggested as a key determinant of the intrinsic severity of epilepsy. Glial cell activation and associated inflammatory signaling can influence seizure thresholds as well as the pharmacodynamics and pharmacokinetics of antiepileptic drugs. Based on these data, we hypothesized that molecular imaging of microglia activation might serve as a tool to predict drug refractoriness of epilepsy.Brain uptake of (R)-[11C]PK11195, a ligand of the translocator protein 18 kDa and molecular marker of microglia activation, was studied in a chronic model of temporal lobe epilepsy in rats with selection of phenobarbital responders and non-responders.In rats with drug-sensitive epilepsy, (R)-[11C]PK11195 brain uptake values were comparable to those in non-epileptic controls. Analysis in non-responders revealed enhanced brain uptake of up to 39% in different brain regions. The difference might be related to the fact that non-responders exhibited higher baseline seizure frequencies than responders indicating a more pronounced intrinsic disease severity. In hippocampal sections, ED1 immunostaining argued against a general difference in microglia activation between both groups.Our data suggest that TSPO PET imaging might serve as a biomarker for drug resistance in temporal lobe epilepsy. However, it needs to be considered that our findings indicate that the TSPO PET data might merely reflect seizure frequency. Future experimental and clinical studies should further evaluate the validity of TSPO PET data to predict the response to phenobarbital and other antiepileptic drugs in longitudinal studies with scanning before drug exposure and with a focus on the early phase following an epileptogenic brain insult.

Cognitive impairment in temporal lobe epilepsy: role of online and offline processing of single cell information.

Cognitive impairment is a common comorbidity in temporal lobe epilepsy (TLE) and is often considered more detrimental to quality of life than seizures. While it has been previously shown that the encoding of memory during behavior is impaired in the pilocarpine model of TLE in rats, how this information is consolidated during the subsequent sleep period remains unknown. In this study, we first report marked deficits in spatial memory performance and severe cell loss in the CA1 layer of the hippocampus lower spatial coherence of firing in TLE rats. We then present the first evidence that the reactivation of behavior-driven patterns of activity of CA1 place cells in the hippocampus is intact in TLE rats. Using a template-matching method, we discovered that real-time (3-5 s) reactivation structure was intact in TLE rats. Furthermore, we estimated the entropy rate of short time scale (∼250 ms) bursting activity using block entropies and found that significant, extended temporal correlations exist in both TLE and control rats. Fitting a first-order Markov Chain model to these bursting time series, we found that long sequences derived from behavior were significantly enriched in the Markov model over corresponding models fit on randomized data confirming the presence of replay in shorter time scales. We propose that the persistent consolidation of poor spatial information in both real time and during bursting activity may contribute to memory impairments in TLE rats.

Genome-wide microRNA expression profiles in hippocampus of rats with chronic temporal lobe epilepsy.

The expression and functions of microRNAs (miRNAs) in chronic temporal lobe epilepsy (TLE), the most common type of refractory epilepsy in adults, are poorly understood currently. In this study, status epilepticus evoked by amygdala stimulation was used to establish rat chronic TLE model. Two months later, high-throughput sequencing was employed to investigate miRNA expression profile in rat hippocampus, and six miRNAs were confirmed to be differentially expressed. Kyoto Encyclopedia of Genes and Genomes pathway analysis indicated that most of the target genes for these six miRNAs were associated with neuronal apoptosis. Meanwhile, the levels of miR-423-3p and miR-296-5p were correlated with the activity of caspase-3, an apoptosis indicator. Additionally, the loading of miR-423-3p was increased in RNA-induced silencing complex whilst caspase-6, a target of miR-423-3p, was reduced in chronic TLE rats. Collectively, our findings suggest that miRNAs may exert anti-apoptotic effects in chronic TLE.

Neuroprotective Effect of Vitamin E in a KainateInduced Rat Model of Temporal Lobe Epilepsy

Temporal lobe epilepsy (TLE) is known as the most common form of epilepsy in adults and as the type most resistant to treatment. Neuroprotective treatments are considered a promising therapy for preventing and treating TLE. We investigated the possible neuroprotective effect of vitamin E in an intrahippocampal kainate model of TLE in rats. Kainate injection caused a higher incidence rate of seizures; vitamin E pretreatment significantly attenuated this index. Intrahippocampal kainate also led to elevation of the malondialdehyde (MDA) and nitrite/nitrate levels and lowered superoxide dismutase (SOD) activity, while vitamin E significantly restored MDA and SOD indices. In addition, intrahippocampal kainate induced a significant degeneration of neurons in the CA1, CA3, and hilar regions of the hippocampus; vitamin E considerably attenuated these changes. Timm staining data demonstrated mossy fiber sprouting (MFS) in the dentate gyrus of kainate-lesioned rats, and vitamin E significantly lowered the MFS intensity. Our data suggest that vitamin E pretreatment is capable of attenuating seizures and inhibiting hippocampal neuronal loss and MFS in the kainate-induced model of TLE. A part of the beneficial vitamin E effect is due to its potential to mitigate oxidative stress.

Melatonin protects testes against lithium-pilocarpine-induced temporal lobe epilepsy in rats: a time course study

Male dysfunction is common in patients with temporal lobe epilepsy (TLE). We evaluated whether melatonin, as a supplement, can play a positive role in reducing the epileptogenesis imposing abnormalities of spermatozoa and testes in epileptic rats. Status epilepticus was induced based on the TLE lithium-pilocarpine model. Two patterns of melatonin were administered to the epileptic animals along the mean durations of latent (14days) and chronic (60days) phases. Sperm parameters, different antioxidant enzyme levels, germ cell apoptosis, body and relative sex organ weights were evaluated in all groups 60days following SE induction. Chronic TLE caused a significant reduction in sperm parameters. In the testis, the reduced level of antioxidant enzymes was accompanied by a significant increase in malondialdehyde concentration. The presence of oxidant condition in the testes of epileptic animals caused expanded apoptosis in the germ cell layer. Moreover, the amount of weight gain in epileptic animals was more prominent. Melatonin administration was able to improve sperm motility by increasing the total antioxidant level. There was also a significant reduction in the spermatogenic cell line apoptosis and the extra weight gain of melatonin-treated animals. Melatonin supplementation might be considered as an acceptable cotreatment in epileptic patients.

Expression of HIF-1α and MDR1/P-glycoprotein in refractory mesial temporal lobe epilepsy patients and pharmacoresistant temporal lobe epilepsy rat model kindled by coriaria lactone

Hypoxia-inducible factor-1α (HIF-1α) is thought to mediate pharmacoresistance in tumor by inducing Pgp overexpression. We aimed to investigate the expression of HIF-1α and MDR1/P-glycoprotein in refractory epilepsy, to explore the correlation of HIF-1α with epilepsy multidrug resistance. We collected hippocampus and mesial temporal lobe (MTL) cortex of refractory mesial temporal lobe epilepsy (mTLE) patients that underwent surgery, and established a pharmacoresistant TLE rat model kindled by coriaria lactone. We used real-time quantitative PCR (RQ-PCR) and western blot to investigate expression of HIF-1α and MDR1 in hippocampus and MTL/entorhinal cortex. We found that the expression of HIF-1α and MDR1, at both mRNA and protein levels, were up-regulated in hippocampus and MTL cortex of mTLE patients compared with the control cortex (all P < 0.05), and increased in hippocampus and entorhinal cortex of kindled rat model versus the control group (all P < 0.05). These results demonstrated the overexpression of HIF-1α and MDR1/Pgp in hippocampus and MTL/entorhinal cortex of mTLE patients and the pharmacoresistant TLE rat model. HIF-1α may have a regulatory effect on MDR1 expression in refractory epilepsy, which is probably consistent with MDR mechanism in tumor.

Specific Impairment of “What-Where-When” Episodic-Like Memory in Experimental Models of Temporal Lobe Epilepsy

Episodic memory deficit is a common cognitive disorder in human temporal lobe epilepsy (TLE). However, no animal model of TLE has been shown to specifically replicate this cognitive dysfunction, which has limited its translational appeal. Here, using a task that tests for nonverbal correlates of episodic-like memory in rats, we show that kainate-treated TLE rats exhibit a selective impairment of the "what-where-when" memory while preserving other forms of hippocampal-dependent memories. Assisted by multisite silicon probes, we recorded from the dorsal hippocampus of behaving animals to control for seizure-related factors and to look for electrophysiological signatures of cognitive impairment. Analyses of hippocampal local field potentials showed that both the power of theta rhythm and its coordination across CA1 and the DG-measured as theta coherence and phase locking-were selectively disrupted. This disruption represented a basal condition of the chronic epileptic hippocampus that was linked to different features of memory impairment. Theta power was more correlated with the spatial than with the temporal component of the task, while measures of theta coordination correlated with the temporal component. We conclude that episodic-like memory, as tested in the what-where-when task, is specifically affected in experimental TLE and that the impairment of hippocampal theta activity might be central to this dysfunction.

Speed modulation of hippocampal theta frequency correlates with spatial memory performance

Hippocampal theta rhythm is believed to play a critical role in learning and memory. In animal models of temporal lobe epilepsy (TLE), there is evidence that alterations of hippocampal theta oscillations are involved in the cognitive impairments observed in this model. However, hippocampal theta frequency and amplitude at both the local field potential (LFP) and single unit level are strongly modulated by running speed, suggesting that the integration of locomotor information into memory processes may also be critical for hippocampal processing. Here, we investigate whether hippocampal speed-theta integration influences spatial memory and whether it could account for the memory deficits observed in TLE rats. LFPs were recorded in both Control (CTR) and TLE rats as they were trained in a spatial alternation task. TLE rats required more training sessions to perform the task at CTR levels. Both theta frequency and power were significantly lower in the TLE group. In addition, speed/theta frequency correlation coefficients and regression slopes varied from session to session and were worse in TLE. Importantly, there was a strong relationship between speed/theta frequency parameters and performance. Our analyses reveal that speed/theta frequency correlation with performance cannot merely be explained by the direct influence of speed on behavior. Therefore, variations in the coordination of theta frequency with speed may participate in learning and memory processes. Impairments of this function could explain at least partially memory deficits in epilepsy.

Thymoquinone Attenuates Astrogliosis, Neurodegeneration, Mossy Fiber Sprouting, and Oxidative Stress in a Model of Temporal Lobe Epilepsy

Temporal lobe epilepsy (TLE) is a rather common and difficult-to-treat variant of epilepsy. Nearly one third of people with epilepsy do not respond effectively to currently available anticonvulsants. In this study, we evaluated the protective effect of thymoquinone (TQ), the main constituent of black seed with antioxidant and anti-inflammatory effects, in the intrahippocampal kainate model of TLE in rat. Following kainate injection, seizure activity was observed that was significantly diminished by TQ pretreatment at a dose of 10 mg/kg, p.o. Intrahippocampal kainate also increased malondialdehyde (MDA), nitrite, and nitrate levels and decreased activity of superoxide dismutase and TQ only significantly attenuated MDA. In addition, intrahippocampal kainate caused a significant reduction of neurons in CA1, CA3 and the hilar regions, and TQ significantly attenuated these changes. Timm histochemistry showed a marked mossy fiber sprouting (MFS) in the dentate gyrus of kainate-lesioned rats, and TQ significantly lowered MFS intensity. Meanwhile, a number of reactive astrocytes (astrogliosis) increased significantly in the kainate group, and TQ pretreatment significantly decreased it. These data suggest that TQ pretreatment could attenuate seizure activity and lipid peroxidation, lower hippocampal neuronal loss and MFS, and mitigate astrogliosis in kainate model of TLE.