Tail Tip Research Articles

Basilaphelenchus hyrcanus n. sp. (Rhabditida: Tylaphelenchinae) associated with bark of a beech tree (Fagus orientalis Lipsky) from northern Iran

Basilaphelenchus hyrcanus n. sp., the sixth species of the newly established genus was isolated during a nematode survey associated with bark samples of beech tree in northern Iran, which differs from the other species by body size, stylet length, metacorpus structure, and tail characters of both genders. The new species is also characterized by elevated cephalic region with sclerotised vestibule, posteriorly directed stylet knobs, well-developed metacorpus filling corresponding body region, position of excretory pore at the level of base of metacarpus, length of post uterine sac by 38–60 μm long, conoid elongate tail by sharp to finely rounded tip in female. Based upon the morphological characteristics and phylogenetic analyses of partial 18 S and D2-D3 28 S rDNA segments, the new species mostly resembles B. magnabulbus. However, B. hyrcanus n. sp. is clearly different from this species by having a longer stylet, different position of the excretory pore, a different male tail tip characters and 4.4 and 13.2% sequence divergences in 18 S and D2-D3 28 S, respectively.

Discopersicus hexagrammatus n. sp. (Rhabditida: Tylenchidae), the second species of the genus.

Discopersicus hexagrammatus n. sp., is described and illustrated from a population associated with the rhizosphere of carrot (Daucus carota L.) in Dezful, Khuzestan province, south-western Iran. Based on morphological and morphometric data, the new species is characterized by a 601-734 µm long body, a prominent perioral labial disc and oblique amphidial slits, 10-11 µm long stylet, vulva at 65-67% of body length, 15.5-17 µm long spicules, and an elongate conoid tail with a pointed terminus. It is the second species of the genus Discopersicus and differs from its counterpart D. iranicus, by its anterior position of vulva, shorter stylet, lower M.B. ratio, different shape of tail tip, and shorter spicules in male specimens. A molecular phylogenetic analysis using the D2-D3 expansion segments of 28S rDNA sequences, placed the new species in close relationship with five sequences of the genus Boleodorus.

Description of Hemicycliophora cardamomi sp. n. (Nematoda: Hemicycliophoridae) associated with Amomum longiligulare T.L. Wu and a web-based key for the identification of Hemicycliophora spp.

During a survey of plant diseases in the Central Highlands of Vietnam, a new plant-parasitic nematode, Hemicycliophora cardamomi sp. n., was discovered in the growing areas of Amomum longiligulare, a valuable medicinal plant with high economical value. The new species is characterized by a cuticular sheath loosely fitting body; a labial region continuous to the body contour bearing 3 annuli; a lateral field frequently marked by a discontinuous single line with indistinct additional short lines in some parts along the body; a modified vulval lip with an anterior lip c. 4 annuli long; and a post-vulval body tapering to a pointed tail tip with an abrupt constriction at the last third of the post-vulval body. Morphology and molecular characterizations of D2-D3 expansion segment of 28S rRNA, ITS, and COI mtDNA gene regions clearly distinguish the new species from all other 133 known species. This study also provides a newly developed web-based key for the identification of Hemicycliophora spp. in order to accelerate the identification process, to minimize the increasing error load associated with larger datasets, and to avoid any dependence on a single starting entry. This key includes both an existing Bray-Curtis similarity measure and a newly developed similarity formula.

Interleukin-1β injection causes loss of tail tips in neonatal mice.

Early-life immune challenges and inflammation are risk factors for a range of developmental disorders. During the course of a study examining interactions between the common antipyretic acetaminophen (APAP; paracetamol) and interleukin-1β (IL-1β)-induced inflammation in neonatal mice we observed that subcutaneous (s.c.) injection of IL-1β often leads to significantly shorter, blunt-tipped tails. Three times during early development, on postnatal day 5 (P5), P8, and P11, C57BL/6J pups were given s.c. injection of either .2 μg/kg IL-1β or 5 cc/kg injection of saline vehicle followed, after a 45 min delay, by a second injection, of either 103.9 mg/kg APAP or saline. IL-1β was observed to reduce tail length-via a blunting of the tail tip-in treated vs. untreated mice, an effect that was significant as early as P11 and persisted through the end of the study (~P74). Interestingly, IL-1β-induced tail blunting was significantly lessened by APAP, an interaction that may have occurred as a result of the opposing actions of APAP and IL-1β on cyclooxygenase-2. Although this specific hypothesis and the mechanisms underlying the effects of IL-1β on tail length require further study, they add to the literature suggesting that IL-1β may be a critical mediator of specific adverse effects of early-life inflammation.

A genetic screen in Drosophila reveals an unexpected role for the KIP1 ubiquitination-promoting complex in male fertility

A unifying feature of polycystin-2 channels is their localization to both primary and motile cilia/flagella. In Drosophila melanogaster, the fly polycystin-2 homologue, Amo, is an ER protein early in sperm development but the protein must ultimately cluster at the flagellar tip in mature sperm to be fully functional. Male flies lacking appropriate Amo localization are sterile due to abnormal sperm motility and failure of sperm storage. We performed a forward genetic screen to identify additional proteins that mediate ciliary trafficking of Amo. Here we report that Drosophila homologues of KPC1 and KPC2, which comprise the mammalian KIP1 ubiquitination-promoting complex (KPC), form a conserved unit that is required for the sperm tail tip localization of Amo. Male flies lacking either KPC1 or KPC2 phenocopy amo mutants and are sterile due to a failure of sperm storage. KPC is a heterodimer composed of KPC1, an E3 ligase, and KPC2 (or UBAC1), an adaptor protein. Like their mammalian counterparts Drosophila KPC1 and KPC2 physically interact and they stabilize one another at the protein level. In flies, KPC2 is monoubiquitinated and phosphorylated and this modified form of the protein is located in mature sperm. Neither KPC1 nor KPC2 directly interact with Amo but they are detected in proximity to Amo at the tip of the sperm flagellum. In summary we have identified a new complex that is involved in male fertility in Drosophila melanogaster.

A new nematode of the genus Rhabdochona (Rhabdochona) from Botia dario (ornamental fish) from Jiri River, Jiribam, Manipur, India

During a taxonomic study of parasites of freshwater fishes, three new gravid female nematodes of the genus Rhabdochona were recovered from the intestine of a freshwater fish, Botia dario caught from Jiri River. Detail study revealed the specimen as a medium-sized nematode, tapering at both ends with finely striated cuticle, 14 anterior teeth in the funnel-shaped prostome, vulva post-equatorially open, vagina muscular, posteriorly directed with an ovejector, eggs oval, thinshelled and embryonated, tail tip conoidly pointed. Thus, the present species is assigned to the genus Rhabdochona. Prevalence and intensity of infection is 20% (1/5) and 3(3/1) parasite per host, respectively. Comparing the relative characteristics of the two conspecies, the present species closely resembles Rhabdochona (Rhabdochona) acuminata. It differs in a few aspects such as the longer oesophagus, more anteriorly located excretory pore, longer vagina, thin-shelled eggs but smooth-shelled eggs in R.(R) acuminata, conoidly pointed tail tip but bluntly ended in R. (R.) acuminata. Based on these distinguishing characters the present species is described as a new species giving the name Rhabdochona (Rhabdochona) jiribamensis n. sp.

Microevolutionary change in mimicry? Potential erosion of rattling behaviour among nonvenomous snakes on islands lacking rattlesnakes

Batesian mimics – harmless species that converge on the warning signals of a dangerous species – are spectacular examples of adaptation, but few documented cases involve acoustic signals. Even fewer studies have documented microevolutionary change in mimicry of any kind. Here, we describe a potential evolutionary change in acoustic mimicry. Many nonvenomous snakes vibrate their tail tip when threatened, making a sound resembling venomous rattlesnakes, which can vibrate their tail rapidly and for a long duration. When we compared this behavior between Gophersnakes from mainland California (where rattlesnakes are present) versus nearby derived island populations (where rattlesnakes are absent), we found that mainland snakes vibrated their tail for a longer duration, thereby producing a signal more similar to rattlesnakes. At the same time, we did not find evidence that island snakes differ from mainland snakes in the rate at which they vibrate their tails, or their propensity to vibrate their tails. Taken together, these data lend some support to the longstanding hypothesis that defensive tail vibration by nonvenomous snakes represents acoustic mimicry of rattlesnakes. These data further suggest that this mimetic signal may be undergoing erosion in populations where rattlesnakes are absent.

Description of Raphidascaris (Ichthyascaris) multipapillata sp. nov., Redescription of Hysterothylacium simile Li et al., 2013 and New Records of Some Other Ascaridoid and Seuratoid Nematodes from Marine Fishes in Japan.

Many nematode species parasitizing marine fishes were reported from Japanese waters. However, considering the wealth of fish species in this zoogeographically interesting region and the host specificity of nematodes, the number of hitherto recorded fish nematodes probably represents only a very small part of the potential Japanese fauna of these organisms. Therefore, new data are needed to recognise the species composition of these parasites in this region. Helminthological examinations of some marine fishes from off Japan, carried out in the years 2005-2017, revealed one new and five insufficiently known species of ascaridoid and seuratoid nematodes. These were studied with the use of light and scanning electron microscopy. All six nematode species recorded are described: Anisakidae: Raphidascaris (Ichthyascaris) multipapillata sp. nov. (male and females) from the intestine of Labracoglossa argenteiventris Peters (Kyphosidae) in the Sea of Japan, Raphidascaris (Ichthyascaris) sp. (third-stage larvae) probably from the digestive tract of Seriola dumerili (Risso) and S. rivoliana Valenciennes (both Carangidae) in the western North Pacific Ocean off Ishigaki-jima Island, Okinawa Prefecture, Hysterothylacium simile Li et al., 2013 (males and females) from the stomach of Lateolabrax japonicus (Cuvier) (Lateolabracidae) in the Sea of Japan, Hysterothylacium sp. 1 (female) from the pyloric caeca of Jaydia lineata (Temminck et Schlegel) (Apogonidae) in the Seto Inland Sea, Hysterothylacium sp. 2 (third- and fourth-stage larvae) from the intestine and mesentery of Etelis coruscans Valenciennes (Lutjanidae) and Pseudorhombus pentophthalmus Günther (Paralichthyidae) in the western North Pacific Ocean off Ishigaki-jima Island, Okinawa Prefecture and the Seto Inland Sea, respectively; and Cucullanidae: Cucullanus sp. (female) from the intestine of Semicossyphus reticulatus (Valenciennes) (Labridae) in the Seto Inland Sea. Raphidascaris (I.) multipapillata sp. n. differs from congeners mainly in the high number (79) of pairs of caudal papillae, spicules 402µm long and in the structure of the male and female tail tips. Hysterothylacium simile is redescribed, being recorded from off Japan for the first time. In addition to the discovery of the new nematode species R. (I.) multipapillata sp. nov. and a redescription of H. simile providing some new morphological data of this parasite, the findings of all other species represent new host and geographical records. The present study extends the knowledge of the species composition and host-parasite relationships of nematodes parasitizing marine fishes.

Schistonchus macrophylla (Nematoda: Aphelenchoididae): an enigmatic taxon from sycones of Ficus section Malvanthera in eastern Australia, with description of a new subspecies

Summary Over a period of 15 years, Schistonchus was collected from sycones of Ficus subgenus Urostigma section Malvanthera in eastern Australia, and was found to occur widely. Here, Schistonchus macrophylla macrophylla is redescribed from F. macrophylla and F. superba, and a new subspecies, Schistonchus m. lightfooti subsp. n., from F. rubiginosa and F. superba. Schistonchus m. lightfooti subsp. n., is characterised by having a long post-vulval uterine sac (PUS) with thickened walls and a narrowly rounded or pointed distal tip, procorpus which is usually longer than the stylet length, pyriform metacorpus, trapezoid-shaped head capsule, papillae arranged as one large pair adcloacal, a large pair at mid-tail length, and a small pair near the tail tip, no caudal alae, and a spatulate tail tip in females; and was collected from Sydney in New South Wales (NSW) to southern Queensland. Schistonchus m. macrophylla is characterised by having a procorpus shorter than or equal to the stylet length, an ovoid metacorpus, rectangular-shaped head capsule, long PUS with thickened wall only at its distal tip, caudal alae, and papillae arranged as one pair precloacal, one small pair adcloacal, and a large pair at mid-tail length. It was collected in NSW.

Brown watersnakes (Nerodia taxispilota) as bioindicators of mercury contamination in a riverine system

Mercury (Hg) is a contaminant that enters the environment through natural or anthropogenic means. Ecological risk assessments have examined Hg bioaccumulation and effects in many taxa, but little is known about Hg dynamics in reptiles, or their potential use as bioindicator species for monitoring Hg in aquatic systems. Numerous snake species, like North American watersnakes (Nerodia spp.), are piscivorous and are exposed to Hg through their diet. The purpose of this study was to identify factors associated with Hg accumulation in a common watersnake species and compare Hg concentrations of the snakes to those in fish occupying the same habitats. To this end, we sampled brown watersnakes (Nerodia taxispilota) from the Savannah River, a major river system in the southeastern U.S., and compared N. taxispilota Hg accumulation trends to those of bass (Micropterus salmoides), catfish (Ictalurus and Ameiurus spp.), and panfish (Lepomis and Pomoxis spp.) collected from the same reach. Total Hg (THg) in N. taxispilota tail tips ranged from 0.020 to 0.431 mg/kg (wet weight; mean: 0.104 ± 0.008). Snake tail THg was significantly correlated with blood THg, which ranged from 0.003 to 1.140 mg/kg (0.154 ± 0.019). Snake size and site of capture were significantly associated with tail THg. Snake tail THg increased at sites along and downstream of the area of historic Hg pollution, consistent with fish THg. Snake muscle THg was predicted based on tail THg and ranged from 0.095 to 1.160 (0.352 ± 0.022). To gauge Hg biomagnification in N. taxispilota, we compared predicted snake muscle THg concentrations to THg in fish of consumable size. Average biomagnification factors for THg in N. taxispilota were 3.1 (panfish) and 5.4 (catfish), demonstrating N. taxispilota likely biomagnify Hg through their diet. These results reveal N. taxispilota to be an effective bioindicator species for monitoring Hg in aquatic environments.

Anteroposterior Wnt-RA Gradient Defines Adhesion and Migration Properties of Neural Progenitors in Developing Spinal Cord.

SummaryMammalian embryos exhibit a transition from head morphogenesis to trunk elongation to meet the demand of axial elongation. The caudal neural tube (NT) is formed with neural progenitors (NPCs) derived from neuromesodermal progenitors localized at the tail tip. However, the molecular and cellular basis of elongating NT morphogenesis is yet elusive. Here, we provide evidence that caudal NPCs exhibit strong adhesion affinity that is gradually decreased along the anteroposterior (AP) axis in mouse embryonic spinal cord and human cellular models. Strong cell-cell adhesion causes collective migration, allowing AP alignment of NPCs depending on their birthdate. We further validated that this axial adhesion gradient is associated with the extracellular matrix and is under the control of graded Wnt signaling emanating from tail buds and antagonistic retinoic acid (RA) signaling. These results suggest that progressive reduction of NPC adhesion along the AP axis is under the control of Wnt-RA molecular networks, which is essential for a proper elongation of the spinal cord.

On the reappearance of the Indian grey wolf in Bangladesh after 70 years: what do we know?

The Indian grey wolf, Canis lupus pallipes Sykes, 1831, is a small, cryptic subspecies and the only wolf living in arid plains and deserts of the Indian subcontinent. Since 1950, it has been considered extinct beyond 88° east longitude. Herein, we report an instance from Bangladesh after 70 years. A solitary male of C. l. pallipes was killed in retaliation in June 2019 as livestock predation events erupted and lasted for a month after a severe cyclone had swept coastal Bangladesh. The specimen was about 119 cm from nose to tail tip with a skull length of 26.23 cm. Two molecular markers, mt d-loop control region and 16S rRNA, and 54 cranial parameters consolidated the identity. Bayesian inference and maximum-likelihood analyses indicated its intraspecies position. The locality of conflict, 450 km eastward of the easternmost population of C. l. pallipes, is adjacent to the Sundarbans in the Ganges estuary that presents formidable tidal rivers as dispersal barriers. In 2017, another wolf was sighted from the Indian Sundarbans vicinity. The present incident and the sighting of 2017 remarkably appeared from the farthest corners of a 10,000 km2 strong mangrove network that is rimmed by dense human settlements. The records surmise about the most challenging wolf dispersal route ever recorded. Additionally, the south-central coasts of Bangladesh, once home to wolves, bear old planted mangroves with open dunes but never surveyed for mammals. These facts necessitate a systematic camera-trapping in the coastal mangroves of Bangladesh exclusively intended for wolves.

Knockdown of liver-derived factor XII by GalNAc-siRNA ALN-F12 prevents thrombosis in mice without impacting hemostatic function

BackgroundPlasma coagulation Factor XII (FXII) plays a crucial role in contact activation, ultimately regulating both the kinin-kallikrein system and the intrinsic pathway of coagulation. A growing body of evidence suggests that inhibition of FXII can prevent thrombosis. Given FXII does not appear to modulate hemostasis, targeting FXII is a promising strategy for the prevention of pathological thrombus formation without the hemostatic risks typically associated with anticoagulants. To this end, a subcutaneously administered investigational RNAi therapeutic targeting liver F12 mRNA (ALN-F12) was developed. AimTo investigate the thrombo-protective and hemostatic effects of FXII reduction by ALN-F12 in rodent thrombosis and hemostasis models. MethodsA single dose of ALN-F12 was subcutaneously administered to C57Bl/6 mice. After reaching steady state FXII reduction, the impact on thrombosis (ferric chloride arterial thrombosis and electrolytic injury induced venous thrombosis models) and hemostasis (saphenous vein injury and tail tip transection bleeding models) was evaluated. ResultAdministration of ALN-F12 resulted in dose-dependent reductions of both liver F12 mRNA and plasma FXII protein. In mice, ALN-F12 led to dose-dependent reductions in platelet and fibrin accumulation in the venous electrolytic-injury model and in the time to occlusion in the ferric chloride arterial thrombosis model. At 10 mg/kg ALN-F12, the top dose level evaluated, this resulted in >95% reduction of FXII and ~10 fold reduction in fibrin deposition. Finally, hemostasis models showed that >95% reduction of FXII had no impact on bleeding time or blood loss. ConclusionOur findings support that reduction of plasma Factor XII by ALN-F12 provided thrombo-protective effects with no increased bleeding risk in rodent models of thrombosis and hemostasis.

Niviventer confucianus sacer (Rodentia, Muridae) is a distinct species based on molecular, karyotyping, and morphological evidence.

Niviventer confucianus sacer Thomas, 1908, which has been regarded as a subspecies of N. confucianus, was found to be a distinct species from N. confucianus based on molecular, karyotyping, and morphological characteristics in this study. Niviventer c. sacer was found to belong to a distinct phylogenetic clade in phylogenetic tree constructed using the mitochondrial gene Cytb, it clustered with N. bukit (Bonhote, 1903) from Vietnam and N. confucianus (Milne-Edwards, 1871) from Yunnan, but showed a distant relationship with N. confucianus from adjacent areas. The genetic distance between N. c. sacer and N. confucianus was more than 5.8%, reaching the level of interspecific differentiation. The species delimitation indicates that N. c. sacer is a monophyletic group. The karyotype of N. c. sacer (FN = 55, 8m+4st+32t+X(sm)Y(t)) differed from that of N. confucianus (FN = 59, 6m+4sm+2st+32t+X(sm)Y(t)). In terms of morphological features, the length of incisive foramen (LIF) and length of auditory bulla (LAB) of N. c. sacer is significantly larger than that of N. confucianus and N. bukit (P < 0.05) and the proportion of white tail tip to total tail length is significantly longer at N. c. sacer (≥ 1/3) than that at N. confucianus (≤ 1/3). Therefore, integrated analysis confirmed that N. c. sacer is a distinct species of genus Niviventer rather than a subspecies of N. confucianus or N. bukit, namely N. sacer, which is only distributed in Shandong.

Structural Insights into Lactococcal Siphophage p2 Baseplate Activation Mechanism.

Virulent phages infecting L. lactis, an industry-relevant bacterium, pose a significant risk to the quality of the fermented milk products. Phages of the Skunavirus genus are by far the most isolated lactococcal phages in the cheese environments and phage p2 is the model siphophage for this viral genus. The baseplate of phage p2, which is used to recognize its host, was previously shown to display two conformations by X-ray crystallography, a rested state and an activated state ready to bind to the host. The baseplate became only activated and opened in the presence of Ca2+. However, such an activated state was not previously observed in the virion. Here, using nanobodies binding to the baseplate, we report on the negative staining electron microscopy structure of the activated form of the baseplate directly observed in the p2 virion, that is compatible with the activated baseplate crystal structure. Analyses of this new structure also established the presence of a second distal tail (Dit) hexamer as a component of the baseplate, the topology of which differs largely from the first one. We also observed an uncoupling between the baseplate activation and the tail tip protein (Tal) opening, suggesting an infection mechanism more complex than previously expected.

First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.

Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24-48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines. Measurements of females (n = 20) included vulval slit length = 26.4 ± 2.7 (23.6 to 31.2) µm, vulval slit to anus distance = 22.1 ± 2.4 (18.9 to 24.7) µm. The J2s had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of J2s (n = 20) were body length = 432.4 ± 23.1 (386.8 to 465.3) µm, body width = 16.2 ± 1.8 (14.2 to 18.9) µm, stylet = 12.8 ± 0.5 (11.6 to 13.7) µm, dorsal esophageal gland orifice to stylet base = 3.6 ± 0.4 (3.1 to 4.8) µm, tail = 52.9 ± 3.8 (46.3 to 61.4) µm, hyaline tail length = 15.7 ± 2.6 (12.5 to 19.2) µm. These morphological characteristics were consistent with the original description of M. enterolobii (Yang and Eisenback 1983). Molecular biology analyses were also conducted to confirm species identification. Genomic DNA was extracted from a single J2 (Song et al. 2017). The ITS rRNA gene and D2-D3 region of the 28S rRNA gene were amplified using the primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The ITS rRNA gene sequence (765 bp, GenBank accession No. MT654126) was 100% identical to M. enterolobii sequences previously obtained from Fujian, China (MT406251) and Vietnam (MG773551), and the D2/D3 region sequence of 28S rRNA gene (759 bp, MT654127) revealed 99% identity with M. enterolobii sequences from Fujian (MT193450) and Taiwan (KP411230), China, and South Carolina, USA (MH800969). In addition, species identification was further confirmed using the M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) and MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC), respectively (Long et al. 2006; Tigano et al. 2010). The PCR products had the expected fragment lengths of 236 bp and 520 bp, which were consistent with those previously reported for M. enterolobii (Long et al. 2006; Tigano et al. 2010). The pathogenicity test of this nematode was performed in a greenhouse at 25°C. Ten industrial hemp seedlings (cv. Longma No. 5 ) maintained in 12-cm diameter and 12-cm high pots containing autoclaved soil, were inoculated with 800 freshly hatched J2s of the original population of M. enterolobii per plant, and 8 non-inoculated seedlings were used as controls. At 60 d after inoculation, all inoculated plants exhibited gall symptoms on the roots similar to those in the field, and the nematode reproduction factor (final population density/initial population density) was 18.2. No symptoms were observed on control plants. These results confirmed the pathogenicity of M. enterolobii on industrial hemp. To our knowledge, this is the first report of industrial hemp as a new host of M. enterolobii in China. As M. enterolobii has a broad host range, a strong pathogenicity, and a high reproduction rate, it could become a major threat to industrial hemp production. Further monitoring and research on effective control strategies are needed.

Human pluripotent stem cell-derived cardiomyocytes as a target platform for paracrine protection by cardiac mesenchymal stromal cells

Ischemic heart disease remains the foremost cause of death globally, with survivors at risk for subsequent heart failure. Paradoxically, cell therapies to offset cardiomyocyte loss after ischemic injury improve long-term cardiac function despite a lack of durable engraftment. An evolving consensus, inferred preponderantly from non-human models, is that transplanted cells benefit the heart via early paracrine signals. Here, we tested the impact of paracrine signals on human cardiomyocytes, using human pluripotent stem cell-derived cardiomyocytes (hPSC-CMs) as the target of mouse and human cardiac mesenchymal stromal cells (cMSC) with progenitor-like features. In co-culture and conditioned medium studies, cMSCs markedly inhibited human cardiomyocyte death. Little or no protection was conferred by mouse tail tip or human skin fibroblasts. Consistent with the results of transcriptomic profiling, functional analyses showed that the cMSC secretome suppressed apoptosis and preserved cardiac mitochondrial transmembrane potential. Protection was independent of exosomes under the conditions tested. In mice, injecting cMSC-conditioned media into the infarct border zone reduced apoptotic cardiomyocytes > 70% locally. Thus, hPSC-CMs provide an auspicious, relevant human platform to investigate extracellular signals for cardiac muscle survival, substantiating human cardioprotection by cMSCs, and suggesting the cMSC secretome or its components as potential cell-free therapeutic products.

Martininema semicordatae n. sp. (Nematoda: Aphelenchoididae) associated with Ficus semicordata in China

Summary A new nematode species was recovered from the syconia of Ficus semicordata from Xishuangbanna Tropical Botanical Garden, Yunnan Province, China. It is described herein as Martininema semicordatae n. sp. and is characterised by having the combined characters of a long post-vulval uterine sac, excretory pore located at nerve ring level, amoeboid sperm, three pairs of subventral papillae on the male tail, rounded male tail tip with mucron, absence of gubernaculum (= apophysis), and a recurved, rose-thorn-shaped spicule lacking a terminal cucullus. Martininema semicordatae n. sp. differs from other sequenced species by differences in the partial small subunit (SSU) rRNA gene and D2-D3 expansion segments of the large subunit (LSU) rRNA gene. Phylogenetic analysis with LSU D2-D3 expansion segment sequences suggested that M. semicordatae n. sp. is clustered in a highly supported monophyletic clade with M. guangzhouense, M. fistulosus and M. baculum, and shares a common ancestor with these three species.

What Is a Dingo? The Phenotypic Classification of Dingoes by Aboriginal and Torres Strait Islander Residents in Northern Australia.

Dingo classification and management is complicated by hybridisation with domestic dogs. Northern Australia is a relatively high-risk zone for a rabies incursion, and in the event of an incursion, Aboriginal and Torres Strait Islander peoples who reside in this region would prioritise the protection of dingoes. Therefore, the classification of dingoes in this context is important. Twelve pictures of canids with features associated with both dingoes and domestic dogs from camera traps in the Northern Peninsula Area (NPA), northern Queensland, were shown to Aboriginal and Torres Strait Islander rangers (n = 3), biosecurity officers (n = 2), environmental health workers (n = 2), and residents (n = 39) in the NPA. Nearly all pictures (10/12) were classified as dingo or domestic dog (none as hybrid) and two were inconclusive (no overall agreement). Dingoes were consistently identified as medium to large-framed dogs, with a long nose, pointed ears, narrow abdomen, a bushy or feathered tail, and smooth coats of a single base colour. Some hybrid features were acceptable, including sable coats, lack of white tail tip or feet, and curled tail. These findings are a preliminary guide for identifying canids in the NPA region for whom management might be controversial. Building on this approach via further consultation with residents is needed to inform rabies response policy. Our approach using locally acquired camera trap pictures could also be extended to other regions in which dingoes have value but their management is controversial.

Description of Aphelenchoides hamospiculatus n. sp. (Aphelenchoidea: Aphelenchoididae) from Golestan province, north Iran

Summary Two populations of Aphelenchoides hamospiculatus n. sp. were recovered from natural forests in eastern regions of Golestan province, north Iran. Both populations were morphologically similar. The new species is described and illustrated herein. The females of the type population, recovered from soil, measured 467-550 μm long, and females of the second population, from bark, measured 545-666 μm long. It is mainly characterised by having five lines in the lateral fields, a subcylindrical tail and a single centrally located mucron at the female tail tip with fine nodules, giving it a warty appearance. It is further characterised by having a cephalic region separated from the rest of the body by a shallow constriction, stylet with small swellings at base, large median bulb with slightly post-centrally located, well sclerotised valvular plates and post-vulval uterine sac 56-63 μm long in the type population. The males have spicules with a remarkable narrowing at the distal two-thirds, well-developed condylus with rounded end, small rostrum slightly bent inwards and a hook-like tip of the dorsal limb; and three pairs of cloacal + caudal papillae (the single precloacal papilla, P1, is lacking). The new species was morphologically compared with three species of the genus having five lines in the lateral fields, similar species with no data on their lateral lines, and those with similar spicules and a female tail end bearing a warty mucron. The molecular phylogenetic relationships of the new species using partial small and large subunit ribosomal RNA gene (SSU and LSU rDNA) sequences are discussed.