Synthetic Promoter Research Articles

AAV-delivered muscone-induced transgene system for treating chronic diseases in mice via inhalation

Gene therapies provide treatment options for many diseases, but the safe and long-term control of therapeutic transgene expression remains a primary issue for clinical applications. Here, we develop a muscone-induced transgene system packaged into adeno-associated virus (AAV) vectors (AAVMUSE) based on a G protein-coupled murine olfactory receptor (MOR215-1) and a synthetic cAMP-responsive promoter (PCRE). Upon exposure to the trigger, muscone binds to MOR215-1 and activates the cAMP signaling pathway to initiate transgene expression. AAVMUSE enables remote, muscone dose- and exposure-time-dependent control of luciferase expression in the livers or lungs of mice for at least 20 weeks. Moreover, we apply this AAVMUSE to treat two chronic inflammatory diseases: nonalcoholic fatty liver disease (NAFLD) and allergic asthma, showing that inhalation of muscone—after only one injection of AAVMUSE—can achieve long-term controllable expression of therapeutic proteins (ΔhFGF21 or ΔmIL-4). Our odorant-molecule-controlled system can advance gene-based precision therapies for human diseases.

Engineering CREB-activated promoters for adenosine-induced gene expression.

Accumulation of the ribonucleoside, adenosine (ADO), triggers a cAMP response element binding protein (CREB)-mediated signaling pathway to suppress the function of immune cells in tumors. Here, we describe a collection of CREB-activated promoters that allow for strong and tunable ADO-induced gene expression in human cells. By optimizing number of CREB transcription factor binding sites and altering the core promoter region of CREB-based hybrid promoters, we created synthetic constructs that drive gene expression to higher levels than strong, endogenous mammalian promoters in the presence of ADO. These synthetic promoters are induced up to 47-fold by ADO, with minimal expression in their "off" state. We further determine that our CREB-based promoters are activated by other compounds that act as signaling analogs, and that combinatorial addition of ADO and these compounds has a synergistic impact on gene expression. Surprisingly, we also detail how background ADO degradation caused by the common cell culture media additive, fetal bovine serum (FBS), confounds experiments designed to determine ADO dose-responsiveness. We show that only after long-term heat deactivation of FBS can our synthetic promoters enable gene expression induction at physiologically relevant levels of ADO. Finally, we demonstrate that the strength of a CREB-based promoter is enhanced by incorporating other transcription factor binding sites.

Fine-Tuning the Expression of the Glycolate Biosynthetic Pathway in Escherichia coli Using Synthetic Promoters

Glycolate plays an important role as a platform chemical in both polymeric material and cosmetic industries. However, the microbial production of glycolate often encounters challenges associated with unbalanced metabolic flux, leading to a notably low titer. Additionally, the use of expensive inducers, such as IPTG, contributes to an increase in the overall production cost. To address these issues, the key enzymes involved in the glycolate biosynthetic route, including citrate synthase (gltA), isocitrate lyase (aceA), isocitrate dehydrogenase kinase/phosphatase (aceK) and glyoxylate reductase (ycdW), were overexpressed in E. coli under the control of inducible promoters with varying strengths in order to determine the optimal combination. Subsequently, the glycolate pathway was further modulated by replacing inducible promoters with various constitutive synthetic promoters. Through this systematic optimization, the best strain, named Mgly4T1562, produced 3.02 g/L glycolate with 97.32% theoretical yield in shake-flask cultivation. The titer further increased to 15.53 g/L in a fed-batch experiment. Notably, this study marks the first successful utilization of synthetic promoters in tuning the glycolate biosynthetic pathway for glycolate biosynthesis. The strategy presented in this research holds significant promise for facilitating the cost-effective and industrially viable production of glycolate without the need for expensive inducers.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Promoters and Synthetic Promoters in Trichoderma reesei.

Trichoderma reesei holds immense promise for large-scale protein production, rendering it an excellent subject for deeper exploration using genetic engineering methods to achieve a comprehensive grasp of its cellular physiology. Understanding the genetic factors governing its intrinsic regulatory network is crucial, as lacking this knowledge could impede the expression of target genes. Prior and ongoing studies have concentrated on advancing new expression systems grounded in synthetic biology principles. These methodologies involve utilizing established potent promoters or engineered variations. Genomic and transcriptomic analyses have played a pivotal role in identifying robust promoters and expression systems, including light-responsive, copper-inducible, L-methionine-inducible, and Tet-On systems, among others. This chapter seeks to highlight various research endeavors focusing on tunable and constitutive promoters, the impact of different promoters on both native and foreign protein expression, the discovery of fresh promoters, and strategies conducive to future research aimed at refining and enhancing protein expression in T. reesei. Characterizing new promoters and adopting innovative expression systems hold the potential to significantly expand the molecular toolkit accessible for genetically engineering T. reesei strains. For instance, modifying potent inducible promoters such as Pcbh1 by replacing transcriptional repressors (cre1, ace1) with activators (xyr1, ace2, ace3, hap2/3/5) and integrating synthetic expression systems can result in increased production of crucial enzymes such as endoglucanases (EGLs), β-glucosidases (BGLs), and cellobiohydrolases (CBHs). Similarly, robust constitutive promoters such as Pcdna1 can be converted into synthetic hybrid promoters by incorporating activation elements from potent inducible promoters, facilitating cellulase induction and expression even under repressive conditions. Nevertheless, further efforts are necessary to uncover innovative promoters and devise novel expression strategies to enhance the production of desired proteins on an industrial scale.

Fine-Tuning Gene Expression in Bacteria by Synthetic Promoters.

Promoters are key genetic elements in the initiation and regulation of gene expression. A limited number of natural promoters has been described for the control of gene expression in synthetic biology applications. Therefore, synthetic promoters have been developed to fine-tune the transcription for the desired amount of gene product. Mostly, synthetic promoters are characterized using promoter libraries that are constructed via mutagenesis of promoter sequences. The strength of promoters in the library is determined according to the expression of a reporter gene such as gfp encoding green fluorescent protein. Gene expression can be controlled using inducers. The majority of the studies on gram-negative bacteria are conducted using the expression system of the model organism Escherichia coli while that of the model organism Bacillus subtilis is mostly used in the studies on gram-positive bacteria. Additionally, synthetic promoters for the cyanobacteria, which are phototrophic microorganisms, are evaluated, especially using the model cyanobacterium Synechocystis sp. PCC 6803. Moreover, a variety of algorithms based on machine learning methods were developed to characterize the features of promoter elements. Some of these in silico models were verified using in vitro or in vivo experiments. Identification of novel synthetic promoters with improved features compared to natural ones contributes much to the synthetic biology approaches in terms of fine-tuning gene expression.

Synthetic Promoter Design and Functional Evaluation in Saccharomyces cerevisiae.

Saccharomyces cerevisiae has become a key microbial cell factory for producing biofuels, recombinant proteins, and natural products. The development of efficient cell factories relies on the precise control and fine-tuning of gene expression, underscoring the pivotal role of promoters in pathway engineering. However, natural promoters often have limited transcriptional capacity and thus fall short of the metabolic engineering requirements. This chapter provides protocols and guidelines for constructing and evaluating synthetic promoters in S. cerevisiae. Moreover, these protocols are applicable for creating and testing various synthetic promoters in other host systems.

Chemical Reaction Models in Synthetic Promoter Design in Bacteria.

We discuss the formalism of chemical reaction networks (CRNs) as a computer-aided design interface for using formal methods in engineering living technologies. We set out by reviewing formal methods within a broader view of synthetic biology. Based on published results, we illustrate, step by step, how mathematical and computational techniques on CRNs can be used to study the structural and dynamic properties of the designed systems. As a case study, we use an E. coli two-component system that relays the external inorganic phosphate concentration signal to genetic components. We show how CRN models can scan and explore phenotypic regimes of synthetic promoters with varying detection thresholds, thereby providing a means for fine-tuning the promoter strength to match the specification.

Rational Design and Screening of Synthetic Promoters in Chlamydomonas reinhardtii.

Synthetic promoters are powerful tools to boost the biotechnological potential of microalgae as eco-sustainable industrial hosts. The increasing availability of transcriptome data on microalgae in a variety of environmental conditions allows to identify cis-regulatory elements (CREs) that are responsible for the transcriptional output. Furthermore, advanced cloning technologies, such as golden gate-based MoClo toolkits, enable the creation of modular constructs for testing multiple promoters and a range of reporter systems in a convenient manner. In this chapter, wewill describe how to introduce in silico-identified CREs into promoter sequences, and how to clone the modified promoters into MoClo compatible vectors. Wewill then describe how these promoters can be evaluated and screened for transgene expression in an established microalgal model for genetic perturbation, i.e., Chlamydomonas reinhardtii.

Exploring the Function of Gene Promoter Regulatory Elements Using CRISPR Tools.

Gene promoters serve as pivotal regulators of transcription, orchestrating the initiation, rate, and specificity of gene expression, resulting in cellular diversity found among distinct cell types within multicellular organisms. Identification of the sequence and function of promoters' regulatory elements and their complex interaction with transcription factors, enhancers, silencers, and insulators is fundamental to coordinated transcriptional processes within cells. Identifying these regulatory elements and scrutinizing their functions and interactions through the use of synthetic promoters can pave the way for researchers in various fields ranging from uncovering the origins of diseases associated with promoter mutations to harnessing these regulatory components in biotechnological applications.In this chapter, we describe the manipulation of regulatory elements within promoters, with a specific focus on the use of CRISPR technology on enhancers and silencer elements of the Ovalbumin gene promoter. We explain and discuss processes for the deletion of/interference with regulatory elements within the promoter, employing CRISPR-based approaches. Furthermore, we demonstrate that a CRISPR/Cas-manipulated promoter can activate gene transcription in cell types where it is normally inactive. This confirms that CRISPR technology can be effectively used to engineer synthetic promoters with desired characteristics, such as inducibility, tissue-specificity, or enhanced transcriptional strength. Such an approach provides valuable insights into the mechanisms and dynamics of gene expression, thereby offering new opportunities in the fields of biotechnology and medicine.

Systematic promoter design for plasmid-encoded S-adenosylmethionine sensing systems.

S-adenosylmethionine (SAM) is an important biomolecule that mainly acts as a methyl donor and plays many roles in a variety of biological functions. SAM is also required for the biosynthesis of valuable methylated compounds, but its supply is a bottleneck for these biosynthetic pathways. To overcome this bottleneck and to reconfigure SAM homeostasis, a high-throughput sensing system for changes in intracellular SAM availability is required. We constructed a plasmid that can detect the factors that can alter SAM availability using minimal components. It does so by placing a fluorescent protein under a promoter controlled by endogenous MetJ, a transcription factor that represses its own regulons upon binding with SAM. Next, to validate SAM-responsive behavior, we systematically reconstructed 10 synthetic promoters with different positions and with different number of metbox sites. We found that a position between the -35 box and the -10 box was the most effective for repression and that this setup was suitable for detecting the genetic or environmental factors that can deplete and recover the intracellular SAM availability. Overall, the response patterns of the synthetic MetJ-regulated promoters characterized in this study may be useful for the development of better SAM biosensing systems.

Hybrid Synthetic Promoters in Saccharomyces cerevisiae Built on Foreign Promoter Sequences.

Traditionally, hybrid promoters are constructed, in Saccharomyces cerevisiae, by joining the core region and the upstream activating sequences from different native promoters. Here, we describe a new design that makes use of the core promoters from foreign organisms: viruses, humans, and the yeast Schizosaccharomyces pombe. With this approach, we realized a library of 59 new constitutive promoters that span over nine folds in gene expression.

EFFECT OF MACA (Lepedium Meyenii) POWDER SUPPLEMENT ON GROWTH PERFORMANCE AND NUTRIENT DIGESTIBILITY OF YANKASA RAMS

The use of phytochemical feed additives such as Maca (Lepedium meyenii) has been widely used by livestock farmers to reduce cost of production, toxic and residual effect of industrially chemical synthetic antibiotics and growth promoters. Therefore, this research was conducted to evaluate the effect of Maca power supplement on growth performance and nutrient digestibility of Yankasa rams. A total of twenty (20) grower Yankasa rams was divided into four treatment groups of 0, 5, 10, 15g/ Kg powdered Maca with five (5) rams each per treatment in a completely randomized design (CRD). The growth performance result revealed that all parameters were significantly (P<0.05) differences with the exception (P>0.05) of initial weight were T4 had the best growth performance attributes followed by T3. Profound (P<0.05) changes was recorded in Yankasa rams nutrient digestibility fed supplemented levels of Maca. There were significant (P<0.05) differences in feacal nitrogen, urine nitrogen, and nitrogen retained as percent feed intake while nitrogen intake and nitrogen retained were not significantly (P>0.05) affected with supplementation level of Maca. It could be concluded that Maca powder supplement has a profound effect of growth performance were T4 had the outstanding growth performance, considerable increases were recorded with increases level of Maca supplement on nutrient digestibility and nitrogen balances. For improvement of growth performance and nutrient digestibility, farmers are therefore recommended to supplement up to 15g/kg Maca powder into the diet of Yankasa rams, further studies are therefore recommended to fully explore its mechanisms of actions and nutritional activities.

Development of new binary expression systems for plant synthetic biology.

A novel plant binary expression system was developed from the compactin biosynthetic pathway 27 of Penicillium citrinum ML-236B. The system achieved >fivefold activation of gene expression in 28 transgenic tobacco. A diverse and well-characterized genetic toolset is fundamental to achieve the overall goals of plant synthetic biology. To properly coordinate expression of a multigene pathway, this toolset should include binary systems that control gene expression at the level of transcription. In plants, few highly functional, orthogonal transcriptional regulators have been identified. Here, we describe the process of developing synthetic plant transcription factors using regulatory elements from the Penicillium citrinum ML-236B (compactin) pathway. This pathway contains several genes including mlcA and mlcC that are transcriptionally regulated in a dose-dependent manner by the activator mlcR. In Nicotiana benthamiana, we first expressed mlcR with several cognate synthetic promoters driving expression of GFP. Synthetic promoters contained operator sequences from the compactin gene cluster. Following identification of the most active synthetic promoter, the DNA-binding domain from mlcR was used to generate chimeric transcription factors containing variable activation domains, including QF from the Neurospora crassa Q-system. Activity was measured at both protein and RNA levels which correlated with an R2 value of 0.94. A synthetic transcription factor with a QF activation domain increased gene expression from its synthetic promoter up to sixfold in N. benthamiana. Two systems were characterized in transgenic tobacco plants. The QF-based plants maintained high expression in tobacco, increasing expression from the cognate synthetic promoter by fivefold. Transgenic plants and non-transgenic plants were morphologically indistinguishable. The framework of this study can easily be adopted for other putative transcription factors to continue improvement of the plant synthetic biology toolbox.

Highly efficient production of rhamnolipid in P. putida using a novel sacB-based system and mixed carbon source

Pseudomonas putida KT2440, a GRAS strain, has been used for synthesizing bulk and fine chemicals. However, the gene editing tool to metabolically engineer KT2440 showed low efficiency. In this study, a novel sacB-based system pK51mobsacB was established to improve the efficiency for marker-free gene disruption. Then the rhamnolipid synthetic pathway was introduced in KT2440 and genes of the competitive pathways were deleted to lower the metabolic burden based on pK51mobsacB. A series of endogenous and synthetic promoters were used for fine tuning rhlAB expression. The limited supply of dTDP-L-rhamnose was enhanced by heterologous rmlBDAC expression. Cell growth and rhamnolipid production were well balanced by using glucose/glycerol as mixed carbon sources. The final strain produced 3.64 g/L at shake-flask and 19.77 g/L rhamnolipid in a 5 L fermenter, the highest obtained among metabolically engineered KT2440, which implied the potential of KT2440 as a promising microbial cell factory for industrial rhamnolipid production.

Synthetic Homoserine Lactone Sensors for Gram-Positive Bacillus subtilis Using LuxR-Type Regulators.

A universal biochemical signal for bacterial cell-cell communication could facilitate programming dynamic responses in diverse bacterial consortia. However, the classical quorum sensing paradigm is that Gram-negative and Gram-positive bacteria generally communicate via homoserine lactones (HSLs) or oligopeptide molecular signals, respectively, to elicit population responses. Here, we create synthetic HSL sensors for Gram-positive Bacillus subtilis 168 using allosteric LuxR-type regulators (RpaR, LuxR, RhlR, and CinR) and synthetic promoters. Promoters were combinatorially designed from different sequence elements (-35, -16, -10, and transcriptional start regions). We quantified the effects of these combinatorial promoters on sensor activity and determined how regulator expression affects its activation, achieving up to 293-fold activation. Using the statistical design of experiments, we identified significant effects of promoter regions and pairwise interactions on sensor activity, which helped to understand the sequence-function relationships for synthetic promoter design. We present the first known set of functional HSL sensors (≥20-fold dynamic range) in B. subtilis for four different HSL chemical signals: p-coumaroyl-HSL, 3-oxohexanoyl-HSL, n-butyryl-HSL, and n-(3-hydroxytetradecanoyl)-HSL. This set of synthetic HSL sensors for a Gram-positive bacterium can pave the way for designable interspecies communication within microbial consortia.

Systems metabolic engineering of the primary and secondary metabolism of Streptomyces albidoflavus enhances production of the reverse antibiotic nybomycin against multi-resistant Staphylococcus aureus

Nybomycin is an antibiotic compound with proven activity against multi-resistant Staphylococcus aureus, making it an interesting candidate for combating these globally threatening pathogens. For exploring its potential, sufficient amounts of nybomycin and its derivatives must be synthetized to fully study its effectiveness, safety profile, and clinical applications. As native isolates only accumulate low amounts of the compound, superior producers are needed. The heterologous cell factory S. albidoflavus 4N24, previously derived from the cluster-free chassis S. albidoflavus Del14, produced 860 μg L−1 of nybomycin, mainly in the stationary phase. A first round of strain development modulated expression of genes involved in supply of nybomycin precursors under control of the common Perm* promoter in 4N24, but without any effect. Subsequent studies with mCherry reporter strains revealed that Perm* failed to drive expression during the product synthesis phase but that use of two synthetic promoters (PkasOP* and P41) enabled strong constitutive expression during the entire process. Using PkasOP*, several rounds of metabolic engineering successively streamlined expression of genes involved in the pentose phosphate pathway, the shikimic acid pathway, supply of CoA esters, and nybomycin biosynthesis and export, which more than doubled the nybomycin titer to 1.7 mg L−1 in the sixth-generation strain NYB-6B. In addition, we identified the minimal set of nyb genes needed to synthetize the molecule using single-gene-deletion strains. Subsequently, deletion of the regulator nybW enabled nybomycin production to begin during the growth phase, further boosting the titer and productivity. Based on RNA sequencing along the created strain genealogy, we discovered that the nyb gene cluster was unfavorably downregulated in all advanced producers. This inspired removal of a part and the entire set of the four regulatory genes at the 3′-end nyb of the cluster. The corresponding mutants NYB-8 and NYB-9 exhibited marked further improvement in production, and the deregulated cluster was combined with all beneficial targets from primary metabolism. The best strain, S. albidoflavus NYB-11, accumulated up to 12 mg L−1 nybomycin, fifteenfold more than the basic strain. The absence of native gene clusters in the host and use of a lean minimal medium contributed to a selective production process, providing an important next step toward further development of nybomycin.

Enhancing the antibacterial function of probiotic Escherichia coli Nissle: when less is more.

Probiotic bacteria confer multiple health benefits, including preventing the growth, colonization, or carriage of harmful bacteria in the gut. Bacteriocins are antibacterial peptides produced by diverse bacteria, and their production is tightly regulated and coordinated at the transcriptional level. A popular strategy for enhancing the antibacterial properties of probiotic bacteria is to retrofit them with the ability to overproduce heterologous bacteriocins. This is often achieved from non-native constitutive promoters or in response to host or pathogen signal from synthetic promoters. How the dysregulated overproduction of heterologous bacteriocins affects the fitness and antibacterial efficacy of the retrofitted probiotic bacteria is often overlooked. We have conferred the prototypical probiotic Escherichia coli strain Nissle (EcN) the ability to produce microcin C (McC) from the wild-type promoter and two mutant promoters that allow, relative to the wild-type promoter, high and low amounts of McC production. This was done by introducing specific changes to the sequence of the wild-type promoter driving transcription of the McC operon while ensuring that the modified promoters respond to native regulation. By studying the transcriptomic responses and antibacterial efficacy of the retrofitted EcN bacteria in a Galleria mellonella infection model of enterohemorrhagic E. coli, we show that EcN bacteria that produce the lowest amount of McC display the highest antibacterial efficacy with little-to-none undesired collateral impact on their fitness. The results highlight considerations researchers may take into account when retrofitting probiotic bacteria with heterogenous gene products for therapeutic, prophylactic, or diagnostic applications. Bacteria that resist killing by antibiotics are a major risk to modern medicine. The use of beneficial "probiotic" bacteria to make antibiotic-like compounds at the site of infection in the body is emerging as a popular alternative to the use of conventional antibiotics. A potential drawback of engineering probiotic bacteria in this way is that producing antibiotic-like compounds could impart undesired side effects on the performance of such bacteria, thereby compromising their intended use. This study highlights considerations researchers may take into account when engineering probiotic bacteria for therapeutic, prophylactic, or diagnostic applications.

Stable Therapeutic Transgenic FIX Levels for More Than 10 Years in Subjects with Severe Hemophilia B Who Received scAAV2/8-LP1-Hfixco Adeno-Associated Virus Gene Therapy

Background: Previously, we reported data from a first-in-human, dose-escalation, Phase 1 gene therapy trial demonstrating a dose-dependent increase in transgenic factor IX (FIX) expression in 10 adults with severe hemophilia B (FIX activity ≤1%). This was achieved following a single intravenous infusion of a self-complementary adeno-associated virus (scAAV) vector containing the wild-type FIX gene (codon-optimized), under the control of a synthetic liver-specific promoter and pseudotyped AAV8 capsid (scAAV2/8-LP1-hFIXco; ClinicalTrials.gov:NCT00979238). We now report durable efficacy and long-term safety over at least 10 years of follow-up in these participants. Methods: FIX activity, annualized bleeding rate (ABR), use of FIX concentrates, safety (specifically transaminitis and oncogenesis), and FIX expression kinetics were evaluated in the 10 participants following a bolus infusion of scAAV2/8-LP1-hFIXco at a dose of 2x10 11vg/kg (N=2), 6x10 11vg/kg (N=2), or 2x10 12vg/kg (N=6), between 2010 and 2012. Results: As of December 31, 2022, the median follow-up was 10.7 years (range 4-12 years). A total of 11 treatment-related adverse events occurred in 10 participants, including transient elevation of liver transaminases within 3 months of vector infusion in 4 of 6 patients treated with the high vector dose, without any recurrence. Two new serious adverse events were reported: (1) non-mucinous lung adenocarcinoma in situ, identified incidentally following a bullectomy for spontaneous pneumothorax 5 years after gene therapy in a 48-year-old participant considered not related to gene therapy following molecular studies, and (2) adenocarcinoma of the prostate in a 72-year-old participant 12 years after gene therapy. Tissue evaluation of the latter case is ongoing. No FIX inhibitors, thrombosis, persistent transaminitis or deaths were observed. Transgenic FIX expression has remained stable, with mean (±SD) FIX activity (one-stage) for the three dose cohorts of 1.7±0.9, 2.3±0.9 and 4.9±2.2 IU/dL, respectively (Figure 1). The mean and median ABR over the 10-year period following gene therapy of all 10 participants were 1.95 and 1.6 compared to 16.5 and 14, respectively, before gene therapy. This represents an 8.5-fold reduction in bleeding events (Wilcoxon signed rank test p=0.002). In the 6 high-dose participants, the ABR was 21-fold lower (mean=1.16, median 1, paired t-test, p<0.008). Mean and median FIX concentrate usage before gene therapy in the 10 participants were 2869 and 2526 IU/kg dropping to 945 and 274 IU/kg, respectively, over a 10-year period after gene therapy (p=0.0003). All participants developed a persistent, high-titer polyclonal anti-AAV8 capsid-specific antibody response after administration of scAAV2/8-LP1-hFIXco. Conclusion: Expression of transgenic FIX has remained stable over a period of 10 years following systemic administration of scAAV2/8-LP1-hFIXco resulting in sustained clinical benefit, with substantial reduction in ABR and FIX concentrate use.

Tuning Plant Promoters Using a Simple Split Luciferase Method to Assess Transcription Factor-DNA Interactions.

Sequence features, including the affinity of binding motifs for their cognate transcription factors, are important contributors to promoter behavior. The ability to predictably recode affinity enables the development of synthetic promoters with varying levels of response to known cellular signals. Here we describe a luminescence-based microplate assay for comparing the interactions of transcription factors with short DNA probes. We then demonstrate how these data can be used to design synthetic plant promoters of varying strengths that respond to the same transcription factor.