Synthetic Lethal Relationship Research Articles

Abstract 6064: Discovery of potent and selective EP300 degraders with anti-cancer activity

Abstract E1A binding protein (EP300) and CREB binding protein (CBP) are paralog histone acetyltransferases involved in many cellular processes via their activity as transcriptional co-activators. Dysregulation of one or both proteins has been implicated in various cancers, and functional genomic screens have demonstrated a bidirectional synthetic lethal relationship between the two genes in tumor cells. Due to the high homology between EP300 and CBP, identifying chemical matter that selectively targets EP300 or CBP has proven challenging. Here, we describe a potent, highly selective heterobifunctional degrader of EP300 with biological activity in CBP-deficient and EP300-dependent tumor cells. Targeted degradation of EP300 protein resulted in a stronger suppression of cell growth and survival than targeting the bromodomain or HAT activity of EP300/CBP with small molecule inhibitors. Anti-proliferative effects have been demonstrated in multiple cancer types, including malignant lymphomas and castration-resistant prostate tumors, highlighting the essential role of EP300 in mediating oncogenic transcription required for tumor cell growth and survival. Degradation of EP300 in vivo attenuated androgen-driven transcription and inhibited tumor growth in VCAP (AR+) prostate tumor xenografts. Importantly, no evidence of overt toxicity or thrombocytopenia was observed at therapeutically efficacious doses. These findings indicate that selective targeting of EP300 with targeted protein degradation is a safe and effective treatment strategy for advanced tumors. Citation Format: Mark Zimmerman, Ammar Adam, Hafiz Ahmad, Benjamin Adams, Ketaki Adhikari, Wesley Austin, Breanna Bullock, Julie Di Bernardo, Thomas Dixon, Danette Daniels, Claudia Dominici, GiNell Elliot, Brian Ethell, Anais Gervais, Md Imran Hossain, David Huang, Dave Lahr, Mei Yun Lin, David Mayhew, Karolina Mizeracka, Solymar Negretti, Tyler Nguyen, Olga Prifti, Darshan Sappal, Shawn Schiller, Brenna Sherbanee, David Terry, Nihan Ucisik, Elizabeth Wittenborn, Qianhe Zhou, Laura La Bonte. Discovery of potent and selective EP300 degraders with anti-cancer activity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 6064.

Abstract 3230: Discovery of selective BRM (SMARCA2) ATPase inhibitors for the treatment of BRG1 (SMARCA4) mutant cancers

Abstract BRM (SMARCA2) and BRG1 (SMARCA4) are highly homologous ATPases that are members of the BAF (also known as the mSWI/SNF) chromatin remodeling complex. BRM and BRG1 are mutually exclusive enzymatic subunits of BAF complexes, and functional genomic screens have shown a synthetic lethal relationship between the two genes. BRG1 is frequently mutated in cancer, including in approximately 10% of non-small cell lung carcinomas. Selective inhibition of BRM is a mechanism by which BRG1-mutated cancer cell growth would be affected by losing BRM function, while normal tissues should be spared as they still express functional BRG1. Given that the ATPase domains of BRM and BRG1 are 92% identical, the identification of selective enzymatic inhibitors of BRM has been challenging. Here, we report the discovery of novel, highly potent compounds that selectively inhibit BRM over BRG1 as seen in cell-based transcription and proliferation assays, that also possess excellent oral pharmacokinetics. Our lead compounds inhibit BRM in a cell-based reporter assay with an unbound IC50 of 1 nM and are greater than 20-fold selective over BRG1. They are also selective against other helicases and do not show any significant activity in off-target screening panels. Dosing of mice carrying BRG1-mutant xenografts causes target gene modulation that is correlated with compound exposure. Treatment of A549 and RERF-LC-AI xenografts with lead compounds led to tumor growth inhibition of 87% and 96%, respectively, at well-tolerated doses, and significant tumor growth inhibition was also achieved in multiple other BRG1-mutant models. The results suggest that our compounds have first-in-class potential as potent and selective BRM ATPase inhibitors for the treatment of BRG1-mutated cancers, and we are planning to file an IND in 2024. Citation Format: Janice Y. Lee, Nathan Brooks, Brandon Antonakos, Bryan Perria, Candace Langan, Bonita D. Jones, Robert Stephen Flack, Zhifang Li, David Terry, Ross Wallace, Robert Bondi, Gereint Sis, Ronee Baracani, Maralee McVean, Gabrielle Kolakowski, Dayo Osimboni, Kevin Wilson. Discovery of selective BRM (SMARCA2) ATPase inhibitors for the treatment of BRG1 (SMARCA4) mutant cancers [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3230.

Abstract 5813: AI-driven identification and validation of novel synthetic lethal gene pairs through deep mining of cancer dependency data

Abstract The targeting of synthetic lethal (SL) gene pairs is emerging as a new paradigm in precision oncology, with the potential to deliver treatments with higher efficacy and fewer side-effects. However, existing approaches have focused on a few well-validated pairs, and there is a clear need to expand the toolbox of potential SL targets. We have performed deep mining of cancer dependency data using a suite of machine learning tools and AI algorithms underpinned by robust statistical analysis to identify the next generation of SL gene pairs. To ensure robust, high confidence validation of multiple SL pairs simultaneously, we have used three cell lines and orthogonal assay formats. This has led to the confirmation of new druggable SL genes suitable for clinical development. We have identified the cancer subtypes with the strongest evidence of SL vulnerabilities and quantified patient populations who would most benefit from novel therapeutic agents. For one gene pair, we have generated novel best-in-class inhibitors of the target of interest, with exceptional selectivity over the SL partner, and used these chemical tools to validate the SL relationship in 2D and 3D models. Citation Format: Daniel S. Miller, Oliver Vipond, Alfie Brennan, Anna Hercot. AI-driven identification and validation of novel synthetic lethal gene pairs through deep mining of cancer dependency data [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5813.

Mapping of DDX11 genetic interactions defines sister chromatid cohesion as the major dependency.

DDX11/Chl1R is a conserved DNA helicase with roles in genome maintenance, DNA replication, and chromatid cohesion. Loss of DDX11 in humans leads to the rare cohesinopathy Warsaw breakage syndrome. DDX11 has also been implicated in human cancer where it has been proposed to have an oncogenic role and possibly to constitute a therapeutic target. Given the multiple roles of DDX11 in genome stability and its potential as an anticancer target, we set out to define a complete genetic interaction profile of DDX11 loss in human cell lines. Screening the human genome with clustered regularly interspaced short palindromic repeats (CRISPR) guide RNA drop out screens in DDX11-wildtype (WT) or DDX11-deficient cells revealed a strong enrichment of genes with functions related to sister chromatid cohesion. We confirm synthetic lethal relationships between DDX11 and the tumor suppressor cohesin subunit STAG2, which is frequently mutated in several cancer types and the kinase HASPIN. This screen highlights the importance of cohesion in cells lacking DDX11 and suggests DDX11 may be a therapeutic target for tumors with mutations in STAG2.

Abstract A035: Genome-wide CRISPRi screening reveals determinants of platinum sensitivity and resistance in high-grade serous ovarian cancer

Abstract A035: Genome-wide CRISPRi screening reveals determinants of platinum sensitivity and resistance in high-grade serous ovarian cancer

Predicting host-based, synthetic lethal antiviral targets from omics data.

Traditional antiviral therapies often have limited effectiveness due to toxicity and the emergence of drug resistance. Host-based antivirals are an alternative, but can cause nonspecific effects. Recent evidence shows that virus-infected cells can be selectively eliminated by targeting synthetic lethal (SL) partners of proteins disrupted by viral infection. Thus, we hypothesized that genes depleted in CRISPR knockout (KO) screens of virus-infected cells may be enriched in SL partners of proteins altered by infection. To investigate this, we established a computational pipeline predicting antiviral SL drug targets. First, we identified SARS-CoV-2-induced changes in gene products via a large compendium of omics data. Second, we identified SL partners for each altered gene product. Last, we screened CRISPR KO data for SL partners required for cell viability in infected cells. Despite differences in virus-induced alterations detected by various omics data, they share many predicted SL targets, with significant enrichment in CRISPR KO-depleted datasets. Our comparison of SARS-CoV-2 and influenza infection data revealed potential broad-spectrum, host-based antiviral SL targets. This suggests that CRISPR KO data are replete with common antiviral targets due to their SL relationship with virus-altered states and that such targets can be revealed from analysis of omics datasets and SL predictions.

SLInterpreter: An Exploratory and Iterative Human-AI Collaborative System for GNN-based Synthetic Lethal Prediction.

Synthetic Lethal (SL) relationships, though rare among the vast array of gene combinations, hold substantial promise for targeted cancer therapy. Despite advancements in AI model accuracy, there is still a significant need among domain experts for interpretive paths and mechanism explorations that align better with domain-specific knowledge, particularly due to the high costs of experimentation. To address this gap, we propose an iterative Human-AI collaborative framework with two key components: 1) HumanEngaged Knowledge Graph Refinement based on Metapath Strategies, which leverages insights from interpretive paths and domain expertise to refine the knowledge graph through metapath strategies with appropriate granularity. 2) Cross-Granularity SL Interpretation Enhancement and Mechanism Analysis, which aids experts in organizing and comparing predictions and interpretive paths across different granularities, uncovering new SL relationships, enhancing result interpretation, and elucidating potential mechanisms inferred by Graph Neural Network (GNN) models. These components cyclically optimize model predictions and mechanism explorations, enhancing expert involvement and intervention to build trust. Facilitated by SLInterpreter, this framework ensures that newly generated interpretive paths increasingly align with domain knowledge and adhere more closely to real-world biological principles through iterative Human-AI collaboration. We evaluate the framework's efficacy through a case study and expert interviews.

Hybrid nanoassembly indicating a synthetic lethality relationship induces mitotic catastrophe-mediated tumor elimination

Although DNA damage-based chemotherapy has been well investigated for clinical oncology, their effectiveness is greatly hindered by the DNA damage defenses including DNA damage repair and cell cycle arrest. Herein, we propose hybrid prodrug nanoassemblies using core-matched strategy and self-assembly technology to facilitate a synthetic lethal relationship between DNA damage and DNA damage defense. Hydroxycamptothecin (HCPT), a topoisomerase I inhibitor, is chosen as the DNA toxic chemotherapeutic. Norcantharidin (NCTD), a PP2A inhibitor, serves to abrogate homologous recombination repair and G2/M cell cycle arrest initiated by HCPT. Hybrid prodrug nanoassemblies efficiently co-deliver the two drugs with notably different physicochemical properties and lay solid foundation for their synthetic lethal synergy. The developed synthetic lethal synergy potently damages DNA and successfully attenuates DNA damage defense. More intriguingly, such synthetic lethality synergy induces tumor apoptosis by the cell death mechanism of mitotic catastrophe. In both breast tumor and colon tumor mouse models, hybrid prodrug nanoassemblies remarkably suppresses tumor proliferation and improves the safety of chemotherapy. Our results provide a promising strategy to potentiate DNA damage-based translational medicine.

Abstract A047: Discovery of potent and paralog selective PROTAC degraders of CBP or p300 proteins for the treatment of various cancers

Abstract E1A binding protein (p300) and its paralog CREB binding protein (CBP or CREBBP) are ubiquitously expressed histone acetyl transferases (HAT). They act by scaffolding or as co-activator and enhancer of different transcription factors like HIF1a, BRCA-1, p53, c-Myc, PD-L1, Estrogen receptor (ER) and Androgen receptor (AR). CBP and p300 are multidomain proteins that harbour different functional units imperative for chromatin remodelling and transcription like Bromodomain (BD), Histone acetyl transferase (HAT) domain, KIX domain etc. These two closely related epigenetic modulators are known to play oncogenic role in a variety of cancers. Conventional CBP/p300 inhibitors targeting either BD, HAT or KIX domain do not discriminate between CBP and p300 proteins due to high homology. Because of the indiscriminate inhibition of both proteins, HAT domain inhibitors showed tolerability issues preventing their clinical advancement. In contrast, bromodomain inhibitors are better tolerated because they only block coactivation function at the transcription level without impacting the scaffolding or global histone acetylation function. They show less than desirable efficacy in various cancer models within very well tolerated doses. The implication of selective inhibition of either of these proteins in various cancer has been reported in the literature due to differential dependency on either of the paralogs. A synthetic lethal relationship between these paralogs in cancer set up has also been well established recently. However, none of the reported inhibitors of the various domains described above could selectively target CBP or p300 alone due to high sequence homology. Paralog selectivity in recent time has been proved to be possible with degrader approach due to differentiated ternary complex formation. Structure-guided modeling and iterative medicinal chemistry approaches were applied to identify paralog selective and potent first in class degraders with diverse linker length and linker composition. Identified compounds showed pronounced paralog selective degradation of target proteins and cellular effects in a panel of cell lines with loss of function mutation for either of the paralog proteins but not in wild type cells. The paralog selective lead degraders are currently being further optimized to identify development candidates. Selective degraders of CBP and p300 are expected to enhance efficacy of SOC drugs or immune checkpoint blockers by governing the acetylation and transcription of oncogenic factors and co-stimulatory molecules involved in tumor progression. Citation Format: Chandrasekhar Abbineni, Saravanan Thiyagarajan, Krishna Chaitanya T, Achala Apte, Naveen Kumar R, Avinash Kumar, Dabbeeru Madhu Babu, Shwetha S, Aishwarya B Kamath, Monalisha Mandal, Rituparna Panigrahi, Sivapriya Marappan, Subhendu Mukherjee, Kavitha Nellore, Shekar Chelur, Murali Ramachandra, Susanta Samajdar. Discovery of potent and paralog selective PROTAC degraders of CBP or p300 proteins for the treatment of various cancers [abstract]. In: Proceedings of the AACR-NCI-EORTC Virtual International Conference on Molecular Targets and Cancer Therapeutics; 2023 Oct 11-15; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2023;22(12 Suppl):Abstract nr A047.

Abstract C163: KRAS alterations combined with TP53 mutations as novel synthetic lethal genomic lesions for PKMYT1 inhibition

Abstract Background: Membrane-associated tyrosine- and threonine-specific Cdc2-inhibitory kinase (PKMYT1) is a cell cycle regulatory kinase that inhibits CDK1/CyclinB activity, delaying entry into mitosis in tumor cells experiencing replication stress (RS). RS is frequently induced by genetic alterations that drive premature transition from G1 to S phase, promoting genome instability and creating a synthetic lethal (SL) relationship between these specific alterations and PKMYT1 inhibition. This relationship has been demonstrated preclinically and clinically with CCNE1 amplification and FBXW7 mutations, common alterations in ovarian and colorectal cancers, respectively. Oncogenic KRAS gain of function (GOF) mutations, combined with TP53 alterations, are bona fide drivers of RS. Here we investigate the relationship between KRAS/TP53 alterations and PKMYT1 inhibition, mediated by the first-in-class, potent and selective PKMYT1 inhibitor lunresertib (RP-6306), alone or in combination with RS-inducing agents. Methods: KRAS/TP53 double mutant isogenic cell pairs, across relevant tumor origins, were genetically engineered to express multiple KRAS GOF mutant codons and alleles (G12D, G12C, G12V, G12R, G13D and Q61H). Cell cycle distribution perturbations and RS were evaluated. Sensitivity to lunresertib alone or in combination with chemotherapeutic or targeted agents was assessed by cell growth assays. In vitro findings were further evaluated in KRAS/TP53 double mutant patient-derived xenografts (PDX). Results: Lunresertib inhibited the growth of isogenic KRAS/TP53 double mutant cells, with up to a 12-fold EC50 shift compared to control parental cells. Combination of lunresertib with RS-inducing chemotherapeutic agents (eg. gemcitabine), or the ATR inhibitor camonsertib (RP-3500) led to synergistic cell growth inhibition in KRAS/TP53 mutant cells at significantly lower concentrations than in wild type lines. Mechanistically, KRAS/TP53 isogenic cells showed elongated S-phase and increased cyclin B1 levels, phenocopying the effects of CCNE1 amplification. Lunresertib induced premature mitosis and DNA damage in KRAS/TP53 mutant cells, sparing parental cell lines. PDX efficacy studies demonstrated robust combination benefit in pancreatic, lung and colorectal settings, with durable tumor regressions and complete responses observed. Conclusion: GOF KRAS mutations, when combined with TP53 alterations, show a strong SL relationship with PKMYT1 inhibition, alone or in combination with RS-inducing antitumor agents. Importantly, the SL phenotype was observed across multiple tumor indications and KRAS mutant codons/alleles, suggesting a potential broad scope of clinical utility beyond approved KRAS inhibitors. The mechanism is similar to CCNE1 amplification, characterized by enhanced G1/S transition driving heightened dependence on PKMYT1 to inhibit CDK1/CyclinB. Taken together, our data form rationale for the therapeutic evaluation of PKMYT1 inhibitors in KRAS/TP53 altered tumors and uncover a potential new patient selection biomarker for lunresertib. Citation Format: Marc L. Hyer, Jimmy Fourtounis, David Gallo, Vivek Bhaskaran, Rino Stocco, Rosie Kryczka, Sai Save, Helen Burston, Olivier Nicolas, Stephen Morris, Anne Roulston, Jordan T. F. Young, Michal Zimmermann, C. Gary Marshall, Artur Veloso, Elia Aguado-Fraile. KRAS alterations combined with TP53 mutations as novel synthetic lethal genomic lesions for PKMYT1 inhibition [abstract]. In: Proceedings of the AACR-NCI-EORTC Virtual International Conference on Molecular Targets and Cancer Therapeutics; 2023 Oct 11-15; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2023;22(12 Suppl):Abstract nr C163.

Abstract B020: SF3B1 hotspot mutations confer sensitivity to PARP inhibition through a defective replication stress response

Abstract SF3B1 hotspot mutations are highly prevalent in several tumor types, where they lead to a global disruption of canonical splicing and are associated with a poor clinical outcome. Whilst evidence suggests that spliceosomal inhibitors have a therapeutic benefit for specific SF3B1 mutant cancers, recent trials have failed to report any clinical responses. Here we used a myriad of in vitro and in vivo techniques to identify and explore a synthetic lethal vulnerability in SF3B1 mutant cancers. These included a high throughput drug screen with an in-house curated library of 80 small-molecule inhibitors in an isogenic cell line model with the most prevalent SF3B1 mutation, a resistance CRISPR knockout screen and a range of DNA fibre analyses to gain mechanistic insights into the observed sensitivity. We identified that SF3B1 mutant cells are selectively sensitive to multiple PARP inhibitors (PARPi), which validated in numerous cell lines and patient derived models in vitro and in vivo, whereby they prevent metastasis. SF3B1 selective PARPi sensitivity occurs via a previously undescribed mechanism, as a result of excessive dormant origin firing and altered fork dynamics, due to the loss of the canonical replication stress response (pCHK1, pRPA, 53BP1), when SF3B1 mutant cells are treated with PARPi. This was further substantiated by the lack of MUS81 recruitment to under-replicated DNA intermediates, leading to the accumulation of DNA damage and cell cycle stalling, via the induction of the G2/M checkpoint. These findings demonstrate that SF3B1 mutant cells have wild-type-like replication under normal growth conditions, but fail to safeguard replication when exposed to PARPi. High content proteomic profiling identified that the defective ATR response is a direct consequence of the downregulation of CINP in SF3B1 mutant cells, which was confirmed in multiple isogenic models and in primary tumors. The defective ATR response was rescued with CINP re-expression and phenocopied through CINP silencing. In SF3B1 mutant cells G2/M checkpoint activation under PARP inhibition can be further abrogated by the addition of ATM inhibitors, but not by the inhibition of ATR or Chk1. Our discovery defines a unique mechanism underpinning PARPi sensitivity in SF3B1 mutant cancers. This synthetic-lethal relationship is further validated in a Phase 1 clinical trial, which shows that those patients with SF3B1 mutant relapsed leukemia have the longest progression free survival when treated with single agent PARPi. This novel synthetic lethality extends the utility of PARPi beyond BRCA1/2 mutant cancers and introduces a new therapeutic approach ready for proof-of-concept clinical trials. Citation Format: Philip Bland, Harry Saville, Patty T Wai, Lucinda Curnow, Jadwiga Nieminuszczy, Nivedita Ravindran, Holly E Barker, James Wright, Lu Yu, Ioanna Mavrommati, Barrie Peck, Patrycja Gazinska, Helen N Pemberton, Aditi Gulati, Naomi Guppy, Ioannis Roxanis, Guy Pratt, Ceri Oldreive, Tatjana Stankovic, Samantha Barlow, Helen Kalirai, Sarah E Coupland, Ronan Broderick, Samar Alsafadi, Alexandre Houy, Marc-Henri Stern, Stephen Pettit, Jyoti S Choudhary, Syed Haider, Wojciech Niedzwiedz, Christopher J Lord, Rachael Natrajan. SF3B1 hotspot mutations confer sensitivity to PARP inhibition through a defective replication stress response [abstract]. In: Proceedings of the AACR-NCI-EORTC Virtual International Conference on Molecular Targets and Cancer Therapeutics; 2023 Oct 11-15; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2023;22(12 Suppl):Abstract nr B020.

Abstract A060: Discovery of potent and selective EP300 degraders with anti-cancer activity

Abstract E1A binding protein (EP300) and CREB binding protein (CBP) are paralog histone acetyltransferases involved in many cellular processes via their activity as transcriptional co-activators. Dysregulation of one or both proteins has been implicated in various cancers, and functional genomic screens have demonstrated a bidirectional synthetic lethal relationship between the two genes in tumor cells. Due to the high homology between EP300 and CBP, identifying chemical matter that selectively targets EP300 or CBP has proven challenging. Here, we describe a potent, highly selective heterobifunctional degrader of EP300 with biological activity in CBP-deficient and EP300-dependent tumor cells. This compound achieves robust degradation of EP300 in vivo at doses that sustain EP300 degradation with minimal effects on CBP protein level. Targeted degradation of EP300 protein resulted in a stronger suppression of cell growth and survival than targeting the bromodomain or HAT activity of EP300/CBP with small molecule inhibitors. Strong anti-proliferative effects have been demonstrated in multiple cancer types, including lymphomas and prostate tumors, highlighting the essential role of EP300 in the malignant phenotype of these tumors. Citation Format: Mark Zimmerman, Darshan Sappal, Ammar Adam, Benjamin Adams, Ketaki Adhikari, Wesley Austin, Breanna Bullock, Julie DiBernardo, Thomas Dixon, GiNell Elliot, Brian Ethell, Anais Gervais, Md Imran Hossain, David Huang, Dave Lahr, Mei Yun Lin, David Mayhew, Karolina Mizeracka, Solymar Negretti, Tyler Nguyen, Olga Prifti, Shawn Schiller, Brenna Sherbanee, David Terry, Nihan Ucisik, Elizabeth Wittenborn, Laura LaBonte, Danette Daniels. Discovery of potent and selective EP300 degraders with anti-cancer activity [abstract]. In: Proceedings of the AACR-NCI-EORTC Virtual International Conference on Molecular Targets and Cancer Therapeutics; 2023 Oct 11-15; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2023;22(12 Suppl):Abstract nr A060.

Mechanisms of synthetic lethality between BRCA1/2 and 53BP1 deficiencies and DNA polymerase theta targeting

A synthetic lethal relationship exists between disruption of polymerase theta (Polθ), and loss of either 53BP1 or homologous recombination (HR) proteins, including BRCA1; however, the mechanistic basis of these observations are unclear. Here we reveal two distinct mechanisms of Polθ synthetic lethality, identifying dual influences of 1) whether Polθ is lost or inhibited, and 2) the underlying susceptible genotype. Firstly, we find that the sensitivity of BRCA1/2- and 53BP1-deficient cells to Polθ loss, and 53BP1-deficient cells to Polθ inhibition (ART558) requires RAD52, and appropriate reduction of RAD52 can ameliorate these phenotypes. We show that in the absence of Polθ, RAD52 accumulations suppress ssDNA gap-filling in G2/M and encourage MRE11 nuclease accumulation. In contrast, the survival of BRCA1-deficient cells treated with Polθ inhibitor are not restored by RAD52 suppression, and ssDNA gap-filling is prevented by the chemically inhibited polymerase itself. These data define an additional role for Polθ, reveal the mechanism underlying synthetic lethality between 53BP1, BRCA1/2 and Polθ loss, and indicate genotype-dependent Polθ inhibitor mechanisms.

Cellular Responses to Widespread DNA Replication Stress

Replicative DNA polymerases are blocked by nearly all types of DNA damage. The resulting DNA replication stress threatens genome stability. DNA replication stress is also caused by depletion of nucleotide pools, DNA polymerase inhibitors, and DNA sequences or structures that are difficult to replicate. Replication stress triggers complex cellular responses that include cell cycle arrest, replication fork collapse to one-ended DNA double-strand breaks, induction of DNA repair, and programmed cell death after excessive damage. Replication stress caused by specific structures (e.g., G-rich sequences that form G-quadruplexes) is localized but occurs during the S phase of every cell division. This review focuses on cellular responses to widespread stress such as that caused by random DNA damage, DNA polymerase inhibition/nucleotide pool depletion, and R-loops. Another form of global replication stress is seen in cancer cells and is termed oncogenic stress, reflecting dysregulated replication origin firing and/or replication fork progression. Replication stress responses are often dysregulated in cancer cells, and this too contributes to ongoing genome instability that can drive cancer progression. Nucleases play critical roles in replication stress responses, including MUS81, EEPD1, Metnase, CtIP, MRE11, EXO1, DNA2-BLM, SLX1-SLX4, XPF-ERCC1-SLX4, Artemis, XPG, FEN1, and TATDN2. Several of these nucleases cleave branched DNA structures at stressed replication forks to promote repair and restart of these forks. We recently defined roles for EEPD1 in restarting stressed replication forks after oxidative DNA damage, and for TATDN2 in mitigating replication stress caused by R-loop accumulation in BRCA1-defective cells. We also discuss how insights into biological responses to genome-wide replication stress can inform novel cancer treatment strategies that exploit synthetic lethal relationships among replication stress response factors.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

The XPO7/Npat Axis Inactivation Is a Therapeutic Vulnerability for TP53-Mutated AML

In acute myeloid leukemia (AML), TP53 mutations are the most prognostically unfavorable genetic alterations, as they confer resistance to various therapeutic agents and form relapsing clones, underscoring the critical need to devise a novel therapeutic strategy for TP53-mutated AML. To identify genes or pathways whose loss is vulnerable to TP53 deficiency in AML cells, we performed genome-wide CRISPR-Cas9 screens using Trp53-knockout (KO) and wild-type (WT) mouse AML cells. We employed two distinct KO screen libraries, through which we identified Xpo7, a putative nuclear/cytoplasmic transporter, as a common factor necessary for Trp53-KO AML survival. Interestingly, Trp53-KO cells were vulnerable to Xpo7 depletion, while Xpo7 functioned as a Trp53-dependent tumor suppressor in Trp53-WT AML cells. Further probing this phenomenon, we performed a CRISPR-Cas9 saturation mutagenesis scan on all Xpo7 exons. Strikingly, sgRNAs targeting Xpo7 coding regions were significantly enriched only in the Trp53-WT AMLs. In stark contrast, these same sgRNAs were mostly depleted in Trp53-KO AMLs. To determine the role of Xpo7 depletion on the expansion of Trp53 deficient clones, we prepared AML cells containing a small fraction of Trp53-KO cells both in the Xpo7-WT and KO backgrounds and assessed the proportion over time in vitro or in vivo. Remarkably, the expansion of Trp53-KO clones, noticeable in the Xpo7-WT setting, was significantly reduced under the Xpo7-KO background, prolonging the mice's survival. These data suggest that Xpo7 depletion effectively impedes Trp53-KO clone expansion. Since Xpo7 is presumed to mediate the nuclear import and export of proteins, we hypothesized that Xpo7 contributes to retaining Trp53 protein within the nucleus in Trp53-WT AMLs. As expected, nuclear Trp53 protein and mRNA levels of Trp53-targeting genes decreased significantly upon Xpo7 depletion. These data suggest that Xpo7 retains WT-Trp53 in the nucleus and functions as a Trp53-dependent tumor suppressor in Trp53-WT AMLs. Next, to elucidate the underlying mechanisms causing the toxic effects in Trp53-KO AMLs upon Xpo7 depletion, we set out to identify proteins whose localization was potentially regulated by Xpo7 in the Trp53-KO state. Employing mass spectrometry on an immunoprecipitate using anti-Xpo7 and cytoplasmic/nuclear protein extracts from both Xpo7-WT and KO AML cells, we found that Npat, an activator of histone transcription in the G1/S transition, interacted with Xpo7 and showed a significant shift towards cytoplasmic localization upon Xpo7 depletion in Trp53-KO AMLs. Strikingly, Npat protein levels displayed a notable upregulation by Trp53 depletion in AML cells. To evaluate the relevance of the XPO7/NPAT axis in human TP53-mutated AML cells, we examined the correlation between XPO7 and NPAT expression levels and AML subtypes and genetic background using publicly available datasets. XPO7 and NPAT mRNA levels were significantly upregulated in TP53-mutated AMLs in the TCGA datasets. Moreover, XPO7 and NPAT mRNAs levels were remarkably high in acute erythroid leukemia (AEL) cases, where TP53 mutations are frequently observed (Tyner et al. Nature, 2018; Iacobucci et al. Nat Genet. 2019). The Xpo7 and Npat protein expression evaluation using primary AML samples corroborated these findings, revealing overexpression in TP53-mutated AML cases. Finally, we assessed the therapeutic effect of Npat depletion in Trp53-deficient AML cells, using the dTAG system to induce Npat protein degradation by knock-in FKBP12 F36V into Npat loci. dTAG v-1 treatment immediately degraded endogenous Npat protein and led to delayed G1/S transition progression. Moreover, Npat degradation induced DNA damage, particularly in the presence of a WEE1 inhibitor or etoposide, and subsequent apoptosis. Transplantation of these AML cells into immunocompromised mice followed by dTAGv1 treatment for one week demonstrated suppressing leukemia progression in vivo. Furthermore, shRNA-mediated XPO7 or NPAT knockdown significantly suppressed the proliferation of HEL, a human AEL cell line harboring TP53 mutation, in vitro and in vivo. In summary, we identified a synthetic lethal relationship between TP53 and XPO7. We unveiled the novel regulatory mechanism of protein localization by XPO7, depending on TP53 mutational state. Our data suggest that XPO7/NPAT inactivation is a therapeutic vulnerability for TP53-mutated AML.

Activation of GCN2 By HC-7366 Results in Significant Anti-Tumor Efficacy As Monotherapy and Overcomes Resistance Mechanisms When Combined with Venetoclax in AML

Venetoclax (anti-BCL2) is approved for elderly patients with acute myeloid leukemia (AML) in combination with hypomethylating agents such as azacitidine or decitabine. However, several resistance mechanisms arise, impeding responses in patients. These resistance mechanisms include TP53 or FLT3-ITD mutations, suppression of pro-apoptotic proteins NOXA or PUMA, increases in oxidative phosphorylation and energy metabolism, or elevated expression of S100A8/A9. Recent reports have highlighted that hyperactivation of the integrated stress response (ISR) pathway overcomes venetoclax resistance through NOXA activation and glycolytic activity inhibition. However, these studies used drugs that indirectly activate the ISR with other off-target effects. General Control Nonderepressible 2 (GCN2) is an ISR kinase that senses and responds to nutrient stress conditions, and activation of GCN2 results in antitumor activity. We are developing HC-7366, a first-in-class, first-in-human direct GCN2 activator, and are currently evaluating this agent in a phase 1 clinical trial in solid tumors (NCT05121948). Here we present a series of studies characterizing the antitumor effects of HC-7366 in AML, and how it impacts venetoclax resistance. AML patients with TP53 mutations are known to have lower response rates to venetoclax.The in vivo efficacy of HC-7366 in both CDX and PDX models was independent of TP53 mutation, resulting in 100% complete response and 100% tumor growth inhibition in TP53-mutated MOLM-16 and KG-1 tumor models, respectively. Analysis of tumors from treated mice by IHC demonstrated activation of the ISR as evidenced by increased expression of the ATF4 targets ASNS and PSAT1. A genome-wide CRISPR screen in KG-1 cells revealed that GCN2 sgRNAs were significantly enriched in HC-7366-treated cells, highlighting the importance of GCN2 activation in mediating the mechanism of action of HC-7366. Interestingly, BCL2 sgRNAs were significantly depleted in HC-7366 treated cells, suggesting a synthetic lethal relationship with BCL2 inhibitors, such as venetoclax, when combined with HC-7366. Indeed, in the MV4-11 FLT3-ITD mutant model (a differentiated subtype of AML that shows limited response to venetoclax), the combination of HC-7366 and venetoclax produced substantial benefit resulting in 26% tumor regression and enhanced activation of the ISR pathway. HC-7366 treatment also increased mRNA and protein levels of NOXA and PUMA while reducing mitochondrial respiration and glycolysis in a GCN2-dependent manner, leading to a low energetic state. Consistent with its impact on cellular energetics, global metabolomic analyses of AML xenograft tumors showed that HC-7366 significantly altered metabolites associated with glycolysis and the TCA cycle. Additionally, HC-7366 reduced protein levels of S100A8/A9, also known to correlate with venetoclax resistance. Our in vitro and in vivo results demonstrate that HC-7366 is a potent GCN2 activator with strong antitumor activity in AML as a single agent and in combination with venetoclax. The potential of HC-7366 to counteract multiple known resistance mechanisms to venetoclax could provide a viable treatment option for patients with relapsed/refractory AML when used in combination with venetoclax.

RHINO directs MMEJ to repair DNA breaks in mitosis.

Nonhomologous end-joining (NHEJ) and homologous recombination (HR) are the primary pathways for repairing DNA double-strand breaks (DSBs) during interphase, whereas microhomology-mediated end-joining (MMEJ) has been regarded as a backup mechanism. Through CRISPR-Cas9-based synthetic lethal screens in cancer cells, we identified subunits of the 9-1-1 complex (RAD9A-RAD1-HUS1) and its interacting partner, RHINO, as crucial MMEJ factors. We uncovered an unexpected function for RHINO in restricting MMEJ to mitosis. RHINO accumulates in M phase, undergoes Polo-like kinase 1 (PLK1) phosphorylation, and interacts with polymerase θ (Polθ), enabling its recruitment to DSBs for subsequent repair. Additionally, we provide evidence that MMEJ activity in mitosis repairs persistent DSBs that originate in S phase. Our findings offer insights into the synthetic lethal relationship between the genes POLQ and BRCA1 and BRAC2 and the synergistic effect of Polθ and poly(ADP-ribose) polymerase (PARP) inhibitors.

Genome-wide CRISPR-Cas9 screening to identify CDS2 as an essential gene in uveal melanoma.

e21585 Background: Despite low rates of local recurrence in primary uveal melanomas following radical treatment, approximately half of all patients will develop metastatic disease. There are limited effective systemic therapeutic options and survival outcomes remain poor. Genome-wide CRISPR-Cas9 knockout screening enables appropriate molecular targets and pathways that underlie cancer development to be identified. Methods: Genome-wide single gRNA CRISPR knockout screens were performed using Human Improved Genome-wide Knockout CRISPR Library v1.1. Eight human uveal melanoma cell lines were screened for 14 days to identify gene dependencies. Prior to screening, all cell lines underwent RNA-Seq to quantify gene expression. CRISPR screen hits were validated using single gRNA competitive growth assays. In vitro functional assessment of CDS2 knockout was performed using inducible CDS2 knockout isogenic cell lines in colony forming assays and Annexin V apoptosis assays. To determine the effects of CDS2 loss on phosphoinositide synthesis, quantification of phosphatidic acid and phosphoinositides was performed using HPLC-MS. To test the association between CDS2 essentiality and CDS1 expression across all cancer types, we analysed gene essentiality data from Project Score and Project Achilles with gene expression data obtained from Cell Model Passports and the DepMap download portal (22Q4). Cell lines with CDS1 expression log2(TPM+1) < 1 were annotated as low-expressors, and the rest were annotated as high-expressors. Single group data were assessed using Student's t test. Results: We identified CDS2, which encodes enzymes that maintain phosphoinositide levels during PLC signalling, to be an essential gene in 7 out of 8 screened cell lines. All cell lines were found to have low expression of its paralogous gene, CDS1. Doxycycline-inducible CDS2 knockout clones were generated from cell lines MP41 and OMM2.5. Reduced colony formation, with a significant decrease in surviving fraction was observed after doxycycline compared with treatment with a DMSO control in both cell lines (P < 0.0001). Apoptotic and dead cells increased significantly when doxycycline was added in MP41(13.6 ± 0.9% to 47.4 ± 3.3%; P= 0.0006) and OMM2.5 (3.7 ± 0.4% to 60.4± 0.7%, P< 0.0001). CDS2 knockout resulted in an increase in the precursor phosphatidic acid, and a significant reduction of the phosphoinositides PI (MP41, P= 0.018; OMM2.5, P= 0.0005) and PIP (MP41, P= 0.033; OMM2.5, P= 0.006). CDS2 was more essential in CDS1 low-expressors in both Project Score ( P< 0.0001) and Project Achilles ( P< 0.0001) datasets, compared with CDS1 high-expressors. Conclusions: Disruption of CDS2 results in reduced cellular fitness in uveal melanoma. Given the synthetic lethal relationship between CDS1 and CDS2, in the context of low CDS1 gene expression as observed in uveal melanomas and in other tumour types, CDS2 is a potential novel therapeutic target.

PARP Inhibitors in Breast and Ovarian Cancer.

Poly (ADP-ribose) polymerase (PARP) inhibitors are one of the most successful examples of clinical translation of targeted therapies in medical oncology, and this has been demonstrated by their effective management of BRCA1/BRCA2 mutant cancers, most notably in breast and ovarian cancers. PARP inhibitors target DNA repair pathways that BRCA1/2-mutant tumours are dependent upon. Inhibition of the key components of these pathways leads to DNA damage triggering subsequent critical levels of genomic instability, mitotic catastrophe and cell death. This ultimately results in a synthetic lethal relationship between BRCA1/2 and PARP, which underpins the effectiveness of PARP inhibitors. Despite the early and dramatic response seen with PARP inhibitors, patients receiving them often develop treatment resistance. To date, data from both clinical and preclinical studies have highlighted multiple resistance mechanisms to PARP inhibitors, and only by understanding these mechanisms are we able to overcome the challenges. The focus of this review is to summarise the underlying mechanisms underpinning treatment resistance to PARP inhibitors and to aid both clinicians and scientists to develop better clinically applicable assays to better select patients who would derive the greatest benefit as well as develop new novel/combination treatment strategies to overcome these mechanisms of resistance. With a better understanding of PARP inhibitor resistance mechanisms, we would not only be able to identify a subset of patients who are unlikely to benefit from therapy but also to sequence our treatment paradigm to avoid and overcome these resistance mechanisms.