Synthesis Of Oligodeoxyribonucleotides Research Articles

Solid Phase Synthesis of Phosphorothioate Oligonucleotides Utilizing Diethyldithiocarbonate Disulfide (DDD) as an Efficient Sulfur Transfer Reagent

Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.

Convenient synthesis of oligodeoxyribonucleotides bearing arabinofuranosyl pyrimidine derivatives and its duplex formation with complementary DNA.

The oligodeoxyribonucleotides bearing 2,2'-anhydro-beta-D-arabinofuranosyluracil derivatives were synthesized and the modified residue was converted to beta-D-arabinofuranosyluracil derivatives or beta-D-arabinofuranosylisocytosine derivatives by post-synthetic modification method. The melting profiles of their ODNs with complementary DNA were studied.

Synthesis and properties of oligodeoxyribonucleotids with mono- and diphosphoryldisulfide internucleotide groupings

The synthesis of oligodeoxyribonucleotides bearing mono- and diphosphoryldisulfide internucleotide links was optimized. Oligonucleotide 3'-thiophosphorothioates were modified using the thiophosphoryl-disulfide exchange with preactivated 5'-deoxy-5'-mercaptooligonucleotides or 5'-phosphorothioate derivatives both with and without a complementary template. The lack of template was shown to differently affect the product ratio (homo- and heterodimers) in the reactions of mono- and diphosphoryldisulfide-containing oligonucleotides. A replacement of one natural phosphodiester bond in 15-16-mer duplexes by a mono- or diphosphoryldisulfide group causes a slight thermal destabilization of the corresponding duplex. The disulfide recombination of the resulting compounds was studied.

3‐(N‐tert‐Butylcarboxamido)‐1‐propyl and 4‐Oxopentyl Groups for Phosphate/Thiophosphate Protection in Oligodeoxyribonucleotide Synthesis

This unit provides procedures for the preparation of deoxyribonucleoside phosphoramidites and appropriate phosphordiamidite precursors with P(III) protecting groups different than the standard 2-cyanoethyl group. Specifically, these phosphoramidites are functionalized with the 3-(N-tert-butylcarboxamido)-1-propyl or 4-oxopentyl groups. The usefulness of these novel deoxyribonucleoside phosphoramidites in the solid-phase synthesis of a 20-mer DNA oligonucleotide and its phosphorothioated analog is demonstrated. It is also shown that removal of the 3-(N-tert-butylcarboxamido)-1-propyl phosphate/thiophosphate-protecting group from these oligonucleotides is rapidly effected under thermolytic conditions at neutral pH, whereas the 4-oxopentyl group is preferably removed by treatment with pressurized ammonia gas or concentrated ammonium hydroxide at ambient temperature. These detailed methods constitute an economical and alkylation-free approach to large-scale preparations of therapeutic oligonucleotides.

Utility of Porous Glass with a new long-chain alkylamine spacer arm as a solid support for synthesis of oligodeoxyribonucleotides via the phosphoramidite method.

Porous Glass with an [[N-(2-aminoethyl)aminomethyl]phenyl]ethylsilyl spacer arm serving as a useful solid support in the synthesis of oligodeoxyribonucleotides via the phosphoramidite strategy.

Novel base-labile protecting groups for 5'-hydroxyl protection in the synthesis of oligonucleotides.

The 6-(levulinyloxymethyl)-3-methoxy-2-nitrobenzoyl (LMM0NBz) and 2-(levulinyloxy-methyl)-5-methoxy-4-nitrobenzoyl (LMMpNBz) groups were developed as novel base-labile protection for the 5'-hydroxyl group in solid-phase oligonucleotide synthesis. A comparative study on the utility of LMMoNBz, LMMpNBz, and 2-(levulinyloxymethyl)-5-nitrobenzoyl (LMNBz) groups for the synthesis of oligodeoxyribonucleotides, and the synthesis of oligoribonucleotides using the LMMoNBz group in combination with the acid-labile 1-ethoxyethylk (EE) group to protect the 2'-hydroxyl group, are described.

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

Multiple thiol-anchor capped DNA-gold nanoparticle conjugates.

We report the synthesis of a novel trithiol-capped oligodeoxyribonucleotide and gold nanoparticle conjugates prepared from it. These DNA-gold nanoparticle conjugates exhibit substantially higher stability than analogs prepared from monothiol and cyclic disulfide-capped oligodeoxyribonucleotides, but comparable hybridization properties. A quantitative analysis of their stability under a range of conditions is provided. Significantly, this novel trithiol oligodeoxyribonucleotide can be used to stabilize particles >30 nm in diameter, which are essential for many diagnostic applications.

Direct assignment of the absolute configuration of a distinct class of deoxyribonucleoside cyclic N-acylphosphoramidites at phosphorus by M-GOESY nuclear magnetic resonance spectroscopy.

The determination of the absolute configuration of deoxyribonucleoside cyclic N-acylphosphoramidites at phosphorus toward the synthesis of P-stereodifined phosphorothioated oligodeoxyribonucleotides is easily accomplished with computer-assisted molecular modeling and M-GOESY NMR spectroscopy. Specifically, computer-modeling diasteromeric phosphoramidite 3 has identifed a proximal (2.55 A) through-space interaction between benzylic H-5 and sugar H-2' ', which can predictably be detected by M-GOESY NMR in SP-3 but not in RP-3 because of being too distant (5.85 A). Consistent with computer-assisted modeling predictions, M-GOESY NMR spectra of SP-3 and RP-3 revealed NOE signals generated from nuclei near the selectively excited H-2' ' that are common to both SP-3 and RP-3, namely those of H-2', H-4', H-3', and H-1'. In addition, a diagnostic NOE signal at 5.5 ppm (benzylic H-5) is, as predicted, only detected in SP-3 and thus provides an unequivocal assessment of the configuration of the diastereomer at phosphorus. M-GOESY NMR data also confirm that the condensation of deoxyribonucleoside cyclic N-acylphosphoramidites with base-activated nucleosidic or nucleotidic 5'-hydroxyls proceeds via a single nucleophilic event.

Synthesis of nucleotide derivatives containing 1-(4-(3-(trifluoromethyl)-3H-diazirin-3-yl)benzamido)-2,3-propanediol for photoaffinity modification of proteins and nucleic acid

1-(4-(3-(Trifluoromethyl)-3H-diazirin-3-yl)benzamido)-3-O-(4,4'- dimethoxytrityl)-2,3-propanediol phosphoramidite was synthesized and used as a modified unit in the automatic synthesis of oligodeoxyribonucleotides. Pentadecathymidylates with various numbers of 2,3-propanediol moieties substituted with aryl(trifluoromethyl)diazirinyl (ATFMD) were obtained, and the thermal stability of their duplexes with (dA)15 were studied. One ATFMD-propanediol residue was shown to reduce the thermal stability of the duplex by 8-9 degrees C. The irradiation of the ATFMD-containing duplexes by UV light with the wavelength of 350 nm was found to cause the cross-linking reaction of the ATFMD-containing strand with the complementary strand and the formation of the cross-linked duplexes. The photomodification efficiency was independent of the oligonucleotide sequence, with each ATFMD group providing for 5% cross-linking. The irradiation of an ATFMD-containing duplex, a substrate of the HIV-1 integrase, in the presence of this enzyme resulted in the covalent DNA-protein complex. The oligonucleotides with the 1-(4-(3-(trifluoromethyl)-3H-diazirin-3-yl)benzamido)-2,3-propanediol moiety in their chains can be used for the photoaffinity modification of both nucleic acids and proteins that recognize them. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2002, vol. 28, no. 4; see also http://www.maik.ru.

A new method for the synthesis of oligodeoxyribonucleotides containing 4-N-alkoxycarbonyldeoxycytidine derivatives and their hybridization properties.

Oligodeoxyribonucleotides incorporating 4-N-alkoxycarbonyldeoxycytidine derivatives were synthesized on polystyrene-type ArgoPore resins having a new benzyloxy(diisopropyl)silyl linker, by use of ZnBr(2) as the detritylating agent. The first 3'-terminal thymidine could be attached to the resin by successive in situ reactions of 5'-O-DMTr-thymidine with diisopropylsilanediyl ditriflate and an ArgoPore resin containing hydroxyl groups. The use of this new silanediyl-type linker allowed release of the DNA chain from the resin by treatment with TBAF under neutral conditions. The T(m) experiments apparently showed that incorporation of 4-N-alkoxycarbonyldeoxycytidines into DNA strands resulted in higher hybridization affinity with the complementary DNA strands than that of 4-N-acyldeoxycytidines. In addition, comparable T(m) studies using oligodeoxyribonucleotides incorporating acyl (RC(O)-) groups and alkoxyacyl (RO(CH(2))(n)C(O)-) groups having the same chain length show that the latter tend to exhibit higher T(m) values than the former. It turned out that 4-N-alkoxycarbonyldeoxycytidines can form base pairs not only with deoxyguanosine but also with deoxyadenosine. Based on the ab initio calculations of the hydrogen bond energies of the possible base pairs formed between 4-N-methoxycarbonyl-1-methylcytosine and 9-methyladenine and the NMR analysis of the base-pairs of (15)N-labeled 4-N-alkoxycarbonyldeoxycytidines with deoxyadenosine derivatives, we conclude that the base pair involves two unique hydrogen bonds between the cytosyl 4-NH group and the adenyl N(1) atom and between the O atom of the ester group and the adenyl 6-NH group.

Conjugation of 5′‐Functionalized Oligodeoxyribonucleotides with Properly Functionalized Ligands

This unit reports the synthesis of oligodeoxyribonucleotides covalently linked via their 5' termini to various ligands such as intercalating agents, reactive groups, or labels. Methods for incorporation of halogenoalkyl, isothiocyanate, and 2-pyridyldisulfide linkers onto ligands, and addition of amino, carboxyl, thiophosphate, phosphate, and masked thiol groups at the 5 terminus of an oligodeoxyribonucleotide are described elsewhere in the series. This unit reports procedures for coupling the ligands and oligonucleotides, as well as details for purification and characterization of the final products.

Synthesis of oligonucleotide inhibitors of DNA (Cytosine-C5) methyltransferase containing 5-azacytosine residues at specific sites.

The incorporation of 5-azacytosine residues into DNA causes potent inhibition of DNA (Cytosine-C5) methyltransferases. The synthesis of oligodeoxyribonucleotides incorporating single or multiple 5-aza-2'-deoxycytidine residues at precise sites was undertaken to generate an array of sequences containing the reactive 5-azacytosine base as specific target sites for enzymatic methylation. Preparation of these modified oligonucleotides requires the use of 2-(p-nitrophenyl)ethyloxycarbonyl (NPEOC) groups for the protection of exocyclic amino functions. These groups are removed under mild conditions, thus avoiding conventional protocols that are detrimental to the integrity of the 5-azacytosine ring.

Synthesis and Hybridization Ability of Oligodeoxyribonucleotides Incorporating N-Acyldeoxycytidine Derivatives

Synthesis and Hybridization Ability of Oligodeoxyribonucleotides Incorporating N-Acyldeoxycytidine Derivatives

Synthesis and characterization of oligodeoxyribonucleotides carrying arrays of intercalating groups.

A novel strategy for attaching the functional groups to oligodeoxyribonucleotides (ODNs) is described. A thymidine carrying anthraquinone derivative at the N3 position (AnT) was synthesized and introduced into ODNs using the phosphoramidite method on a DNA synthesizer. Py-Pu-Py type triplex formation of ODNs was enhanced by attaching AnT to the 5'-end of the third strand.

A new coupling method for the synthesis of oligodeoxyribonucleotides based on protection by protonation of nucleoside bases.

We developed a conceptually new strategy for the coupling method in the phosphoramidite method without protection of nucleoside bases. This strategy, called "proton-block method", significantly reduced side reactions compared with the previous methods.

Toward an Ideal Synthesis of Oligonucleotides: Development of a Novel Phosphoramidite Method with High Capability

Abstract Several novel methods for reliably carrying out the oligonucleotide synthesis via the phosphoramidite strategy have been developed. The first is the method using allyloxycarbonyl and allyl groups for the protection of nucleoside bases and internucleotide linkages, respectively. These protectors can be cleanly removed under almost neutral conditions with a mixture of an organic Pd(0) complex such as Pd[P(C6H5)3]4 or Pd2[(C6H5CH=CH)2CO]3·CHCl3, and P(C6H5)3 in the presence of a nucleophile such as butylammonium formate, diethylammonium hydrogencarbonate, diethylammonium carbonate, or dimedone. A method for the facile oxidation of nucleoside phosphites to phosphates has been developed; this is performed under non-aqueous and non-basic conditions using 2-butanone peroxide in dichloromethane, t-butyl hydroperoxide in toluene, or bis(trimethylsilyl) peroxide in dichloromethane. The combined use of the N-allyloxycarbonyl/P–O-allyl-protected method and anhydrous/non-basic oxidation is extremely useful for the synthesis of nucleotide derivatives sensitive to moisture and/or bases, producing them in higher yield and at a greater level of purity than the existing methods using acyl or aroyl and cyanoethyl groups for the protection of nucleoside bases and internucleotide linkages, respectively, and iodine in aqueous pyridine for the oxidation. Further, acid/azole complexes serving as highly useful activators of phosphoramidites have been invented. The reagents include imidazolium triflate, N-(phenyl)imidazolium triflate, benzimidazolium triflate, and N-(methyl)benzimidazolium triflate, which allow higher-yield synthesis of oligonucleotides than conventionally employed 1H-tetrazole and related reagents. For example, synthesis of oligoribonucleotides via the allyloxycarbonyl/allyl-protected strategy has been carried out more efficiently using N-(phenyl)imidazolium triflate as a promoter than 5-(ethylthio)-1H-tetrazole, which has been found to be the most effective promoter among those currently available for oligoribonucleotide synthesis. Further, imidazolium triflate has opened the door to the extremely convenient and efficient synthesis of oligodeoxyribonucleotides without nucleoside-base protection. This method is obviously advantageous over N-protected methods because it eliminates tedious operations and the use of superfluous reagents required for the introduction and removal of the N-protecting group; risks of decomposition and loss of product by protection and deprotection are also avoided. Facile liquid-phase preparation of short oligomers has also been developed; this is successfully accomplished using stoichiometric amounts of building blocks by the aid of an equimolar amount of azolium reagent or a catalytic amount of 5-(p-nitrophenyl)-1H-tetrazole. These two methods are beneficial from an economical point of view, particularly in large-scale synthesis.

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

The 4-oxopentyl group as a labile phosphate/thiophosphate protecting group for synthetic oligodeoxyribonucleotides

An efficient and economical method for the solid-phase synthesis of oligodeoxyribonucleotides and their phosphorothioate analogues is described. The method entails the use of the 4-oxopentyl group for phosphate/thiophosphate protection. Post-synthesis removal of the protecting group is easily and rapidly achieved under mild conditions at ambient temperature using either pressurized gaseous amines or concentrated ammonium hydroxide.

Characterization of oligodeoxyribonucleotide synthesis on glass plates.

Achieving high fidelity chemical synthesis on glass plates has become increasingly important, since glass plates are substrates widely used for miniaturized chemical and biochemical reactions and analyses. DNA chips can be directly prepared by synthesizing oligonucleotides on glass plates, but the characterization of these micro-syntheses has been limited by the sub-picomolar amount of material available. Most DNA chip syntheses have been assayed using in situ coupling of fluorescent molecules to the 5'-OH of the synthesized oligonucleotides. We herein report a systematic investigation of oligonucleotide synthesis on glass plates with the reactions carried out in an automated DNA synthesizer using standard phosphoramidite chemistry. The analyses were performed using (32)P gel electrophoresis of the oligonucleotides cleaved from glass plates to provide product distribution profiles according to chain length of oligonucleotides. 5'-Methoxythymidine was used as the chain terminator, which permits assay of coupling reaction yields as a function of chain length growth. The results of this work reveal that a major cause of lower fidelity synthesis on glass plates is particularly inefficient reactions of the various reagents with functional groups close to glass plate surfaces. These problems cannot be detected by previous in situ fluorescence assays. The identification of this origin of low fidelity synthesis on glass plates should help to achieve improved synthesis for high quality oligonucleotide microarrays.