Bacterial Spot Symptoms Research Articles

Evaluation of systemic acquired resistance inducers for the management of copper and streptomycin resistant strains of Xanthomonas perforans on tomato

Bacterial spot (Xanthomonas spp.) is one of the most detrimental diseases of tomato (Solanum lycopersicum L.) worldwide. Bacterial spot Xanthomonads are either endemic or spread by contaminated seed or transplant material into tomato production areas. Due to limited disease management options, transplant producers rely on copper- and streptomycin-based bactericides that are often ineffective due to the predominance of resistant Xanthomonas strains. In this study, transplant production facilities located across eight counties in western North Carolina were surveyed for bacterial spot symptoms from 2018 to 2019. In total, 29 strains (n = 6 in 2018 and n = 23 in 2019) were isolated and identified as Xanthomonas perforans. All strains were resistant to copper, while only 24% of the strains were resistant to streptomycin. Therefore, the ability of three systemic acquired resistance (SAR) inducers, methyl salicylate, Bacillus mycoides isolate J, and acibenzolar-S-methyl (ASM), alone or in combination with copper or streptomycin were evaluated as potential alternatives to copper-mancozeb (grower standard) to manage bacterial spot under greenhouse and field conditions. Under greenhouse conditions, applications of ASM at 0.4 g/L alone, or in combination with copper or streptomycin, significantly reduced bacterial spot disease severity when compared to the grower standard and nontreated controls (P < 0.05). However, none of the SAR inducers significantly reduced disease severity or improved yield when compared to copper-mancozeb-ASM under field conditions (P < 0.05). This study highlights the potential of using ASM for the management of bacterial spot of tomato transplant production to reduce bacterial spot introduction into the field.

Identification of species and physiological races of Xanthomonas isolated from tomato (Solanum lycopersicum) and chili pepper (Capsicum annuum) in Sinaloa, Mexico

Bacterial spot of tomato and chili pepper, caused by four species of Xanthomonas and various races, is one of the diseases with the greatest impact on horticulture worldwide. The aim of this study was to identify the species and physiological races of Xanthomonas present in tomato (Solanum lycopersicum) and chili pepper (Capsicum annuum) crops in Sinaloa, Mexico. For this purpose, samples with typical symptoms of bacterial spot were collected in commercial fields of the different municipalities in the state of Sinaloa. Ninety-three bacteria were isolated on semi-selective medium as nutrient agar and yeast extract-dextrose. A total of 47 bacteria were identified as Xanthomonas by a combination of morphological, pathogenic, biochemical, physiological, and molecular tests. In addition, to characterize the morphological race of each strain, differential tomato (four) and chili pepper (six) lines were used. Molecular diagnostic using specific primers indicated that 83% corresponded to X. euvesicatoria, 10.6% to X. perforans, and 6.4% to X. vesicatoria. At the physiological race level, races T1, T2, T3, and T5 were detected in tomato; while the Xanthomonas races detected in chili pepper were P0, P3, P6, P8 and P10. This information updates previous data on the distribution of races of Xanthomonas that infect chili peppers in Sinaloa, since races P6 and P10 are reported for the first time.

Phenotypic and Genotypic Characterization of Newly Isolated Xanthomonas euvesicatoria-Specific Bacteriophages and Evaluation of Their Biocontrol Potential

Bacteriophages have greatly engaged the attention of scientists worldwide due to the continuously increasing resistance of phytopathogenic bacteria to commercially used chemical pesticides. However, the knowledge regarding phages is still very insufficient and must be continuously expanded. This paper presents the results of the isolation, characterization, and evaluation of the potential of 11 phage isolates as natural predators of a severe phytopathogenic bacterium-Xanthomonas euvesicatoria. Phages were isolated from the rhizosphere of tomato plants with symptoms of bacterial spot. The plaque morphology of all isolates was determined on a X. euvesicatoria lawn via a plaque assay. Three of the isolates were attributed to the family Myoviridae based on TEM micrographs. All phages showed good long-term viability when stored at 4 °C and -20 °C. Three of the phage isolates possessed high stability at very low pH values. Fifty-five-day persistence in a soil sample without the presence of the specific host and a lack of lytic activity on beneficial rhizosphere bacteria were found for the phage isolate BsXeu269p/3. The complete genome of the same isolate was sequenced and analyzed, and, for the first time in this paper, we report a circular representation of a linear but circularly permuted phage genome among known X. euvesicatoria phage genomes.

Attenuations of bacterial spot disease Xanthomonas euvesicatoria on tomato plants treated with biostimulants

BackgroundThe bacterial-spot disease caused by different Xanthomonas species is one of the major tomato diseases that reduce crop production and quality. Pesticides indiscriminate usage has resulted in an increase in resistant bacterial strains as well as contamination of farmers, consumers and the environment. Plant growth-promoting bacteria and humic acids can act as elicitors of plant defence mechanism causing extensive transcriptional and metabolic reprogramming which, in turn, produce a range of plant chemical defences. The purpose of this study was to study how humic acids and plant growth-promoting bacteria, when applied to the substrate, affected the severity of bacterial spot symptoms in tomato leaves.Materials and methodsOne-month-old Micro-Tom tomato (Solanum lycopersicum L.) were transferred to 3 L pots filled with a sterile mixture of sand and vermiculite (2:1, v:v) and treated or not (control) with 250 mL of 4.5 mmol C. L−1 of humic acids, Herbaspirillum seropedicae (108 CFU. mL−1) and the combination of humic acids plus H. seropedicae. One day after substrate treatment, the leaves were inoculated (or not) with X. euvesicatoria (Xe). The area below the disease progression curve based on severity scores and the number of symptomatic leaflets was used to assess phytopathogen virulence. The concentration of oxalic, citric and succinic acids in leaf extracts were determined using HPLC analysis.ResultsSole or combined H. seropedicae (BAC) and humic acids (HA) application promoted shoot and root growth related to control when plants were challenged with Xe pathogen. For plants inoculated with Xe, more significant plant-growth promotion results were obtained for HA + BAC treatment. The first visible symptoms were observed 16 days after inoculation with 2 × 104 CFU. g−1 of Xe cells in leaves of control plants. HA and BAC applied alone or combined reduced disease severity. Only plants treated with HA were able to reduce disease incidence (number of the leaflets with symptoms). Organic acids, such as oxalic, citric and succinic acids, rose in Xe-inoculated leaves. The reduced amount of organic acids in diseased leaves treated with HA + BAC may be linked to a decrease in disease progression.ConclusionHumic acids and H. seropedicae increased growth by modulating the content of organic acids in leaf tissue, attenuating the symptoms of the bacterial spot disease.Graphic abstract

PATHOLOGICAL, BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OF THE SEED-BORNE BACTERIA "PANTOEA SPP., XANTHOMONAS SPP. AND PSEUDOMONAS SPP." FROM SOLANACEOUS PLANTS IN EGYPT

The seed-borne bacterial diseases of family solanaceae cause significant economic losses worldwide. In the present study, fourteen bacterial isolates were recovered from seeds of different varieties of tomato, eggplant, black nightshade and tobacco. The seed samples were collected from different locations in Egypt. Isolated bacteria were identified based on morphological, physiological and biochemical tests as well as colonial morphology aspects on the differential medium, yeast extract dextrose calcium carbonate (YDC) besides the selective media (PA 20, King's B and Tween B). Pathogenicity of the isolated bacteria was assessed for causing graywall, bacterial speck and bacterial spot symptoms on tomato seedlings. Disease symptoms were recognized on leaves and stems of the inoculated seedlings. Re-isolation from collected seeds of the inoculated tomato plants was performed. Results indicated that Pantoea spp. was an endophytic bacteria, Pseudomonas spp. was an epiphytic bacteria, while Xanthomonas spp. was both epiphytic and endophytic bacteria. Furthermore, cellular fatty acids composition were identified and quantified to give a profile for tested bacterial isolates. Moreover, the bacterial isolates were identified at the molecular level via PCR reactions utilizing the 16S rRNA gene. Partial DNA sequences were analyzed using BLAST tool revealed that the inferred 16S rRNA partial sequences of the 7 isolates showed similarity to Pantoea ananatis (3 isolates), Pseudomonas syringae pv. tomato (2 isolates) and Xanthomonas vesicatoria (2 isolates). To the best of our knowledge the bacterium associated with the graywall seems to be first report of P. ananatis isolated from tomato fruits and black nightshade seeds in Egypt.

Pepper Bacterial Spot Control by Bacillus velezensis: Bioprocess Solution

Pepper bacterial spot is one of the most severe plant diseases in terms of infection persistence and economic losses when it comes to fresh pepper fruits used in nutrition and industrial processing. In this study, Bacillus velezensis IP22 isolated from fresh cheese was used as a biocontrol agent of pepper bacterial spot, whose main causal agent is the cosmopolitan pathogen Xanthomonas euvesicatoria. After optimization of the cultivation medium composition aimed at maximizing of the antimicrobial activity against X. euvesicatoria and validation of the optimized medium at the scale of a laboratory bioreactor, in planta tests were performed. The results have showed significant suppression of bacterial spot symptoms in pepper plants by the produced biocontrol agent, as well as reduction of disease spreading on the healthy (uninoculated) pepper leaves. Furthermore, HPLC-MS (high pressure liquid chromatography–mass spectrometry) analysis was employed to examine antimicrobial metabolites produced by B. velezensis IP22, where lipopeptides were found with similar m/z values compared to lipopeptides from fengycin and locillomycin families. The bioprocess solution developed at the laboratory scale investigated in this study represents a promising strategy for production of pepper bacterial spot biocontrol agent based on B. velezensis IP22, a food isolate with a great perspective for application in plant protection.

Strain-Level Identification of Bacterial Tomato Pathogens Directly from Metagenomic Sequences

Routine strain-level identification of plant pathogens directly from symptomatic tissue could significantly improve plant disease control and prevention. Here we tested the Oxford Nanopore Technologies (ONT) MinION sequencer for metagenomic sequencing of tomato plants either artificially inoculated with a known strain of the bacterial speck pathogen Pseudomonas syringae pv. tomato or collected in the field and showing bacterial spot symptoms caused by one of four Xanthomonas species. After species-level identification via ONT's WIMP software and the third-party tools Sourmash and MetaMaps, we used Sourmash and MetaMaps with a custom database of representative genomes of bacterial tomato pathogens to attempt strain-level identification. In parallel, each metagenome was assembled and the longest contigs were used as query with the genome-based microbial identification Web service LINbase. Both the read-based and assembly-based approaches correctly identified P. syringae pv. tomato strain T1 in the artificially inoculated samples. The pathogen strain in most field samples was identified as a member of Xanthomonas perforans group 2. This result was confirmed by whole genome sequencing of colonies isolated from one of the samples. Although in our case metagenome-based pathogen identification at the strain level was achieved, caution still must be exercised in interpreting strain-level results because of the challenges inherent to assigning reads to specific strains and the error rate of nanopore sequencing.

In vitro potencijal antagonista Bacillus spp. za suzbijanje fitopatogena Xanthomonas euvesicatoria

Bacterial pathogen Xanthomonas euvesicatoria, principal causer of bacterial spot, represents a significant problem in agricultural practice due to high yield losses in the production of pepper and tomato. The development of resistance to copper pesticides has shifted research, in the field of its suppression, towards biopesticides. In this study, several Bacillus strains were tested against Xanthomonas euvesicatoria strains, isolated from pepper leaves with symptoms of bacterial spot, to select a sufficiently effective antagonist. When it comes to the testing of cultivation broth, containing biomass of tested antagonists, the best results were achieved using isolate Bacillus sp3. On the other hand, when biomass-free supernatants, containing produced antimicrobial compounds, were tested, Bacillus sp1 and Bacillus sp2 have shown the highest antimicrobial activity. The results of this study represent a basis for further development of bioprocess solutions for the production of biopesticides based on Bacillus spp. biomass or antimicrobial compounds, showing high efficiency in suppression of pepper bacterial spot.

Xanthomonas perforans: a tomato and pepper pathogen associated with bacterial blight and dieback of Eucalyptus pellita seedlings in Indonesia

Leaf and shoot blight, often accompanied by die-back symptoms, on Eucalyptus species, hybrids and clones have been reported from a number of countries. More than one bacterial species has been found to cause these symptoms. In this study, a leaf disease of E. pellita in Indonesia was investigated. The disease was found primarily on nursery plants and young trees that recovered within the first year of growth. Leaf samples were collected from symptomatic trees, and isolations consistently yielded a Xanthomonas sp. Sequencing of the 16S rRNA gene region and multilocus sequence analysis (MLSA) was performed on 19 of the 61 Xanthomonas isolates obtained. In the MLSA, four genes, namely, dnaK, fyuA, gyrB and rpoD, were sequenced and the isolates were identified as X. perforans. Four representative isolates, at a concentration of 106 CFU/ml, were leaf-infiltrated and spray-inoculated on to E. pellita, tomato and pepper seedlings. The type isolate of X. perforans was included in the pathogenicity trials as a positive control. All four isolates of X. perforans, inclusive of the type isolate, induced bacterial spot symptoms on tomato and pepper seedlings. They also caused water-soaked lesions on the leaves of E. pellita seedlings, characteristic of the symptoms observed in the field. This is the first report of X. perforans infecting leaves of a woody host.

Reclassification of Xanthomonas gardneri (ex Šutič 1957) Jones et al. 2006 as a later heterotypic synonym of Xanthomonas cynarae Trébaol et al. 2000 and description of X. cynarae pv. cynarae and X. cynarae pv. gardneri based on whole genome analyses.

Multilocus sequence analysis of Xanthomonas species revealed a very close relationship between Xanthomonas cynarae, an artichoke pathogen and Xanthomonas gardneri, a tomato and pepper pathogen. Results of whole genome sequence comparisons using average nucleotide identity between representative strains of X. gardneri and X. cynarae were well above the threshold of 95-96 %. Inoculations of X. gardneri strains in artichoke leaves caused mild disease symptoms, but only weak symptoms were observed in the bracts. Both X. cynarae and X. gardneri grew equally and caused typical bacterial spot symptoms in pepper after artificial inoculation. However, X. cynarae induced a hypersensitive reaction in tomato, while X. gardneri strains were virulent. Pathogenicity-associated gene clusters, including the protein secretion systems, type III effector profiles, and lipopolysaccharide cluster were nearly identical between the two species. Based on our results from whole genome sequence comparison, X. gardneri and X. cynarae belong to the same species. The name X. cynarae has priority and X. gardneri should be considered as a later heterotypic synonym. An emended description of X. cynarae (type strain=CFBP 4188T, =DSM 16794T) is given. However, due to the host specificity in artichoke and tomato, two pathovars, X. cynarae pv. cynarae and X. cynarae pv. gardneri, are proposed.

Evaluation of cherry cultivar susceptibility to bacterial canker and leaf spot disease

AbstractIn this study, the susceptibility of different sweet (19) and sour cherry (3) cultivars (cvs.) to the bacterial pathogens Pseudomonas syringae pv. syringae and P. s. pv. morsprunorum race 1 causing bacterial canker (sensu stricto) and leaf spot was evaluated. Susceptibility to bacterial canker was examined by artificial inoculations of 1‐year‐old rooted trees, which revealed susceptibility of all cvs. to both P. syringae pathovars. Susceptibility level differed among cvs.; sweet cherry cvs. Katalin, Linda, Summit, New Star and Bigarreau Burlat were highly susceptible, sour cherry cvs. Érdi bôtermô and sweet cherry Drogan's Yellow, Carmen, Germersdorfer and Noir de Meched were susceptible. Sour cherry cvs. Španska and Újfehértói fürtös, as well as sweet cherry cv. Rita were found to be less susceptible to bacterial canker. Susceptibility to bacterial leaf spot disease was evaluated on naturally infected (field conditions) and artificially inoculated leaves (laboratory conditions). Severe symptoms of bacterial spot with shot hole appearance were observed in cherry leaves at the beginning of May under field conditions. In all collected leaf samples, presence of P. s. pv. morsprunorum race 1 was determined. Sweet cherries Valery Chkalov, Summit, Bigarreau Burlat and New Star were highly susceptible to this bacterium. No symptoms of bacterial spot were found on sweet cherries Solomary gomboly, Linda, Germersdorfer, Hedelfinger, Katalin, Margit, Carmen, Aida, Sunburst, Alex, Peter, Rita and Kavics and sour cherry Érdi bôtermô. In laboratory conditions, susceptibility of the tested cvs. varied and mostly depended on the inoculation method. Nonetheless, sweet cherry cvs. Carmen and Margit and sour cherry Érdi bôtermô exhibited a certain level of resistance.

Complete Genome of the Xanthomonas euvesicatoria Specific Bacteriophage KΦ1, Its Survival and Potential in Control of Pepper Bacterial Spot.

Xanthomonas euvesicatoria phage KΦ1, a member of Myoviridae family, was isolated from the rhizosphere of pepper plants showing symptoms of bacterial spot. The phage strain expressed antibacterial activity to all X. euvesicatoria strains tested and did not lyse other Xanthomonas spp., nor other less related bacterial species. The genome of KΦ1 is double-stranded DNA of 46.077 bp including 66 open reading frames and an average GC content of 62.9%, representing the first complete genome sequence published for a phage infecting xanthomonads associated with pepper or tomato. The highest genome similarity was observed between phage KΦ1 and the Xanthomonas oryzae pv. oryzae specific phage OP2. On the other hand, when compared with other members of the genus Bcep78virus, the genome similarity was lower. Forty-four (67%) predicted KΦ1 proteins shared homology with Xanthomonas phage OP2, while 20 genes (30%) were unique to KΦ1. Phage KΦ1, which is chloroform resistant and stable in different media and in the pH range 5-11, showed a high titer storage ability for at least 2 years at +4°C. Copper-hydroxide and copper-oxychloride reduced phage activity proportionally to the used concentrations and the exposure time. UV light was detrimental to the phage strain, but skim milk plus sucrose formulation extended its survival in vitro. The phages survived for at least 7 days on the surface of pepper leaves in the greenhouse, showing the ability to persist on the plant tissue without the presence of the host bacterium. Results of three repeated experiments showed that foliar applications of the unformulated KΦ1 phage suspension effectively controlled pepper bacterial spot compared to the standard treatment and the untreated control. The integration of the phage KΦ1 and copper-hydroxide treatments resulted in an increased efficacy compared to the copper-hydroxide alone.

Lactobacillus plantarum Exopolysaccharides Induce Resistance against Tomato Bacterial Spot

Lactic acid bacteria produce several exopolysaccharides (EPS) that may have antimicrobial action and/or induce defense responses in plants. This work aims to evaluate the potential of EPS produced by Lactobacillus plantarum in the protection of tomato plants against bacterial spot caused by Xanthomonas gardneri, as well as to predict the possible mechanisms of action. The EPS were characterized through FTIR and applied at 0; 0.5; 1.5 and 3.0 mg mL-1 in tomato plants with five expanded leaves, followed by the pathogen inoculation after 3 or 7 days. Antimicrobial activity of the biopolymer (1.5 or 10.0 mg mL-1) was evaluated in bioassay when EPS was incorporated into culture medium or embedded in antibiogram disk. The defense mechanisms i.e., total phenolic compounds and flavonoids content, phenylalanine ammonia-lyase (PAL), glutathione reductase (GR) and lipoxygenase (LOX) activities, were measured in tomato plants treated with EPS (1.5 mg mL-1), inoculated or not with X. gardneri. EPS reduced bacterial spot symptoms by up to 72.0% compared to the control. There were no direct effects of EPS on the in vitro growth of X. gardneri. The spectrophotometric profile, ascorbic and ellagic acid concentrations were change in tomato plants after EPS application, in plants challenged with the pathogen. Increases in PAL, GR and LOX activities were observed in plants treated with EPS. Thus, the application of L. plantarum exopolysaccharides can be considered as an effective alternative for controlling bacterial spot in tomato plants. This paper also discusses how these exopolysaccharides reduced the severity of the disease.

Antagonistic rhizobacteria and jasmonic acid induce resistance against tomato bacterial spot

Tomato bacterial spot on tomato may be caused by four species of Xanthomonas and among them X. gardneri (Xg) is the most destructive one, especially in areas irrigated using a center pivot system in Minas Gerais state and the midwest region of Brazil. Due to the ineffectiveness of chemical control and the lack of cultivars with high levels of genetic resistance, this study investigated the potential of three antagonists (Streptomyces setonii (UFV618), Bacillus cereus (UFV592) and Serratia marcescens (UFV252)), and the hormone jasmonic acid (JA) as a positive control, to reduce bacterial spot symptoms and to potentiate defense enzymes in the leaves of tomato plants infected by Xg. Tomato seeds were microbiolized with each antagonist, and the soil was drenched with these bacteria. The plants were sprayed with JA 48 h before Xg inoculation. The final average severity on the tomato plants was reduced by 29.44, 59.26 and 61.33% in the UFV592, UFV618 and JA treatments, respectively. The UFV618 antagonist was as effective as JA in reducing bacterial spot symptoms on tomatoes, which can be explained by the greater activities of defense enzymes that are commonly involved in host resistance against bacterial diseases. These results suggest that JA and the UFV618 antagonist can be used in the integrated management of bacterial spot on tomatoes.

First Report of Atypical Xanthomonas euvesicatoria Strains Causing Bacterial Spot of Tomato in Nigeria.

Bacterial spot (BS) is an important disease of tomato in Nigeria (2). Although a xanthomonad was isolated from tomato in Nigeria and characterized using phenotypic and pathogenicity tests, the bacterium was not characterized genetically to confirm the species. To determine the species associated with BS, leaves were collected in fields in northwestern Nigeria from tomato plants showing typical BS symptoms, which consisted of dark, irregular-shaped brown leaf spots that coalesced, resulting in a blighted appearance. Isolations from individual lesions were made on nutrient agar (NA). Yellow, mucoid colonies typical of Xanthomonas were isolated from 14 lesions and all were determined to be amylolytic (3). To determine the races of these strains, bacterial suspensions of the tomato strains, derived from 24-h cultures grown on NA at 28°C, were adjusted to 108 CFU/ml and infiltrated into leaves of tomato and pepper differential genotypes (5). The tomato strains elicited hypersensitive reactions (HRs) on the four pepper differential lines and an HR on the tomato genotype FL 216, which contains the R gene Xv3, but elicited susceptible reactions on the tomato genotypes Hawaii 7998 and Bonny Best. These reactions are typical of X. perforans tomato race 3 strains (5). Multilocus sequence analysis (MLSA) of six housekeeping genes (fusA, lacF, gyrB, gltA, gapA, and lepA) was used to further analyze four representative strains (1) (GenBank Accession Nos. KJ938581 to KJ938584, KJ938588 to KJ938591, KJ938595 to KJ938598, KJ938602 to KJ938605, KJ938629 to KJ938632, and KJ938636 to KJ938639, respectively). A partial sequence of hrpB2 was also made since the four Xanthomonas species associated with BS can be differentiated based on sequence divergence of this gene (3) (KJ938609 to KJ938621 and KJ938628). The housekeeping gene sequences were aligned along with other Xanthomonas sequences imported from the National Center for Biotechnology Information (NCBI) database ( www.ncbi.nlm.nih.gov ) using the MUSCLE tool from MEGA software, 5.2.2. Maximum likelihood phylogenetic trees constructed for the six housekeeping gene sequences individually and in concatenation revealed that the strains grouped most closely with the X. euvesicatoria reference strain 85-10 but more distantly to X. perforans. The hrpB2 sequence, which is highly conserved for each Xanthomonas species pathogenic on tomato (4), was sequenced from the tomato strains. These sequences were identical to the hrpB2 sequence from X. perforans strains but different from X. euvesicatoria. Although BS is common in Nigeria, to our knowledge, this represents a unique group of X. euvesicatoria strains from tomato that are identical to X. perforans based on pathogenic reactions on tomato and pepper and hrpB2 sequence identity but are more closely related to X. euvesicatoria based on the six housekeeping gene sequences.

First Report of Pseudomonas syringae pv. syringae Causing Bacterial Leaf Spots of Oil Pumpkin (Cucurbita pepo) in Serbia.

Oil pumpkin (Cucurbita pepo L.) is commonly used for oil production, mainly in central and eastern Europe (1). In Serbia, it grows only in the north (Vojvodina Province), up to 1,500 ha. In June 2008, typical bacterial spot symptoms (dark green, water-soaked, transparent and greasy spots with yellow margins) were observed for the first time, cultivated at the experimental fields near Backi Petrovac. Since then, bacterial spots were regularly observed on oil pumpkin in the beginning of the growing seasons and during rainy weather, with disease incidence ranging from 5 to 20%. Bacteria isolated from 40 diseased leaves formed white, round, convex, and mucoid colonies on nutrient sucrose agar (NSA). Eight representative strains were aerobic, gram-negative, non-spore-forming rods. All strains produced fluorescent pigment and catalase. In levan-oxidase-potato rot-arginine dihydrolase-tobacco hypersensitivity (LOPAT) tests (3), they induced a hypersensitive reaction in tobacco leaves, did not cause soft rot of potato tubers, and were positive for levan and negative for oxidase and arginine dihydrolase. According to the LOPAT profile, they were classified in the Ia subgroup of pseudomonads (3). Strains hydrolyzed aesculin, but were unable to hydrolyze starch or reduce nitrates to nitrites. Negative reactions were obtained with hydrogen sulfide and indole. Reactions were identical to those of reference strain Pseudomonas syringae pv. syringae CFBP 1582, which was included in all biochemical, physiological, and molecular tests for comparison. To identify the pathogen, PCR and DNA sequencing were employed. Fragments of 752 bp for the syrB gene and 1,040 bp for the syrD gene were amplified from all strains, using B1/B2 and SyD1/SyD2 primer sets, respectively (2). The pathogenicity was tested on seeds and seedlings of oil pumpkin cv. Olinka. Strains were grown for 48 h on nutrient broth (NB) at 28°C and bacterial suspensions of ~108 CFU ml-1 were used for inoculations. Sterile water was used as negative control. Seeds (at the BBCH-1-0 stage) allowed to imbibe water were wounded by needle, immersed in the bacterial suspensions, and maintained in humid petri dishes to allow symptom development. The cotyledons of seedlings at the BBCH-10 stage were inoculated by hypodermic needle and potted plants were maintained at 25 ± 1°C and 75% relative humidity. Symptoms, including dark green, water-soaked spots, appeared 5 to 7 days after inoculation of both seeds and seedlings. The bacterium was re-isolated from spots of all seeds and seedlings tested, fulfilling Koch's postulates (the identity of re-isolated strains was confirmed by pathogenicity, morphology, and biochemical features). No symptoms were observed on controls. 16S rDNA amplicons obtained from representative strain Tk21 and re-isolated strain Tk21R with fD1/rD1 primers (4) were sequenced and deposited in GenBank under accession nos. KF305578 and KF735064, respectively. The sequences showed 100% similarity to each other and P. syringae pv. syringae from pepper (KC816630.1) (China), Ficus carica (JQ071937) (Serbia), and culture-collection ICMP:3023 (HM190217). On the basis of the symptoms, biochemical tests, and 16S rDNA sequence homology, the pathogen was identified as P. syringae pv. syringae. To our knowledge, this is the first report of P. syringae pv. syringae causing bacterial leaf spot on oil pumpkin in Serbia.

Outbreak of Bacterial Spot (Xanthomonas cucurbitae) in Pumpkin Fields in Illinois.

About 10,000 ha of pumpkins [Cucurbita pepo L. and Cucurbita moschata (Duchesne) Duchesne ex Poir] are produced annually in Illinois. In 2010 and 2011, severe leaf and fruit symptoms typical of bacterial spot caused by Xanthomonas cucurbitae (ex Bryan) Vauterin et al. were observed in pumpkin fields in Illinois, resulting in estimated yield losses of 3 to 90%. Leaf infection was observed from the time of spreading vines until harvest, and infection of fruit occurred from when fruit weights were 0.25 kg until harvest. Leaves had small (2 to 4 mm), angular, yellow spots (1). Fruit had small (1 to 3 mm in diameter), slightly sunken, circular spots, each with a beige center and dark brown halo (1). A survey in 2010 showed that bacterial spot occurred in 40 of 50 pumpkin fields with symptoms on 3 to 94% of fruit in a field (average 34%). A survey in 2011 showed fruit with bacterial spot symptoms in 57 of 65 pumpkin fields, with lesions on 3 to 87% of the fruit in a field (average 24%). Six to twelve symptomatic pumpkins were collected from each field, and X. cucurbitae was isolated from the fruit by surface-disinfesting an area of the fruit with lesions with paper tissue soaked in 95% ethanol. One or two lesions/fruit were cut out with a sterile blade, inserted into an eppendorf tube containing 1 ml of sterile distilled water (SDW), the tubes shaken manually, and a loopful of the bacterial suspension from each tube streaked onto nutrient agar (NA). The plates were incubated at 24°C for 3 to 4 days. Single colonies of each of the isolated bacterium were prepared by streaking isolated colonies onto additional plates of NA and selecting well-separated colonies. The colonies were identified as X. cucurbitae by culturing on yeast extract-dextrose-CaCO3 (YDC) agar, on which xanthomonas-like yellow colonies with mucoid growth developed. The isolates were gram-negative, O+ and F- in the oxidative and fermentative test, oxidase negative, and motile. The isolates hydrolyzed starch and esculin, but did not hydrolyze nitrate, and grew on YDC agar at 33°C. Confirmation of the species identity was achieved using primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') in a conventional PCR assay (2), which produced a 1,500-bp band. Koch's postulates were carried out for 40 isolates of X. cucurbitae from 40 different fields on pumpkin cv. Howden in a greenhouse. Koch's postulates for five of the isolates were also conducted in a field. Bacterial inoculum was cultured on Luria Broth agar medium and a suspension of 108 cfu/ml prepared in SDW. Pumpkin leaves and fruit were spray-inoculated. In the greenhouse test, each isolate was inoculated onto five leaves of each of four plants. In the field, each isolate was inoculated onto 10 leaves and one fruit of each of 10 plants. A positive control treatment consisted of inoculating pumpkin leaves and fruit with a known X. cucurbitae isolate. A negative control treatment entailed using SDW for inoculation. Lesions developed on leaves and fruit of plants inoculated with the positive control and suspected X. cucurbitae isolates. X. cucurbitae was reisolated from symptomatic leaves and fruit and identified by culturing on YDC agar, and using the PCR assay. No symptoms developed on leaves or fruit sprayed with SDW, and attempts to isolate X. cucurbitae from these plants did not result in development of any bacterial colonies.

Reliability and accuracy of visual methods to quantify severity of foliar bacterial spot symptoms on peach and nectarine

The objectives of this study were to assess the reliability and accuracy of visual methods used to quantify the severity of bacterial spot (Xanthomonas arboricola pv. pruni) symptoms and evaluate the effects of rater experience on the quality of disease estimates. Three cohorts of raters differing in experience with disease assessment rated three sets of peach or nectarine leaves (n ≥ 103; disease severity levels from 0% to 100%) by direct estimation of percentage leaf area with symptoms. Four of the experienced raters also rated the leaves using a 1–7 interval scale. Actual disease severity on the leaves was obtained with the APS assess image analysis software. Equivalence tests based on a bootstrap analysis were used to compare the rating scale and direct estimation methods, and to evaluate the effects of rater experience, computer training and human instruction on accuracy and reliability of disease estimates. In concordance analysis of continuous variables, with data from scale converted to percentage, the direct estimation method resulted in more accurate and reliable estimates than the interval scale. Analysing the scale data without conversion to percentage improved the concordance statistics for the scale but not sufficiently to match the direct estimation method. Accuracy was affected more by rater experience and intrinsic ability than reliability. Instruction on disease symptoms resulted in the largest improvement in estimates from inexperienced raters. Accurate and reliable direct estimation of bacterial spot severity on peach and nectarine can be made by raters with varying levels of experience provided they receive sufficient instruction.

First Report of Xanthomonas arboricola pv. pruni in Ornamental Prunus laurocerasus in the Netherlands.

In 2008, Dutch ornamental plant growers observed a leaf spot of cherry laurel (Prunus laurocerasus) at a greater incidence (5 to 50%) than the usual sporadic level (<1%). For advice on disease control, ~5 to 10% of these growers contacted Dutch regulatory officials. In November and December 2008, six symptomatic samples from northern and southern parts of the Netherlands were submitted for diagnosis. Leaf spots were chlorotic, most had a necrotic brown center with a distinct margin, and the spots readily abscised, resulting in a "shot-hole" appearance. Leaf spots from the samples were surface sterilized (2 s in 70% vol/vol alcohol), blotted dry on tissue paper, chopped into pieces (1 to 2 mm in diameter), and incubated for 30 min in 10 mM phosphate-buffered saline (PBS) (1). A 20-μl aliquot of extract per sample was streaked by dilution plating on four plates of yeast peptone glucose agar medium (1), and the plates were incubated for 2 to 3 days at 28°C. Isolations from all six samples yielded Xanthomonas-like colonies. After purification, characterization of all six isolates revealed oxidative, nonfermentative metabolism of glucose by rod-shaped, gram-negative bacterial cells. All six isolates were identified as Xanthomonas arboricola pv. pruni based on biochemical tests (1), fatty acid analysis (4), and immunofluorescence (IF) using polyclonal antibodies (Plant Research International, the Netherlands). Pathogenicity was tested on potted peach plants (cvs. Peregrine and Vaes Oogst) and on detached leaves of P. laurocerasus (cv. Novita) (1). The six field isolates from 2008 were each inoculated (108 CFU/ml) onto four leaves per plant of each of two peach plants (replicates). As positive control treatments, two reference strains (ATCC 19312 and PD740) were each inoculated onto the same number of leaves and plants, and as a noninoculated negative control treatment, leaves of two peach plants were treated with sterile 10 mM PBS buffer (1). All leaves inoculated with the six field isolates and the two reference strains developed typical bacterial spot symptoms in 3 to 4 weeks. Negative control plants showed no symptoms. The detached leaf assay performed with the same treatments on each of two leaves (replicates) showed identical results. The bacterium was reisolated from leaf spots associated with each of the eight symptomatic treatments and identity of the reisolates was confirmed by IF. Additionally, genotypic variation of 35 Dutch isolates of X. arboricola pv. pruni was assessed by BOX-PCR assay with the BOX A1R primer set (3), and Gyrase B gene sequencing (2). Both methods revealed 100% homology among the 35 isolates, suggesting a single, recent introduction of X. arboricola pv. pruni into the Netherlands. In a 2009 survey to assess distribution of the disease in the Netherlands, X. arboricola pv. pruni was found in 41 fields. Infected hosts included P. laurocerasus cvs. Otto Luyken, Rotundifolia, Novita, Etna, Anbri, Herbergii, Mischeana, and Caucasia. X. arboricola pv. pruni is a quarantine organism in countries affiliated under the EPPO (European and Mediterranean Plant Protection Organization). Phytosanitary measures were taken to prevent movement of infested plants from nurseries where X. arboricola pv. pruni was detected.

First Report of Bacterial Leaf Spot of Basil Caused by Pseudomonas viridiflava in Hungary.

In April 2011, typical bacterial spot symptoms were observed on sweet basil plantlets (Ocimum basilicum L.) in a supermarket in Budapest, Hungary. Affected plants had dark brown-to-black lesions on the cotyledons. Spots on the leaves were first water soaked and then became necrotic and progressed inward from the margins. Symptoms were similar to those reported by Little et al. (3) on basil affected by Pseudomonas viridiflava. Bacteria consistently isolated from leaf lesions formed mucoid colonies with a green fluorescent pigment on King's B medium. Strains were gram negative. In LOPAT (levan-oxidase-potato rot-arginine dihydrolase-tobacco hypersensitivity) tests (2), all induced a hypersensitive reaction (HR) in tobacco (Nicotiana tabacum L. cv. White Burley) leaves (1), caused soft rot of potato tuber slices, and were negative for levan, oxidase, and arginine dihydrolase. Biochemical tests, API 20NE and API 50 CH (Biomérieux, Marcy l'Etoile, France), were also used for identification. The pathogenicity of three isolates was tested twice by injecting 20-day-old healthy basil plants with a bacterial suspension (107 CFU/ml). Controls were injected with sterile distilled water. Plants were kept at 25 to 28°C and 80 to 100% relative humidity. Forty-eight hours after inoculation, dark brown-to-black lesions were observed only on inoculated plants. The bacterium was reisolated from lesions of all plants tested, fulfilling Koch's postulates. No lesions were observed on controls. To identify the pathogen, a PCR technique was used. The 16SrDNA region was amplified with general bacterial primer pair (63f forward and 1389r reverse) (4) then the PCR products were cloned into Escherichia coli DH5α cells and a recombinant plasmid was sequenced by M13 forward and reverse primers. The sequence was deposited in GenBank (Accession No. HE585219). On the basis of the symptoms, biochemical tests, and 16SrDNA sequence homology (99% sequence similarity with a number of P. viridiflava isolates), the pathogen was identified as P. viridiflava. To our knowledge, this is the first report of bacterial leaf spot of basil in Hungary, which can seriously affect the basil production.