Symptomless Tomato Research Articles

Clavibacter lycopersici sp. nov.: a peach-colored actinobacterium isolated from symptomless tomato plant.

In 2015, Gram-positive peach-coloured actinobacterial strains were isolated from symptomless tomato phyllosphere in Iran. Biochemical and physiological characteristics, as well as 16S rRNA phylogeny showed that the strains belong to Clavibacter sp., while they were non-pathogenic on the host of isolation, and morphologically distinct from the tomato pathogen C. michiganensis and other plant-associated bacteria. Multilocus sequence analysis of five housekeeping genes showed that the two peach-coloured strains CFBP 8615T (Tom532T) and CFBP 8616 (Tom495) were phylogenetically distinct from all validly described Clavibacter species. Whole genome sequence-based indices, i.e. average nucleotide identity (orthoANI) and digital DNA-DNA hybridization (dDDH), showed that the two peach-colored strains share nearly 100 % orthoANI value with one another, while they differ from all validly described Clavibacter species with the orthoANI/dDDH values <93 % and <50 %, respectively. Thus, based on both phenotypic features and orthoANI/dDDH indices the peach-coloured strains could belong to a new species within Clavibacter. In this study, we provide a formal species description for the peach-coloured tomato-associated Clavibacter strains. Clavibacter lycopersici sp. nov. is proposed for the new species with Tom532T = CFBP 8615T = ICMP 22100T as type strain.

Occurrence of the Iflavirus-like Tomato Matilda Virus in Solanum Species in South Africa.

Tomato matilda virus (TMaV) is an iflavirus-like virus that was first reported by Saqib et al. (2015) in symptomless tomato plants in Australia. Those authors demonstrated using phylogenetic analysis that TMaV was an iflavirus, and that it replicated in plants and was transmitted between plants. However, infection was symptomless in tomato and aubergine, and induced mild symptoms in chilli plants. This was the first report of a plant-infecting iflavirus, a genus of insect viruses, suggesting a potential evolutionary transition of iflaviruses into plant hosts. Here we report the detection of TMaV in wild Solanum chenopodioides and Solanum sisymbriifolium in South Africa. In a survey for viruses of wild Solanum species, leaf tissues from S. chenopodioides and S. sisymbriifolium displaying rugosity and chlorotic mottling were collected from roadsides and potato and tomato farms in five provinces (Free State, Gauteng, KwaZulu Natal, Limpopo and Mpumalanga) in South Africa. Total RNA extracted from 10 plants for each species was pooled (500 ng/sample). Ribosomal RNA removal, cDNA library construction and high throughput sequencing (HTS) using the Illumina HiSeq PE150 were conducted by Novogene Co. Ltd (Beijing, China). From S. chenopodioides and S. sisymbriifolium, 44 052 441 and 47 515 569 total clean reads were obtained, respectively. Using Trinity and SPAdes within the VirFind pipeline (Ho and Tzanetakis, 2014), 68711 and 21125 contigs were assembled. BLASTn search of the contigs revealed the presence of TMaV as well as cowpea tombusvirid 1 (Tombusviridae), pepper veinal mottle virus, African eggplant mosaic, potato virus Y (Potyviridae), cucumber mosaic virus, tomato necrotic spot virus (Bromoviridae), tobacco vein clearing virus and cauliflower mosaic virus (Caulimoviridae) in S. chenopodioides and S. sisymbriifolium. The TMaV contigs from S. chenopodioides (n = 33) and S. sisymbriifolium (n = 88) were mapped to the TMaV genome (HQ260868) reported by Saqib et al. (2015). The assembled draft TMaV genomes from S. chenopodioides (7547 bp, MW717924) and S. sisymbriifolium (7553 bp, MW717925) covered 98.5% of that reference genome with 98.0 and 97.8% sequence identity, respectively, and 98.5 and 98.3% sequence identity to a TMaV isolate (MK517476) from Italy. The two draft genomes displayed 99.5% sequence identity to each other. BLASTn analysis of these draft genomes only retrieved hits for TMaV and blackberry iflavirus A (BVA), another plant-infecting iflavirus (Khadgi, 2015). No insect iflavirus hits were obtained, thereby potentially excluding contamination by insect viruses. The two TMaV sequences displayed 81.9-89.9% identity to the partial sequences of BVA. The presence of TMaV in S. chenopodioides and S. sisymbriifolium was confirmed by RT-PCR of the pooled RNA and sequencing using primer sets reported by Saqib et al. (2015), Matil_F1 (ACGGCAGCCACGCTAAGAAA)/Matil_R1 (TCATTATGGCGCCTGTATGG) covering TMaV genome locations 1008-1821 (includes rhv-like 1 and partially rhv-like 2 structural protein genes) and Matil_F9 (TTTACCTTGTGCTGTTGCAG)/ Matil_R9 (ACCTGCAGACGTTGTTAATT) spanning positions 6485-7214 (sequence region encoding partial cystein protease, nucleotide binding site and partial RNA dependent RNA polymerase). The sequences obtained from the amplicons (accessions MW717926 - MW717929) displayed 97.2 - 98.4% sequence identity to those of the Saqib et al. (2015) genome, and were fully identical to the TMaV sequences generated initially using HTS. The detection of TMaV in these Solanum spp. further supports the concept of plant-infecting iflaviruses. Saqib et al. (2015) proposed the genus Tomavirus within Iflaviridae to accommodate TMaV. This is possibly similar to Tospoviridae, the only plant-infecting family of the order Bunyavirales, which is composed of viruses of arthropods and vertebrates (Ullman et al. 2005). Further studies are needed to understand TMaV infection of different plant hosts, especially crops of economic importance.

Biocontrol of Tomato Bacterial Wilt by Foliar Spray Application of a Novel Strain of Endophytic &lt;i&gt;Bacillus&lt;/i&gt; sp.

The aim of the present study was to identify a strain of endophytic Bacillus species that control tomato bacterial wilt by foliar spray application. Fifty heat-tolerant endophytic bacteria were isolated from the surface-sterilized foliar tissues of symptomless tomato plants that had been pre-inoculated with the pathogen Ralstonia pseudosolanacearum. In the primary screening, we assessed the suppressive effects of a shoot-dipping treatment with bacterial strains against bacterial wilt on tomato seedlings grown on peat pellets. Bacillus sp. strains G1S3 and G4L1 significantly suppressed the incidence of tomato bacterial wilt. In subsequent pot experiments, the biocontrol efficacy of foliar spray application was examined under glasshouse conditions. G4L1 displayed consistent and significant disease suppression, and, thus, was selected as a biocontrol candidate. Moreover, the pathogen population in the stem of G4L1-treated plants was markedly smaller than that in control plants. A quantitative real-time PCR analysis revealed that the foliar spraying of tomato plants with G4L1 up-regulated the expression of PR-1a and LoxD in stem and GluB in roots upon the pathogen inoculation, implying that the induction of salicylic acid-, jasmonic acid-, and ethylene-dependent defenses was involved in the protective effects of this strain. In the re-isolation experiment, G4L1 efficiently colonized foliar tissues for at least 4‍ ‍weeks after spray application. Collectively, the present results indicate that G4L1 is a promising biocontrol agent for tomato bacterial wilt. Furthermore, to the best of our knowledge, this is the first study to report the biocontrol of bacterial wilt by the foliar spraying with an endophytic Bacillus species.

THE FIRST REPORT OF A 16SrXII-A PHYTOPLASMA ASSOCIATED WITH TOMATO BIG BUD DISEASE IN IRAN

In 2013 surveys, up to 7.5% incidence of big bud disease was observed in tomato fields of Kazerun area (Fars province, Iran). The main disease symptoms were big bud, little leaf, flower virescence, phyllody, proliferation and sterility. To investigate the phytoplasma presence, total DNAs extracted from four symptomatic and four symptomless tomato plants were tested by nested PCR using P1/P7 primer pair followed by R16F2n/R16R2 primers (Lee et al., 1998). Amplicons of ca. 1.8 and 1.2 kb, respectively were amplified in samples of symptomatic plants but not of symptomless ones. Four P1/P7 amplicons from symptomatic tomato plants were cloned and sequenced. The obtained 16S rDNA sequences showed 100% sequence identity with each other and a representative of these sequences deposited in GenBank (Accession No. KX098490). BLAST search using full length 16S rRNA gene sequence revealed that Kazerun tomato big bud (KTBB) sequence showed 100% identity with a 'Candidatus Phytoplasma solani' strain (AF248959), representative of 16SrXII-A subgroup. Computer-simulated restriction analysis using iPhyClassifier showed that the RFLP profile of KTBB 16S rDNA F2nR2 fragment was identical (similarity coefficient 1.00) to the reference pattern of 16SrXII-A (AF248959). Phylogenetic analysis revealed that KTBB phytoplasma clustered with16SrXII group phytoplasmas closest to 16SrXII-A subgroup reference strain (AF248959). To our knowledge this is the first report of a 16SrXII-A phytoplasma associated with TBB disease in Iran. 16SrXII- related phytoplasmas have been previously reported from grapevine (Salehi et al., 2014) and Cannabis sativa (Vali Sichani et al., 2011) in Iran.

Monitoring the occurrence of tomato bacterial spot and range of the causal agent Xanthomonas perforans in Iran

A 2‐year comprehensive field survey was conducted across major tomato‐growing areas of Iran. Two hundred and thirty‐four tomato fields and six tomato‐producing greenhouses were surveyed for the potential presence of bacterial spot disease. Five hundred and ninety‐six tomato samples with and without symptoms were analysed. While Xanthomonas spp. were found in association with tomato plants both with and without symptoms from five surveyed counties, the bacterial spot disease was observed only in plants from three of them. Only strains isolated from plants with symptoms induced disease symptoms on tomato, while those isolated from symptomless plants caused symptoms only on cabbage and common bean. None of the isolates caused disease symptoms on pepper and eggplant. Phylogenetic analysis showed that X. perforans is the causal agent of tomato bacterial spot in Iran, although X. campestris and X. axonopodis were also associated with symptomless tomato plants. All X. perforans isolates in this study were sensitive to streptomycin, copper sulphate and copper oxychloride at concentrations of 50 mg L−1, 200 mg L−1 and 0.8 g L−1, respectively. Unlike the type strain of X. perforans, isolates in this study did not produce bacteriocin against other Xanthomonas spp., nor were they detected using the usual species‐specific primer pair Bs‐XpF/Bs‐XpR. This suggests an atypical nature of X. perforans strains in Iran, which leads to the hypothesis that X. perforans strains in Iran may have a separate origin to those causing disease epidemics elsewhere. The aggregated dispersal pattern of the diseased tomato fields signifies the seedborne introduction of the pathogen into the country.

Detection and molecular characterization of Slovak tomato isolates belonging to two recombinant strains of potato virus Y.

Total RNAs from asymptomless tomato plant were subjected to next-generation sequencing (NGS) analysis, revealing the presence of asingle viral agent - potato virus Y (PVY). The analysis of determined full-length genome sequence assigned the PVY SL16 isolate to the recombinant PVY-N-Wi strain group. Aseries of primers targeting the four main recombinant junction (RJ) sites were used for characterization of additional 5 tomato PVY isolates recovered in Western Slovakia. Based on the partial sequences, the isolates could be classified as belonging to PVY-N-Wi and PVY-NTNa strain groups. Interestingly, both these distinct recombinant PVY types were identified in mixed infection in one tomato sample (SL31). Our results further reinforce the data on the complexity of PVY infection and confirm the recombination as asignificant evolutionary process shaping the PVY diversity.

Serendipitous identification of a new Iflavirus‐like virus infecting tomato and its subsequent characterization

The genomic sequence of a previously undescribed virus was identified from symptomless tomato plants (Solanum lycopersicum). The viral genome is a positive‐sense ssRNA molecule of 8506 nucleotides. It is predicted to encode a single polyprotein of 314·5 kDa that is subsequently processed into three coat protein components of 13·7, 17·9 and 13·5 kDa, and a viral replicase of approximately 207 kDa with conserved motifs for a helicase, a protease and RNA‐dependent RNA polymerase (RdRp). Pairwise analysis of the deduced amino acid sequence of the RdRp revealed that it shares closest identity with members of the family Iflaviridae, genus Iflavirus (19–47% identity). Evidence of replication in plants was detected by RT‐PCR of the viral replicative strand, and short interfering RNAs (siRNAs) matching the virus. The name Tomato matilda virus (TMaV) is proposed, and furthermore, that the genus Tomavirus (Tomato matilda virus) be created within the family Iflaviridae. This is the first report of a plant‐infecting virus resembling members of the Iflaviridae.

Tomato can be a latent carrier of ‘Candidatus Liberibacter solanacearum’, the causal agent of potato zebra chip disease

‘Candidatus Liberibacter solanacearum’ was recently described as the causal agent of potato zebra chip disease. This pathogen occurs in North America, New Zealand, and Northern Europe on various crops, and may spread to other potato growing regions. Observation on ‘Ca. L. solanacearum’‐infected tomato and potato plants propagated in growth chambers over 5 years indicated that tomato plants (cvs Moneymaker and Roma) can be a latent carrier of ‘Ca. L. solanacearum’. Tomato plants graft‐inoculated with scions from latently infected tomato plants remained symptomless, but tested positive in a species specific PCR assay. ‘Ca. L. solanacearum’ was consistently detected in the top, middle and bottom portion of the symptomless tomato plants, including stem, petiole, midrib, vein, flowers and fruits. In tomato fruits, ‘Ca. L. solanacearum’ was evenly distributed in the tissues at the peduncle and style ends, as well as in the pericarp, and columella placenta tissues. This is the first report that ‘Ca. L. solanacearum’ is present in a plant reproductive organ. In contrast, potato plants (cvs. Jemseg, Atlantic, Shepody, Frontier Russet, Russet Burbank, Red Pontiac, and Russet Norkotah) grafted with scions from the same latently infected tomato plants resulted in typical symptoms of purple top, leaf scorch, and other disease symptoms in plants and brown discoloration in the vascular ring and medullary rays in tubers.

A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene

The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

Incidence and genetic stability of Potato spindle tuber pospiviroid in potato in Turkey

The prevalence of Potato spindle tuber pospiviroid (PSTVd) infection in randomly selected potato tubers was determined via nonisotopic dot blot hybridization and reverse transcriptase polymerase chain reaction (RT-PCR). In January and February of 2010, 168 seedling tubers of Solanum tuberosum, representing 27 cultivars, were received from different seedling potato producers in Turkey. Digoxigenin-labeled RNA probes of PSTVd were synthesized from the cloned PCR products and applied in dot blot hybridization to detect viroids in RNA extracts isolated from dormant potato tubers. PSTVd was found in 7 samples and 6 cultivars (Innovator, Lady Jo, Russet Burbank, Agria, Provento and Konsül). Some RNA samples, although positive by RT-PCR test, did not give a hybridization signal by dot blot assay. The complete genome of a selected isolate (PSTVd-TR) was cloned and sequenced. Primary and secondary structure analysis showed that the RNA genome of the PSTVd-TR isolate (GenBank Accession No. HQ456944) differed from other compared isolates by only a few nucleotides. The highest identity (99%) was in a PSTVd isolate that was identified in Solanum spp. in Italy (Accession No. EF459700). The infectivity of PSTVd-TR isolate was shown 2 weeks after the mechanical inoculation of sap extracts onto seedlings of tomato cultivar Joker. The PSTVd infections were proven by RT-PCR assay in symptomless tomato seedlings.

A New Selective Medium for Isolation of Clavibacter michiganensis subsp. michiganensis from Tomato Plants and Seed

A new selective and highly sensitive medium was developed for isolation of Clavibacter michiganensis subsp. michiganensis (Cmm), the causal agent of bacterial canker of tomato, from seed and latently infected plants. The new medium (BCT) proved to be superior to all published semiselective media for Cmm and is denoted as selective medium because of (i) its mean plating efficiency, amounting to ≤89% within 7 days for all 30 Cmm strains from different sources tested; (ii) the high selectivity, because accompanying bacterial species occurring on tomato plants and seed or bacteria obtained from culture collections were inhibited to an extent of 98 to 100%; and (iii) the remarkable detection sensitivity. Thus, 8 CFU of Cmm in field plant homogenates containing 12,750 CFU of accompanying saprophytes were detected on BCT. Under these extreme conditions, all of the published semiselective media (D2, KBT, D2ANX, SCM, mSCM, CMM1, mCNS, and EPPO) gave false-negative results. Either some media were rather toxic and Cmm growth was also inhibited or the other, less toxic media allowed growth of high numbers of saprophytes, so that Cmm growth was suppressed. Exclusively, BCT also supported growth of the closely related C. michiganensis subsp. insidiosus, nebraskensis, and tessellarius. The new medium is recommended for Cmm detection in tomato seed, and in symptomless tomato plantlets, to improve disease control of bacterial canker of tomato.

Detection of Tomato spotted wilt virus in Tomato in the Baja California Peninsula of Mexico

In 2005, serological screening by ELISA of 24 tomato (Solanum lycopersicon Mill.) plants with virus-like foliar symptoms (locally known as "marchitez manchada" [spotted wilt] disease) was done for a variety of RNA viruses: Tomato spotted wilt virus (TSWV; family Bunyaviridae, genus Tospovirus) was specifically detected. The symptomatic plants testing positive were from the most important tomato areas in San Quintin, in the north of Baja California. Symptoms characteristic of TSWV (4), including chlorosis, malformation of apical leaves, stunting, and ringspot lesions, were observed in this region and throughout the peninsula. In 2006, 42 symptomatic tomato plants from La Paz, in the south of Baja California, were analyzed for TSWV by double-antibody sandwich (DAS)-ELISA with a commercially available kit (TSWV ImmunoStrip Kit; Agdia Inc., Elkhart, IN). Total nucleic acids of the TSWV ELISA-positive samples (16 of 42 = 38%) were extracted and preserved on FTA cards (Whatman, Brentford, U.K.) and processed according to the manufacturer's protocol. The positive TSWV samples were verified by reverse transcription (RT)-PCR with primers specific to the TSWV nucleocapsid protein gene, 5'-ATGTCTAAGGTTAAGCTC-3' and 5'-TTAAGCAAGTTCTGTGAG-3' (2). Amplicons of the expected size (approximately 800 bp) were obtained from all 16 positive samples but not in the ELISA-negative samples. The spotted wilt disease was mechanically transmitted to tomato (cv. Rutgers) and Nicotiana glauca seedlings. Symptoms on leaves consisting of chlorotic ring patterns and necrotic lesions were observed in tomato, and slightly concentric chlorotic lesions were observed in N. glauca. All symptomatic plants from San Quintin and La Paz were positive for TSWV in the DAS-ELISA and RT-PCR tests and none were positive for the tobamoviruses, Tomato mosaic virus (ToMV) and Tobacco mosaic virus (TMV). TSWV was not detected in symptomless tomato plants used as negative controls. TSWV was detected in Mexico in tomatillo (Physalis ixocarpa), tobacco (Nicotiana tabacum), jimsonweed (Datura stramonium) (3), and recently, in tomato and pepper in the Central Plateau of Mexico (1). Although spotted wilt disease has been previously observed in San Quintin tomato-producing areas, to our knowledge, this is the first confirmation of TSWV in the Baja Peninsula. The role of weed hosts as a natural reservoir and the role of species of thrips in the epidemiology of the disease are currently unknown, although the incidence of the virus in these regions has risen to destructive levels in tomato.

Genetic Diversity of Fusarium oxysporum Populations Isolated from Tomato Plants in Tunisia

AbstractFusarium crown and root rot of tomato (Lycopersicon esculentum) caused by Fusarium oxysporum f. sp. radicis‐lycopersici is a new devastative disease of tomato greenhouse crops in Tunisia. Nothing is known neither about the population of this pathogen in this region, nor about the population of F. oxysporum f. sp. lycopersici the causal agent of Fusarium wilt of tomato. In order to examine the genetic relatedness among the F. oxysporum isolates by intergenic spacer restriction fragment length polymorphism (IGS‐RFLP) analysis and to elucidate the origin of the formae specialesradicis‐lycopersici in Tunisia by looking for genetic similarity of Tunisians isolates with isolates from a foreign source, the genetic diversity among F. oxysporum f. sp. radicis‐lycopersici and F. oxysporum f. sp. lycopersici populations was investigated. A total of 62 isolates of F. oxysporum, obtained from symptomless tomato plants, were characterized using IGS typing and pathogenicity tests on tomato plants. All Fusarium isolates were highly pathogenic on tomato. Fusarium oxysporum f. sp. radicis‐lycopersici isolates were separated into five IGS types. From the 53 F. oxysporum f. sp. radicis‐lycopersici isolates, 34 isolates have the same IGS types (IGS type 25), and the remaining 19 isolates were distributed into four IGS types. However, the only nine isolates of F. oxysporum f. sp. lycopersici have six different IGS types. This difference of diversity between the two formae speciales suggests that F. oxysporum f. sp. radicis‐lycopersici isolates have a foreign origin and may have been accidentally introduced into Tunisia.

Clavibacter michiganensis subsp. michiganensis

<i>Clavibacter michiganensis</i> subsp. <i>michiganensis</i>

Detection of Ralstonia solanacearum in Soil and Weeds from Commercial Tomato Fields Using Immunocapture and the Polymerase Chain Reaction

AbstractA detection assay for Ralstonia solanacearum in soil and weeds was developed by combining immunocapture and the polymerase chain reaction (IC‐PCR). Anti‐R. solanacearum polyclonal antibodies were produced in a white female rabbit and Dynal® super‐paramagnetic beads were coated with purified immunoglobulinG (IgG). Using IC‐PCR, the 718 bp target DNA was amplified at a detection threshold of approximately 104 colony‐forming units (CFU) bacteria per millilitre of suspension. DNA was not amplified in soil suspensions derived from autoclaved and non‐autoclaved soils, which contained R. solanacearum at 1–105 CFU/g soil. However, a positive PCR result was obtained when bacteria in the soil suspensions were first enriched in nutrient broth. IC‐PCR detected R. solanacearum in tomato stems 24 h after inoculation by stem puncture with a suspension containing approximately 105 CFU/ml. IC‐PCR detected the bacterium in 28 of 55 (51%) weeds and 10 of 32 (31%) soil samples. Of the weeds, Physalis minima, Amaranthus spinosus and Euphorbia hirta had the highest incidence of infection. R. solanacearum was not detected in soil taken from fallow fields, but it was discovered in some weed species. Symptomless tomato and pepper plants collected from the fields in which tomato bacterial wilt had previously occurred were found to contain R. solanacearum. These discoveries suggest that weeds and latent hosts may play a role in the survival of R. solanacearum between cropping cycles.

First Report of Tomato Yellow Leaf Curl Geminivirus in Morocco.

In July 1998, shortened internodes, reduced leaf size, leaf curling, and bushy plants were observed in tomato crops in the coastal region near Casablanca, Morocco. The symptoms were similar to those described for tomato yellow leaf curl virus (TYLCV) disease. During September, the disease was present in more than 130 ha of outdoor and protected crops. Economic losses ranged between 20 and 100%. Similar symptoms were observed in tomato crops in the northeastern region of Morocco. During the same period, high populations of Bemisia tabaci (Gennadius) were observed on tomato, sweet pepper, and several weeds, including Sonchus oleraceus L., Chenopodium sp., Malva parviflora L., and Datura stramonium L. Attempts to control whiteflies with insecticides generally were unsuccessful. Using a pair of degenerate primers (3) that are expected to amplify a region of the A component of begomoviruses between the intergenic conserved nonanucleotide sequence and the first 5' quarter of the capsid protein gene, an expected size product of 500 bp was obtained from six tomato leaf samples collected near Casablanca: four were obtained from symptomatic plants and two from apparently symptomless plants. A product of the same size was obtained from a sample of tomato infected with a TYLCV isolate from Reunion Island, France (2), but not from a sample from symptomless tomato plants from Reunion. The polymerase chain reaction (PCR) product obtained from one symptomatic sample from Morocco was cloned and sequenced (2). The resulting sequence (EMBL no. AJ133491) was at least 95.2% identical to sequences of TYLCV isolates from the Dominican Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Israel (EMBL no. X15656; EMBL no. X76319 for the mild clone), Spain (EMBL no. AF071228), and Reunion (EMBL no. AJ010790). Based on sequence comparisons, the tomato leaf sample was infected by a geminivirus isolate belonging to the Israeli species of TYLCV and was most closely related to the Dominican Republic isolate (98.4% nucleotide identity). In symptomless plants from which a 500-bp PCR product was obtained, infection may have been in an early stage. This is consistent with the fact that in the 2-ha field from which tomato samples were collected, only 4% of the plants exhibited TYLCV symptoms at the time of collection, whereas at least 70% of plants showed symptoms later, requiring the farmer to abandon the crop. The presence of the Eastern Mediterranean TYLCV species in a Western Mediterranean country is not a new observation; this virus has been described in Spain and Portugal (1). In Morocco, TYLCV symptoms were observed during the 1996 to 1997 growing season, following importation of grafted tomato plants from the Netherlands, by a farmer from the Casablanca region.

Response of tolerant breeding lines of tomato, Lycopersicon esculentum, originating from three different sources (L. peruvianum, L. pimpinellifolium and L. chilense) to early controlled inoculation by tomato yellow leaf curl virus (TYLCV)

AbstractSelection of tomato plants supposedly tolerant to tomato yellow leaf curl virus (TYLCV), based solely on the absence of symptoms in an infested field can be misleading. An inoculation routine was therefore established to avoid escapes and to overcome difficulties associated with the age of the plant at the time of infection. The inoculation routine was applied to a selection of resistant/tolerant individuals generated through a diallel F1 cross and to F2 segregating populations originating from three wild tomato species described as tolerant to TYLCV: Lycopersicon peruvianum EC 104395, Lycopersicon pimpinellifolium Hirsute and Lycopersicon chilense LA 1969. Clear differences were observed between susceptible symptomatic and tolerant symptomless tomato genotypes, indicating that the uncertainty resulting from escapes, from different levels of inoculum, and from the time of inoculation, can be eliminated. The genes involved in tolerance provided different levels of protection; combinations of various tolerant sources and levels in a single genotype gave a higher level of tolerance. Differences in level of protection were found between genes from the same source and between sources; none of the sources tested had complete dominance. The results obtained with the F2 segregating population showed that tolerance from L. pimpinellifolium is controlled by one major gene, that from L. chilense by two genes, and that from L. peruvianum by three genes with no dominant effect. The combination of sources for resistance can thus have positive or negative synergistic effects, or no effect. We suggest that a maximal level of tolerance can be obtained by the additive effect of the partly dominant genes from L. pimpinellifolium and L. chilense.

A New Geminivirus Associated with a Leaf Curl Disease of Tomato in Tanzania.

Leaf samples of tomato exhibiting yellow mottle, severe leaf curl, stunting, and upright stems were collected from Makutupora, Tanzania, in October 1994 by L. L. Black (AVRDC). Leaf tissue squashes on nylon membranes did not hybridize with DNA-A probes from tomato yellow leaf curl geminiviruses (TYLCVs) from Thailand (Thai) or Egypt (EG), an isolate of TYLCV-Isr (Israel). Polymerase chain reaction (PCR) with primer pair PAC1v1978/PAV1c715 (2), which specifically amplifies part of the rep (AC1) open reading frame (ORF), the intergenic region, and the cp (AV1) ORF of whitefly-transmitted geminiviruses, yielded a 1.5-kb fragment from a DNA extract of symptomatic tomato leaves. No virus-specific fragments were amplified from symptomless tomato leaves. The nucleotide sequence (GenBank accession no. U73478) of the PCR fragment (recombinant plasmid pAF1) was compared with the sequences of seven distinct subgroup III geminiviruses that infect tomato (1)-TYLCV-Isr, TYLCV-Sar (Sardinia), TYLCV-Thai, tomato leaf curl virus (TLCV)-;Aus (Australia), IndTLCV (India), TLCV-Ind (Bangalore I), and TLCV-Tai (Taiwan)-as well as three other subgroup III geminiviruses from the Old World: Indian cassava mosaic virus, African cassava mosaic virus, and mung bean yellow mosaic virus. Nucleotide sequence identities for the pairwise comparisons of the rep ORF (692 nucleotides) and the intergenic region (169 nucleotides) of this Tanzanian geminivirus with those of the 10 Old World geminiviruses showed low nucleotide identities, which were <79% for the rep ORF and <67% for the intergenic region. Since isolates of the same geminivirus usually have nucleotide sequence identities >90% (1), this Tanzanian geminivirus is considered to be different from all previously characterized Old World geminiviruses and is given the name TLCV-Tan. Further, tissue squash blots of samples previously collected from other areas in Tanzania gave strong positive reactions with the TYLCV-EG probe, so yet another geminivirus closely related to TYLCV-Isr may be present.

Use of ELISA for detection of Clavibacter michiganensis subsp. michiganensis in tomato 1

A DAS‐ELISA method has been developed to detect the causal agent of bacterial canker of tomato, Clavibacter michiganensis subsp. michiganensis. The high sensitivity of the test can be attributed to antibodies which are produced against soluble antigens (extracellular products). The most suitable part of the tomato plant for reliable detection of the bacterium is the lower stem region. It is possible to differentiate heavy and weak symptom expressions by ELISA. The ELISA procedure also allows detection of C.m. michiganensis in symptomless tomato plants. Furthermore, the bacterium has been detected in tomato seeds harvested from infected plants.

Alternative hosts and the epidemiology of potato leafroll virus in Queensland.

Potato leafroll virus (PLRV) was the most frequently detected virus in potato crops grown at a trial site in the Lockyer Valley. Queensland. Levels of infection with PLRV were significantly higher in autumn crops grown from one-off certified (saved) seed (maximum 51%) than in crops grown directly from certified seed (maximum 6%). Potato viruses S and X were very uncommon (maximum incidence each of 1%) and potato virus Y was not detected in these crops. Tomato, Nicandra physalodes and Physalis sp. were identified as field hosts of PLRV in Queensland and, additionally, Stachys aruensis (Labiatae), Nicotiana benthamiana, Nicotiana tabacum and Solanum americanum (Solanaceae) were shown to be experimental hosts. In field trials in the Lockyer Valley and the Redlands district, PLRV was detected in 45-65% of symptomless tomato plants growing within 300 m of the nearest source of PLRV-infected potatoes. Virus levels were lower in the leaves of potato cv. Pontiac than in those of cvv. Bison and Sebago 5 weeks after primary (aphid-borne) infection, but these differences were no longer apparent after 11 weeks. Four weeks after emergence, virus levels in cv. Bison were markedly higher than in cvv. Pontiac and Sebago in plants with secondary (tuber-borne) infection. After 9 weeks, virus levels in all cultivars were similar and were greater in lower than in upper leaves.