Symptomatic Plants Research Articles

First Report of Fusarium Wilt on lily (Lilium 'Tresor') Caused by Fusarium armeniacum in Jiangsu Province, China.

In June 2021, a disease of stem and leaf rot was observed on lily cultivar 'Tresor' with approximately 20% disease incidence in fields at Huaiyin District (119°04'N, 33°63'E) of Huaian County, Jiangsu Province. The roots and bulbs of symptomatic plants were brown and rotten, with sunken lesions. Symptomatic plants showed short, discolored leaves, and eventually lead to stem wilt and death of the whole plants (Fig. 1A and Fig. 3C). To isolate the pathogen, necrotized plant tissues were surface sterilized with 2% sodium hypochlorite for 2 min followed by 70% ethanol for 30 s and rinsed with sterile water. About 4 mm × 4 mm of diseased tissues were placed on potato dextrose agar (PDA) followed by incubation at 25°C in the dark for 5 days. The pure cultures were obtained by the hyphal-tip method. A total of four fungal isolates with similar colony characteristics were recovered. To determine the identity of the four isolated fungal isolates, genomic DNA was extracted using the method previously described (Khan et al. 2021), the sequences of the internal transcribed spacer (ITS), the translation elongation factor 1α (TEF1) and the RNA polymerase II beta subunit (RPB2) genes were analyzed with primers ITS1/ITS4 (White et al. 1990), EF1/ EF2 (O'Donnell et al. 1998), and 5F2/7cR (Reeb et al. 2004), respectively. The three gene sequences of four isolates showed 99.9 %-100% identities. The531 bp (ITS), 699 bp (TEF1), and 900 bp (RPB2) sequences of a representative isolate (JH-37) were deposited in GenBank with acce. nos. OR195729, OR195041 and OR195040, respectively. A phylogenetic tree was constructed using the concatenated three gene sequences of JH-37 and that of the related Fusarium species based on Maximum Likelihood (Fig.2). JH-37 was grouped together with the F. armeniacum strain CBS 485.94 (AB587001, GQ915501, GQ915485), and shared 99.9 % concatenated sequence identity. The three gene sequences of the strain JH-37 shared 100%, 99.85%, 99.89% identity to F. armeniacum strain CBS 485.94 using MEGA 7 software (Kuma et al. 2016) analysis, and with 94%, 95% and 100% coverage by BLAST analysis. The colony of JH-37 on PDA at 25°C for 5 days was white with yellow-brown pigmentation in the center (Fig. 1B-C). From 10-day-old cultures grown on Spezieller Nahrstoffarmer agar (SNA), macroconidia (n = 50) were falcate, slender, curved dorsiventrally, tapering towards both ends, 3 to 4 septate, and measured 24.2 to 50.0 × 2.6 to 4.2 μm. The microconidia (n = 50) were straight or slightly curved, septate 0 to 2, and measured 6.8 to 20.0× 2.1 to 3.7 μm (Fig.1D-F). These morphological characteristics were consistent with Fusarium spp. (Leslie and Summerell 2006). A pathogenicity test of JH-37 was performed on potted lily ('Tresor') under greenhouse conditions. Healthy lily bulbs were selected and one bulb was sown in soil of each pot. Inoculation was performed 60 days after sowing. Bulbs of the lily plants were wounded with needles and inoculated with 5 mL of conidia suspension (1×107 conidia/mL) in the soil around bulb or an equal amount of sterilized water as a control. This experiment had three replicates. After 15 days of inoculation, typical symptoms of bulb rotten, and leaf wilt, similar to the original field symptoms, appeared on the inoculated plants but not on the controls (Fig.3). The same fungus was reisolated from the diseased plants, as identified based on morphology and molecular evidence, which confirmed the Koch's postulate. To our knowledge, this is the first report that F. armeniacum caused Fusarium wilt on Lilium spp. in China. Further, our result could help to develop effective disease management strategies against lily wilt disease.

First Report of Leaf Blight of Camellia japonica Caused by Diaporthe fukushii in Tennessee and the United States.

Japanese camellia (Camellia japonica), is an important ornamental species that has an increasing economic value in China, Japan, Australia and the USA (Vela et al. 2013). Leaf blight symptoms were observed on 20-year-old C. japonica 'April Tryst' leaves collected from a research plot in McMinnville, TN in March 2022. Leaf blight first appeared in the leaf tips and was irregular in shape (2 to 3 cm in diameter). Affected areas displayed gray color discoloration with a deep black margin and gradually expanded in size along the leaf margin, eventually causing leaf death and defoliation. Dark brown globose to subglobose conidiomata (pycnidia) were observed abundantly on the infected leaves (Fig. 1a). Disease severity was 25 to 50% of leaf area and incidence was 10% out of 60 plants. Three leaves were collected from each symptomatic plant and the surface disinfected with 10% NaOCl for 60 s, washed thrice with distilled water, and plated on potato dextrose agar (PDA). Colony growth of the isolates FBG4744 and FBG6184 on PDA, 15 days after incubation at 25°C (light/dark: 12/12h) were white to pale grey with dense and felted mycelium with concentric zonation. Spherical black pycnidia were observed on the concentric rings 2-3 weeks after incubation. Alpha conidia were on average 7.15 × 4.82 µm (4.89 to 9.37 µm × 2.91 to 6.74 µm) in size and were aseptate, hyaline, smooth, and ellipsoidal (n=50). Beta conidia were not observed. Pathogen identity was confirmed by extracting total DNA using the DNeasy PowerLyzer Microbial Kit from 7-day-old cultures. Primer pairs ITS1/ITS4 (White et al. 1990), T1/T222 and EF1/EF2 (Stefańczyk et al. 2016) were used to amplify and sequence the ribosomal internal transcribed spacer (ITS), beta-tubulin (BT), and translation elongation factors 1-α (EF1-α) genetic markers, respectively. The sequences (GenBank accession nos. OR607729, ITS; OR608485, BT; OR608487, EF1-α) were 100% similar to Diaporthe fukushii (=Phomopsis fukushii) in the NCBI nr/nt database (JQ807450: ITS; MG812590: BT, and MG281573: EF1-α). A phylogenetic analysis was performed using concatenated sequences of ITS, BT, and EF1-α of D. fukushii and other closely related taxa retrieved from GenBank (Fig. 2). Pathogenicity tests were performed on 1-year-old 10 healthy potted plants of C. japonica 'April Tryst' per isolate (Mathew et al. 2015; Yang et al. 2019). One leaf per plant was wounded with a sterilized 0.2-mm needle. PDA plugs (5 mm) taken from 7-day old cultures of FBG4744 and FBG6184 isolates were deposited on the wounded leaves and covered with moist cotton (Yang et al. 2019; Zhao et al. 2020). Ten additional plants were used as control and sterile PDA plugs were placed on the wounded leaves. Plants were covered with clear plastic bags and kept inside a greenhouse at 21 to 23°C, 70% RH, 16 h photoperiod. All inoculated leaves exhibited blight symptoms 14 days after inoculation (Fig. 1b) while control plants remained asymptomatic (Fig. 1c). The pathogen was reisolated from all the inoculated leaves and was confirmed as D. fukushii using morphological and molecular tools. Diaporthe species (D. tulliensis, D. passiflorae and D. perseae) have been previously reported to cause leaf spot on Camellia sinensis in Taiwan (Ariyawansa et al. 2021), but to our knowledge, this is the first report of leaf blight of C. japonica caused by Diaporthe fukushii in Tennessee and the United States. Identification of this novel disease is important in developing necessary management approaches.

Use of ginger extract and bacterial inoculants for the suppression of Alternaria solani causing early blight disease in Tomato

Early blight (EB), caused by Alternaria solani, is a serious problem in tomato production. Plant growth-promoting rhizobacteria promote plant growth and inhibit plant disease. The present study explored the bio-efficacy of synergistic effect of rhizobacterial isolates and ginger powder extract (GPE) against tomato EB disease, singly and in combination. Six fungal isolates from symptomatic tomato plants were identified as A. solani on the basis of morphological features i.e., horizontal septation (6.96 to 7.93 µm), vertical septation (1.50 to 2.22 µm), conidia length (174.2 to 187.6 µm), conidial width (14.09 to 16.52 µm), beak length (93.06 to 102.26 µm), and sporulation. Five of the twenty-three bacterial isolates recovered from tomato rhizosphere soil were nonpathogenic to tomato seedlings and were compatible with each other and with GPE. Out of five isolates tested individually, three isolates (St-149D, Hyd-13Z, and Gb-T23) showed maximum inhibition (56.3%, 48.3%, and 42.0% respectively) against mycelial growth of A. solani. Among combinations, St-149D + GPE had the highest mycelial growth inhibition (76.9%) over the untreated control. Bacterial strains molecularly characterized as Pseudomonas putida, Bacillus subtilis, and Bacillus cereus and were further tested in pot trials through seed bacterization for disease control. Seeds treated with bacterial consortia + GPE had the highest disease suppression percentage (78.1%), followed by St-149D + GPE (72.2%) and Hyd-13Z + GPE (67.5%). Maximum seed germination was obtained in the bacterial consortia + GPE (95.0 ± 2.04) followed by St-149D + GPE (92.5 ± 1.44) and Hyd-13Z + GPE (90.0 ± 2.04) over control (73.8 ± 2.39) and chemical control as standard treatment (90.0 ± 2). Ginger powder extracts also induce the activation of defence-related enzymes (TPC, PO, PPO, PAL, and CAT) activity in tomato plants. These were highly significant in the testing bacterial inoculants against A. solani infection in tomato crops.

Incidence and Severity of Vine Rot and Wilt Disease of Telfairia occidentalis Caused by Athelia rolfii in Southern, Nigeria

Telfairia occidentalis is an important vegetable crop that is intensively grown in Southern Nigeria for its utilization in home dishes and commercialization. However, its production is being limited by vine rot infection caused by Athelia rolfsii. Information on the epidemiology in growing regions is important for the disease management. Hence, this study was conducted to investigate the incidence and severity of vine rot disease of Telfairia occidentalis in commercial fields across Abak, Akwa Ibom State. A total of nine established T. occidentalis fields in three locations, including the Cross River Basin Development Authority, Abak-Irrigation Project, were visited during the peak of dry season (November – December), 2021 and raining season (June - August), 2022 respectively. The fields were scored for vine rot disease incidence and severity using a well described scale. Random samples from symptomatic plants were collected and taken to the laboratory for fungi isolation and identification. Koch postulate was carried out to confirm the causal agents on one susceptible genotype of T. occidentalis in the study area. Overall number of plants showing varying levels of symptoms reaches 84% and total values for mean incidences’ rate (3.31 ± 0.06 and 3.19 ± 0.06) were recorded for both sampling period respectively. The result of this study revealed that the prevalent fungal pathogen that is responsible for vine rot and wilt disease of T. occidentalis in the study is A. rolfsii and presented information on the level and severity of infection that is indicative of the need to implement appropriate control measures for A. rolfsii disease in the study area.

First Report of Melon Chlorotic Spot Virus in Cultivated Sorrel (Rumex acetosa) in Belgium

In 2020, symptoms of putative viral origin were observed on 7% of tomatoes in an organic vegetable farm in Belgium (deformed uneven ripened fruits, vein clearing, mosaic and purple leaves, stunted plants). The leaves of twenty symptomatic plants were collected, pooled and screened for viruses using high throughput sequencing technologies (HTS) on Illumina NextSeq500 following a virion-associated nucleic acid (VANA) protocol (Temple et al., 2021, Be_SL1). In total, 3,665,498 reads (PE150) were generated. Bioinformatic analyses (denovo assembly, tblastx search on NCBI and mapping) using Geneious Prime® 2020.1.2 revealed the presence of three viruses known to infect tomatoes: Physostegia chlorotic mottle virus (PhCMoV), 547,142 reads map on NC_055466, potato virus Y (PVY), 4056 reads map on MW595184, and melon chlorotic spot virus (MeCSV), 55 reads mapped to six out of the eight different MeCSV segments (NC_040448-55). Tomato plants have already been artificially inoculated by MeCSV (Lecoq et al., 2019) but this detection (confirmed by independent RT-PCR on the pooled sample) is the first one in natural condition on farm. The high prevalence of symptoms triggered the research of alternative perennial hosts that can serve as a reservoir during inter-cropping season. One plant of Rumex acetosa showing vein clearing (CT-122) was collected in the same greenhouse the year after. Total RNA was extracted, followed by ribodepletion, and Illumina HTS using the protocol described in Temple et al., (2021) for Be_GP1. In total, 4,549,721 PE150 reads were obtained and bioinformatic analyses confirmed the presence of MeCSV (8,816 reads mapped on eight RNA segments NC_040448-55 with an average 96,52% coverage of the reference sequences, supplementary table 1) and suggested the presence of an unclassified partitivirus. Consensus sequences were extracted for each segment of MeCSV (OQ818038-45) and showed between 83% and 87% of nucleotide identity with the reference sequences NC_040448-55. RNA1 segment was used to design MeCSV-specific RT-PCR primers for detection (MeCSV-125F 5’-TTTAAGGCCAGATCCAGAGGTTC-3’/ MeCSV-498R 5’-TGGATGTGACAACCTGGTAGTAC-3’). Thereafter, in July 2022, 42 R. acetosa plants were collected in the same greenhouse. Among them, seven plants showed vein clearing, two showed yellowing with necrosis, two exhibited yellowing and vein clearing (Supplementary figure 1), and one showed mosaic. The 42 plants were subjected to RNA extraction and RT-PCR for MeCSV (Supplementary figure 2) and PhCMoV detection. MeCSV was detected in 13 plants (two asymptomatic plants and all the symptomatic plants except the one exhibiting mosaic where PhCMoV was detected). PhCMoV was also detected in three plants with vein clearing, one with yellowing and one of the two asymptomatic plants infected by MeCSV. Our results report the first detection of MeCSV in R. acetosa and the first detection of MeCSV in Belgium. In addition, according to the hierarchical approach for assessing causal relationships in plant virology (Fox et al., 2020), a preliminary association was observed between symptoms and MeCSV detection [6% prevalence on asymptomatic plants and 92% prevalence on diseased plants (from which seven symptomatic samples were not co-infected by PhCMoV)]. Symptom causality should be further investigated but this results are important for disease management because they suggested that cultivated perennial R. acetosa may serve as a reservoir for two emergent plant viruses (PhCMoV and MeCSV) (Lecoq et al., 2019, Temple et al., 2021).

Metatranscriptome analysis of symptomatic bitter apple plants revealed mixed viral infections with a putative novel polerovirus

BackgroundNext-generation Sequencing (NGS) combined with bioinformatic analyses constitutes a powerful approach for identifying and characterizing previously unknown viral genomes. In this study, leaf samples from bitter apple plants (Citrullus colocynthis (L.) Schrad) exhibiting symptoms such as dwarfing, leaf crinkling, and chlorosis were collected from the southern part of Kerman province, Iran.ResultsPutative infecting viruses were identified through de novo assembly of sequencing reads using various tools, followed by BLAST analysis. Complete genomes for Squash vein yellowing virus (SqVYV), Citrus-associated rhabdovirus (CiaRV), and a novel polerovirus-related strain termed Bitter apple aphid-borne yellows virus (BaABYV) were assembled and characterized. Additionally, a partial genome for Watermelon mosaic virus (WMV) was assembled. The genomic organization of the BaABYV was determined to be 5’-ORF0-ORF1-ORF1,2-ORF3a-ORF3-ORF3,5-ORF4-3’. Amino acid sequence identities for inferred proteins (P0 and P1, P1,2) with known poleroviruses were found to be the 90% species delineation limit, implying that BaABYV should be considered a new member of the genus Polerovirus. Recombination events were observed in the BaABYV and WMV strains; such events were not found in the CiaRV strain.ConclusionsMolecular evidence from this study suggests that C. colocynthis is a reservoir host of several plant viruses. Among them, BaABYV is proposed as a new member of the genus Polerovirus. Furthermore, the CiaRV strain has been reported for the first time from Iran.

Influence of ‘Candidatus Liberibacter solanacearum’ infection on carrot root weight in Germany

Infection with the bacterium ‘Candidatus Liberibacter solanacearum’ (Lso) is suspected to cause severe damage in carrot leading to high carrot weight loss. This study investigates three main aspects: (i) whether there is a reduction of carrot root weight under field conditions due to Lso infection; (ii) the correlation between Lso infection rate in carrot plants and occurrence of the psyllid Trioza apicalis as the known vector for Lso in carrot, and (iii) the comparison between symptoms described in literature and observed symptoms associated with Lso infection. Therefore, field surveys were conducted from 2018 to 2021 on organically managed carrot fields in Lower Saxony, Germany. Two Rebell orange sticky traps were placed per field replaced on a weekly basis. Captured T. apicalis were morphologically identified and counted. Carrot plant samples were collected from T. apicalis infested fields. Discolouration of foliage and further symptoms on carrots were investigated. For detection of Lso in carrot plants and psyllids, the samples were analysed using PCR. The infection rate of carrot plants varied between 2.5% and 80% per field with low abundance of T. apicalis. Of the asymptomatic plants, 39.4% were infected with Lso, while 80.9% of the symptomatic plants were infected with Lso. The weight of Lso-positive carrot samples was not significantly reduced compared to Lso-negative samples. No economically relevant losses of carrot yield were reported by farmers participating in this study. This indicates that there was no effect of Lso infection on carrot root weight during this study. Of the symptoms associated with a Lso infection in carrots, only leaf discolouration could be confirmed. Overall, the bacterium is present in organically grown carrot plants in Lower Saxony but no major carrot root weight losses were observed.

An Agent-Based Model Shows How Mixed Infections Drive Multiyear Pathotype Dynamics in a Plant-Virus System.

Mathematical models are widely used to understand the evolution and epidemiology of plant pathogens under a variety of scenarios. Here, we used this approach to analyze the effects of different traits intrinsic and extrinsic to plant-virus interactions on the dynamics of virus pathotypes in genetically heterogeneous plant-virus systems. For this, we propose an agent-based epidemiological model that includes epidemiologically significant pathogen life-history traits related to virulence, transmission, and survival in the environment and allows for integrating long- and short-distance transmission, primary and secondary infections, and within-host pathogen competition in mixed infections. The study focuses on the tobamovirus-pepper pathosystem. Model simulations allowed us to integrate pleiotropic effects of resistance-breaking mutations on different virus life-history traits into the net costs of resistance breaking, allowing for predictions on multiyear pathotype dynamics. We also explored the effects of two control measures, the use of host resistance and roguing of symptomatic plants, that modify epidemiological attributes of the pathogens to understand how their populations will respond to evolutionary pressures. One major conclusion points to the importance of pathogen competition within mixed-infected hosts as a component of the overall fitness of each pathogen that, thus, drives their multiyear dynamics.

Unveiling the microbiome of hydroponically cultivated lettuce: impact of Phytophthora cryptogea infection on plant-associated microorganisms.

Understanding the complex interactions between plants and their associated microorganisms is crucial for optimizing plant health and productivity. While microbiomes of soil-bound cultivated crops are extensively studied, microbiomes of hydroponically cultivated crops have received limited attention. To address this knowledge gap, we investigated the rhizosphere and root endosphere of hydroponically cultivated lettuce. Additionally, we sought to explore the potential impact of the oomycete pathogen Phytophthora cryptogea on these microbiomes. Root samples were collected from symptomatic and nonsymptomatic plants in three different greenhouses. Amplicon sequencing of the bacterial 16S rRNA gene revealed significant alterations in the bacterial community upon P. cryptogea infection, particularly in the rhizosphere. Permutational multivariate analysis of variance (perMANOVA) revealed significant differences in microbial communities between plants from the three greenhouses, and between symptomatic and nonsymptomatic plants. Further analysis uncovered differentially abundant zero-radius operational taxonomic units (zOTUs) between symptomatic and nonsymptomatic plants. Interestingly, members of Pseudomonas and Flavobacterium were positively associated with symptomatic plants. Overall, this study provides valuable insights into the microbiome of hydroponically cultivated plants and highlights the influence of pathogen invasion on plant-associated microbial communities. Further research is required to elucidate the potential role of Pseudomonas and Flavobacterium spp. in controlling P. cryptogea infections within hydroponically cultivated lettuce greenhouses.

Genetic characterization of historic Norwegian Erwinia amylovora isolates by SSR-genotyping

AbstractErwinia amylovora, the causative agent of fire blight of pome fruits and other rosaceous plants belongs to the group of regulated quarantine pests. The aim of this work was to characterize the populations of E. amylovora in Norway and their geographical distribution. A total of 238 E. amylovora isolates recovered from symptomatic host plants in Norway between 1986 and 2004 were genotyped by means of a short sequence repeat (SSR) marker (ATTACAGA) on plasmid pEa29. The SSR region was amplified and amplicon size determined using fluorescent labelling and rapid, automated capillary gel electrophoresis. All isolates contained the pEa29 plasmid harbouring the investigated marker. In total, ten genotypes were identified, of which two were detected only once. The number of repeats varied from 3 to 13, with 43% of the isolates containing five repeats. Of 17 isolates collected between 1986 and 1991, all but one contained five repeats, whereas more variation was observed in isolates from the period 2000 to 2004. Most of the isolates (80%) originated from Cotoneaster bullatus, hence no relationship between genotype of the isolate and host species that it was isolated from could be detected. This historic data suggests multiple introductions of E. amylovora to Norway.

Characterization and Pathogenicity of Fungal Species Associated with Dieback of Apple Trees in Northern Italy.

Severe dieback symptoms were recently observed on apple (Malus × domestica) trees in Northern Italy, representing a growing concern for producers. Surveys were conducted over a 3-year period (2019 to 2021), and five apple orchards, from 5 to 12 years old, were monitored. A total of 33 fungal isolates isolated from symptomatic plants was selected for characterization. The species identification was achieved through multilocus phylogenetic analyses performed on sequences of three genomic loci (ITS, tub2, and tef1). Morphological features were assessed, and the average growth rate at different temperatures was determined. Seven species were identified in association with dieback of apple trees: Botryosphaeria dothidea, Cadophora luteo-olivacea, Diaporthe rudis, Diplodia seriata, Eutypa lata, Kalmusia longispora, and Paraconiothyrium brasiliense. All the species were pathogenic when inoculated on healthy apple plants. B. dothidea resulted in the most aggressive infections. This study provides an insight into the fungal species diversity associated with apple dieback and provides basis for further investigations to assess the phytosanitary status of plant materials to recommend and implement effective management strategies.

First Report of Charcoal Rot Caused by Macrophomina phaseolina on Dry Bean (Phaseolus vulgaris L.) in Western Canada.

In 2021, several dry bean (Phaseolus vulgaris L.) plants at the mid-seed-fill growth stage displaying wilting, chlorosis of the leaves and reduced vigor were collected near the Pembina - Emerson Border of Manitoba, Canada and North Dakota, USA. When symptomatic plants were examined, gray to dark brown discoloration was observed on the lower stem and the roots. Afterwards, brown to black discoloration was noticed on stem and root sections. Root and lower stem pieces (1 to 2 cm) from affected plants were surface sterilized with 70 % ethanol, followed by 1% NaOCl, rinsed twice in sterilized water, air dried on sterilized filter papers, and placed on potato dextrose agar (PDA) amended with 1 mg/mL of streptomycin sulfate. The PDA plates were incubated at 28°C with 12 h light/12 h dark for 10 days. The growing hyphae were transferred using the hyphal tip method to new PDA plates. Growing cultures were initially hyaline and turned from light gray to dark brown or black with age. Abundant dark and spherical to oblong shaped sclerotia with an average diameter of 97.9 µm (range: 66.8 to 143.5 µm, n =30) formed on the pure cultures 7 days after incubation. Additional pure culture was obtained through an isolation of a single microsclerotium followed by a single hyphal tip transfer. One isolate was identified as Macrophomina phaseolina based on morphological characteristics (Smith and Wyllie 1999). The morphological identity was confirmed by sequencing the rDNA internal transcribed spacer (ITS) region with universal primers ITS1/ITS4 (White et al. 1990) and calmodulin (CAL) and translation elongation factor-1 alpha (TEF-1α) genes with MpTefF/MpTefR, and MpCalF/MpCalR primer sets (Santos et al. 2020), respectively. The online resource Basic Local Alignment Search Tool (BLAST; https://www.ncbi.nlm.nih.gov/BLAST) confirmed the fungus identity as 100% M. phaseolina. The sequences of the original isolate BF21-25 were deposited in GenBank with accession numbers OQ615297 (ITS), OR357630 (CAL), and OR363106 (TEF-1α). To confirm pathogenicity, bioassays were conducted under controlled conditions. Four seeds of cultivar 'Etna' were sown per pot, and five pots were used for inoculated (approx. 4 × 105 microsclerotia/pot) and control (mock-inoculated with sterile PDA medium) treatments. For the inoculum, 20 g of macerated 10 to 14-day old M. phaseolina culture grown on PDA medium was applied to each pot using an inoculum layering technique. Pots were kept in the greenhouse with 28/17°C day/night, 13 h light/11 h dark cycle, and 70% relative humidity and watered weekly. Disease symptoms similar to those observed in the field were visible on all inoculated plants at the mid-seed-fill growth stage. Mock-inoculated control plants didn't show any symptoms. The experiment was repeated twice with similar results. The pathogen was re-isolated from infected plants to confirm Koch's postulates and identified as M. phaseolina based on the morphology and sequences of ITS, CAL and TEF-1α regions. To our knowledge, this is the first report of charcoal rot caused by M. phaseolina on dry bean in Western Canada.

First Report of Lily Virus X Infecting Paris polyphylla var. yunnanensis in Yunnan, China

Lily virus X (LVX) is a positive-sense ssRNA virus belonging to the genus Potexvirus in the family Alphaflexiviridae. LVX is known to infect plants of the genera Lilium and Tricyrtis in the family Liliacea. LVX was first reported in an asymptomatic lily (Lilium formosanum) from England (Stone, 1980), but has been shown to infect plants in the Netherlands (Chen et al. 2005), the United States (Jordan et al. 2008) and Japan (Nijo et al. 2018). To date, the complete genomes of two LVX isolates from the Netherlands and Japan have been reported. Paris polyphylla var. yunnanensis, known as Dianchonglou in China, is a perennial plant of the family Melanthiaceae (formerly belonging to the family Trillium). In China, its rhizome is commonly used as an antispasmodic agent for stroke and cancer treatment (Chang et al. 2017). From 2019 to 2022, leaf mottle and shrinkage which are typical symptoms of viral infections were observed on the leaves of P. polyphylla var. yunnanensis plants in Dianchonglou fields in Qujing, Yunnan. Disease incidence ranged from 19% to 45% across 5 fields (90 plants per field) in Qujing. To identify the possible viral pathogen(s) associated with the disease, the mirVanaTM miRNA isolation Kit was used to extract total RNA was from a mixed sample pool of 5 symptomatic leaf samples collected from the 5 fields. RNA sequencing library was constructed using TruSeqTM RNA sample preparation kit. Sequencing on the Illumina HiSeqTM 2500 platform (Illumina, USA) with 125-bp paired-end reads yielded 23,077,786 raw reads. 22,534,100 clean reads were obtained by removing reads of low quality and poly-N using Trimmomatic software (Bolger et al. 2014). By utilizing the paired-end splicing method in Trinity software (Grabherr et al. 2011) the the raw reads were De novo assembled into 184,596 contigs, of which 303 were related to viruses, including Paris mosaic necrosis virus (PMNV), Pear alphapartitivirus (PAPV), Dahlia mosaic virus (DMV), and Lily virus X (LVX). BLASTn analysis revealed that 12 contigs (lengths ranging from 344 nt to 5,981 nt, query cover 6% to 99%) were most similar (57.32% to 91.67% nt identities) to the genome sequences of LVX, suggesting a possible infection of LVX in the plants. To confirm the result, a full-length genomic sequence of LVX was obtained by reverse transcription polymerase chain reaction (RT-PCR) using specific primers designed based on the sequence of the assembled contigs. The PCR products were cloned into pGEM-T vector (Promega Corporation, USA) and sequenced using the Sanger method (Sangon Biotech, Shanghai, China). The obtained full-length genomic sequence of the LVX isolate (LVX-PP, accession number OM100017) was 5,981 nt in length. BLASTp analysis demonstrated that the putative Rep and CP of LVX-PP shared 76.27% to 81.05% and 80.81% to 81.82% aa sequence similarities with that of other LVX isolates, respectively. Maximum-likelihood phylogenetic trees inferred from the Rep and CP aa sequences showed that LVX-PP clustered closely with LVX isolates. The leaf samples were further analyzed using a lily virus X (LVX) ELISA kit (DEIAPV181, Creative Diagnostics, U.S.A.). Healthy P. polyphylla var. yunnanensis leaves were taken as a negative control and buffer solution as a blank control. The results showed a positive reaction for all five symptomatic plants (OD = 1.259 ± 0.007) relative to the negative (OD = 0.099) and blank (OD = 0.073) controls. These results indicate that LVX can infect P. polyphylla var. yunnanensis. To our knowledge, this is the first report that LVX has been detected in P. polyphylla var. yunnannensis. This study will serve as an important reference for the study of the host range of LVX. Further studies will be required to determine how LVX spreads between P. polyphylla var. yunnannensis and other host plants.

First Report of ‘Candidatus Phytoplasma asteris’ (16SrI-B) Associated with Phyllody Disease of Moth Bean in World

Moth bean (Vigna aconitifolia), a drought and heat-resistant legume from the Fabaceae family, is commonly cultivated in arid and semi-arid regions of the Indian subcontinent In September 2022, phyllody symptoms (Figure 1) were observed on 50-days-old moth bean plants at the ICAR-NBPGR research farm in Jodhpur, Rajasthan, India. The disease incidence ranged from 10 to 25%. To investigate the cause, ten symptomatic VacoJod (1-10) and ten asymptomatic VacoJod (11-20) Vigna aconitifolia plants were collected. Insect populations were also collected from the vicinity using the sweep-net method to examine the role of insect vectors. The leafhopper was identified based on morphological characterization as Empoasca sp. at the Division of Entomology, ICAR-IARI, New Delhi. DNA was extracted from midribs of all collected plants and the Empoasca sp., using Qiagen DNeasy Plant Mini Kit and Blood and Tissue kit, respectively. Nested polymerase chain reaction (Nested-PCR) with universal primers P1/P7 and R16F2n/R16R2 (Deng and Hiruki, 1991; Gundersen and Lee, 1996), and secA gene primers (secAfor1/secArev3 and secAfor2/secArev3) (Hodgetts et al., 2008) were employed to determine phytoplasma species association. Out of the 10 symptomatic plants and 10 leafhopper samples, 6 leafhopper samples and all symptomatic plants produced expected band sizes for the 16S rRNA (approximately 1.25 kb) and secA gene (480 bp). The PCR products were cloned, sequenced, and sequences (two each from moth bean and leafhopper) were submitted to NCBI GenBank with accession numbers OP941130, OP941132, OP941133 and OP941134 for 16S rRNA and OP958868, OP958869, OP958870, and OP958871 for secA gene sequences. Nucleotide BLAST analysis of 16S rRNA sequences revealed a minimum of 99.92% similarity with 'Primula acaulis' yellows phytoplasma (KJ494340) from Czech Republic. All 100% hits corresponded to 16SrI-B group phytoplasmas, for example rapeseed phyllody phytoplasma (CP055264) from Taiwan. Similarly, nucleotide BLAST analysis of secA sequences revealed a minimum of 99.15% sequence similarity with Paulownia witches'-broom phytoplasma (secA) (OP124308) from China. All 100% hits were of 16SrI-B group phytoplasmas, for example Ageratum conyzoides yellowing phytoplasma (MW401697, secA) from India. Phylogenetic analysis using MEGA11 (Tamura et al., 2021) clustered the moth bean and Empoasca sp. phytoplasma strains with 16SrI-B phytoplasma reference strains. iPhyClassifier tool classified the 16S rRNA gene sequences into 16Sr group I, subgroup B, with a similarity coefficient of 1.0 (Figure 2a, 2b). This marks the first report of the association of 'Ca. P. asteris' 16SrI-B related phytoplasma strain with moth bean plants globally. The 16SrI-B phytoplasma strain is prevalent in various crops in India (Singh et al., 2023). This report emphasizes the epidemiological studies and highlights the need for further research and preventive measures to manage the spread of this phytoplasma strain, which could impact crop production and food security in hot and dry regions.

First Report of Foliar Nematode (Aphelenchoides pseudobesseyi) on Soybean in Colombia

Soybean (Glycine max L.) is produced in over 70,000 ha in the Altillanura Region, eastern Colombia (Agronet 2023). From 2018 to 2020, foliar symptoms like green stem and foliar retention of soybean, which in Brazil can cause up to 100% soybean yield losses (Meyer et al. 2017), were observed in soybean fields in Colombia. During 2020, samples from symptomatic plants in reproductive stages (R1-R8) were collected from different commercial soybean fields in the Altillanura Region. Over 200 samples were processed, using an incubation method described in Coyne et al. (2014). Nematodes were recovered from photosynthetic leaf tissues and enlarged nodes/buds with population densities ranging from 13 to 132 and 36 to 936 nematodes/10g, respectively. Adult females were morphologically and molecularly characterized as Aphelenchoides pseudobesseyi (Oliveira et al. 2019; Subbotin et al. 2020). Female body length (n = 20) ranged from 653.3 to 806.3 μm (mean = 723 μm ± 52.7), stylet length from 11.0 to 12.3 μm (11.8 μm ± 0.3), body diameter from 14.8 to 17.9 μm (16.3 μm ± 1.1), post-uterine sac length from 38.7 to 51.9 μm (44.6 μm ± 5.1), vulva to anus from 145.5 to 223.2 μm (172.2 μm ± 22.4), and 26% of the vulva-anus distance. Genomic DNA was extracted (QIAGEN DNeasy® Blood & Tissue kit) from a pool of nematodes. The D2A/D3B (Tenente et al. 2004) primers were used to amplify and sequence the D2/D3 expansion region of the 28S rRNA gene. PCR product (~759 bp) was purified, sequenced, deposited in GenBank (OQ930285), and compared to previously deposited sequences (e.g., KX356756, KY510840, KY510839, KY510841, KT692694, KY510842, MH187565) by means of the BLAST algorithm. Similarly, 988F and 18SR-Burs (De Jesus et al. 2016) primers were used to amplify and sequence the near full-length 18S RNA gene (SSU). PCR product was purified, sequenced, deposited in GenBank (OQ954344), and compared to previously deposited sequences (e.g., KT454962, KT943534, KT943535, KY510835, KY510836, KY510837, KY510838, MH187565). Phylogenetic Bayesian analysis (Ronquist et al. 2012) of the of the D2/D3 and 18S regions placed this nematode from Colombia in the A. pseudobesseyi clade (PP = 100). To fulfill a modified Koch’s postulates, the A. pseudobesseyi population described above was used in a greenhouse assay. In total, 120 soybean plants (cv. Flor Blanca) were infected with 200 A. pseudobesseyi (females + males)/plant. Briefly, at cotyledon stage (VC), 50 µl aliquot containing 50 A. pseudobesseyi was delivered onto each cotyledon and unifoliolate leaves (200 nematodes/plant). Sterile water was delivered to 80 plants which served as control. Plants were kept in the greenhouse at approximately 25°C and covered with clear plastic bag for 72 h to maintain over 90% relative humidity. After 15, 30, 45, and 60 days, soybean plants (n = 20) were processed, A. pseudobesseyi quantified, and the average reproduction factor (final population/initial population) was 0.1, 2.9, 14.0, and 1.8, respectively. Infected plants showed symptoms of blistering leaves with malformation (midrib vein twist), and A. pseudobesseyi was not observed in control plants. To our knowledge, this is the first report of A. pseudobesseyi parasitizing soybean buds and leaves in Colombia. Soybean is an important commodity for the Altillanura Region, and it is important to monitor the risk posed by this nematode. Furthermore, a better understanding of the nematode-host interaction and epidemiology in Colombia soybean producing regions is needed.

First Report of Pantoea ananatis and Pantoea eucalypti causing onion leaf blight and bulb decay in Central Chile.

Nearly 5,400 hectares of long-day onions (Allium cepa) are cultivated in the Central Zone of Chile (UTM 33°3´S to 37°24´S). During summer 2021-22 and 2022-23 (December to February), followed by high temperatures (around 35°C) and high humidity conditions, symptoms showing yellowing, soft rot, blight on old leaves, necrotic tips, and soft bulbs were observed. The affected plants were observed in "spots" into the fields, and the incidence reached 5-10%. The severity was high, and 70-80% of the affected plants died. Symptomatic plants from different fields from the Coquimbo, Metropolitan, O´Higgins and Maule regions were sampled. Isolations were made using casamino-acid peptone glucose (CPG) agar medium (Schaad, 2001). Yellow-pigmented, circular to irregular shaped colonies were observed. Molecular identification was carried out by partial 16S rRNA gene sequencing, resulting in the identification of 18 isolates of Pantoea spp. from twelve different fields. Selected strains were biochemically analyzed using the GEN III BIOLOG microtest system (Hayward, CA) and were identified as Pantoea spp. BLAST analyses of the 16S rRNA sequences (602 nt) of selected strains (GenBank Accession No. OR527817 to OR527819) against the NCBI Database resulted in the identification of Pantoea species with 100% coverage and 100% identity. To determine the Pantoea species of each strain, housekeeping gene gyrB (Delétoile et al. 2009) was amplified and sequenced (GenBank Accessions No. OR544061 to OR544063). BLAST analysis (802 nt) of selected strains resulted in 100% coverage and 100% identity, identifying three different species: P. ananatis, P. eucalypti, and P. agglomerans. Pantoea species were isolated from both leaves and bulbs and no more than one species was observed per field. Pathogenicity assays in onion plants and bulbs were performed based on the methodology described by Asselin et al. (2018). Five onion plants cv. Cimarron of thirteen-week-old were inoculated by wounding an external leave with a sterile toothpick previously immersed in a bacterial suspension at ~ 108 CFU/mL and maintained at 26-28°C for 30 days in high humidity conditions. Control plants were inoculated with sterile water. Plants inoculated with Pantoea spp. showed chlorosis, soft rot, and necrosis mainly in older leaves, as observed in the field, while negative control plants remained healthy. Pantoea spp. were re-isolated from the inoculated onion plants. Toothpicks dipped in the inoculum were stuck 4 cm into the shoulders of onion bulbs and incubated at 26°C for 20 days. Water was inoculated as a negative control. At the end of the incubation period, the bulbs were opened longitudinally across their inoculation sites and shrunken, brownish, watery scales were observed. Pantoea species have been previously described as causing leaf blight of onions in Georgia and Michigan in the USA and South Africa, Brazil, and Uruguay (Hattingh and Walters 1981; Gitaitis and Gay 1997; Edens et al. 2006; Tho et al. 2015; De Armas et al. 2022; Rosende et al. 2022). P. agglomerans was recently reported in Chile (Sepúlveda et al. 2023), but this is the first report of P. ananatis and P. eucalypti affecting onions in central Chile. This detection is an alert call for the onion's growers and exporters in Chile for upcoming seasons, where conditions predisposing to disease may continue to occur. It is crucial to continue analyzing the factors that caused the appearance of this new disease in onions.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Alocasia macrorrhiza Represents a New Host of 'Candidatus Phytoplasma asteris'-Related Strains Associated with Yellows Symptoms in China.

Alocasia macrorrhiza, which belongs to the Araceae family, is an important landscape plant in China, and has of significant medicinal uses. In 2022, A. macrorrhiza displaying abnormal symptoms were found in Qionghai, Hainan Island of China (110°23'3.06″，19°7'56.29″). The incidence of symptomatic plants was about 40% in the sampled areas. The abnormal symptoms included that the ovoid leaves color turned yellow from green gradually, with ovoid leaves chlorosis, mesophyll tissue yellowing, miniature leaves and systemic wilting. The diseased symptoms suspected to be associated with phytoplasma according to the protocols of phytoplasma identification. In order to identify the pathogen, eleven diseased samples and three asymptomatic samples were collected from an area of about 40 hectares. Total DNAs were extracted from 0.10 g fresh plant leaf tissues using a CTAB DNA extraction method. PCR amplifications were performed using primers R16mF2/R16mR1 and fTuf1/rTuf1 specific for the phytoplasma 16S rRNA and tuf genes. Target PCR amplicons were obtained from the DNA of 11 diseased samples, whereas not from the DNA of the asymptomatic samples. The PCR products were cloned and sequenced by Biotechnology (Shanghai) Co., Ltd. (Guangzhou, China), and the obtained sequences were assembled, edited and analyzed using the EditSeq program and DNAMAN version 6.0. The phytoplasma 16S rRNA and tuf gene amplicons were 1336 and 930 bp in length, respectively. The sequences of all 16S rRNA and tuf amplicons in this study were identical. The sequencing data were deposited in GenBank with accession numbers OR466206 (16S rDNA) and OR513090 (tuf). According to the methods and protocols of phytoplasma identified and classification, the phytoplasma strain was described as Alocasia macrorrhiza yellows (AmY) phytoplasma, AmY-hn strain. BLAST search were conducted based on 16Sr RNA and tuf genes. The results showed that the AmY-hn had 100 % 16Sr RNA sequence identity (1336 bp out of 1336 bp) with that of 16SrI-B subgroup phytoplasmas like onion yellows phytoplasma (OY-M, AP006628). The AmY-hn had 100 % tuf sequence identity (930 bp out of 930 bp) with that of 16SrI-B subgroup phytoplasmas like OY-M. RFLP profiles obtained with iPhyClassifier demonstrated that AmY-hn strain was a member of the 16SrI-B subgroup with a similarity coefficient 1.00 to the reference phytoplasma strain (AP006628). Separated phylogenetic analysis based on 16S rRNA and tuf genes obtained with MEGA 7.0 using the neighbor-joining (NJ) method with 1000 bootstrap value indicated that AmY-hn clustered into one clade with phytoplasma strains of OY-M and chinaberry witches'-broom (KP662119) with 100 % and 87 % bootstrap value respectively. To our knowledge, this is the first report that a 'Candidatus Phytoplasma asteris'-related strain belonging to 16SrI-B subgroup infects A. macrorrhiza in China. The 16SrI-B subgroup 'Candidatus Phytoplasma asteris'-related strains can spread outwards through the plant A. macrorrhiza. Thus, the findings in the study will be beneficial to the detection of phytoplasmas which parasitic in this plant and the epidemic monitoring of the related diseases.

First Report of White Mold Caused by Sclerotinia sclerotiorum on Cabbage in Mexico.

The state of Puebla is the main producer of cabbage (Brassica oleracea var. capitata) in Mexico, with an area of approximately 1,858 ha (SIAP 2023). In April 2023, a field sampling was conducted in the San Luis Ajajalpan, Tecali de Herrera (18°55.57'N, 97°55.607'W), Puebla, Mexico. The average temperature was 24°C and the relative humidity was 95% for five consecutive days. Cabbage plants cv. 'American Taki San Juan' close to harvest, with head rot symptoms were found in a commercial area of approximately 3 ha, at an estimated incidence of 35 to 45%. More than 70% of the leaves were symptomatic on severely affected plants. Typical symptoms included chlorosis of older foliage, soft rot with abundant white to gray mycelium, and abundant production of large and irregularly-shaped sclerotia. The fungus was isolated from 30 symptomatic plants. Sclerotia were collected from symptomatic heads, surface sterilized in 3% NaOCl, rinsed twice with sterile distilled water, and plated on Potato Dextrose Agar (PDA) with sterile forceps. Subsequently, a dissecting needle was used to place fragments of mycelium directly on PDA. Plates were placed in an incubator at 25°C in the dark. A total of 30 representative isolates were obtained by the hyphal-tip method, one from each diseased plant (15 isolates from sclerotia and 15 from mycelial fragments). After 8 days, colonies had fast-growing, dense, cottony-white aerial mycelium forming irregular sclerotia of 3.75 ± 0.8 mm (mean ± standard deviation, n=100). Each Petri dish produced 14-25 sclerotia (mean = 18, n = 50), after 10 days. The sclerotia were initially white and gradually turned black. The isolates were identified as Sclerotinia sclerotiorum based on morphological characteristics (Saharan and Mehta 2008). Two representative isolates were chosen for molecular identification, and genomic DNA was extracted by a CTAB protocol. The ITS region and the glyceraldehyde 3-phosphate dehydrogenase (G3PDH) gene were sequenced for two isolates (White et al. 1990; Staats et al. 2005). The ITS and G3PDH sequences of a representative isolate (SsC.1) were deposited in the GenBank (ITS- OR286628; G3PDH- OR333495). BLAST analysis of the partial sequences ITS (509 bp) and G3PDH (915 bp) showed 100% similarity to S. sclerotiorum isolates (GenBank: MT436756.1 and OQ790148). Pathogenicity was confirmed by inoculating 10 detached cabbage heads of 'American Taki San Juan', using the SsC.1 isolate, according to Sanogo et al. (2015). Heads were placed on the rim of a plastic container and inserted in a moisture box with 2 cm of water on its bottom. The box was covered with a plastic sheet to maintain humidity. The control plants were inoculated with a plug of noncolonized PDA. The inoculated cabbages were covered with white to gray mycelia and abundant sclerotia within 10 days, whereas no symptoms were observed on non-inoculated controls. The fungus was re-isolated from the inoculated cabbages as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. White mold caused by S. sclerotiorum on Brussels sprouts was recently reported in Mexico (Ayvar-Serna et al. 2023). In 2015, S. sclerotiorum was reported on cabbage in New Mexico, causing head rot (Sanogo et al. 2015). To our knowledge, this is the first report of S. sclerotiorum causing white mold on cabbage in Mexico. This research is essential for designing management strategies and preventing spread to other production areas.

First Report of Natural Infection of Watermelon mosaic virus (WMV) Infecting Bottle Gourd and Snake Melon

Cucurbitaceous crops, one of the main crops of agriculture, are sensitive to many plant viruses. In August 2019, virus-like symptoms were observed on some cucurbit plants grown in private home gardens in Antalya and Denizli provinces (Turkey). A total of 53 leaf samples were sampled from plants with the most symptoms (melon (Cucumis melo L.), watermelon (Citrullus lanatus L.), bottle gourd (Lagenaria siceraria (Molina) Standl.), and snake melon (Cucumis melo var. flexuosus) and tested by Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR) against possible watermelon mosaic potyvirus (WMV) infection. The coat protein gene (CP) specific primer sets amplified a gene product of nearly 820 bp fragment from symptomatic plants. WMV infections were detected in 31 individual cucurbit plants, including 11 melons, 8 watermelons, 7 snake melons and 5 bottle gourds. The presence of viral infection was found only in ornamental squash plants in Antalya province and in all cucurbits sampled in Denizli province. To better comprehend the molecular characteristics of virus isolates, the amplified viral DNA fragments were cloned in a proper prokaryotic plasmid, sequenced by Next Generation Sequencing (NGS) and recorded to GenBank. Bioinformatic analyses using the Basic Local Alignment Search Tool (BLAST) showed that the identified CP gene sequences exhibited significant nucleotide homogeneity, supported by a high nucleotide similarity index with that of other isolates around the world. In addition, Turkish isolates isolated from Antalya and Denizli regions showed approximately 94% nucleotide similarity among themselves. For phylogenetic inference, WMV sequences were subjected to multiple alignments with isolates from different geographic origins of the same viruses. Molecular phylogeny showed that all WMV isolates are closely related to other world WMV isolates at variable rates. WMV is wide host range viruses in cucurbit crops, however, this work is the first scientific report of WMV isolates detected in bottle gourd and snake melon from the South and West Regions of Turkey all over the world.WMV are broad spectrum viruses in cucurbit crops. This work is the first scientific report of Watermelon mosaic potyvirus isolates detected in bottle gourd and snake melon from the South-West Region of Turkey in all over the world.