Sweet Potato Tubers Research Articles

Development and Quality Evaluation of Ready to Use Sweet Potato and Mushroom (Pleurotus ostreatus) Tikki mix

Experiment was conducted at Research Laboratories of Department of Food Process Engineering, SHIATS, Allahabad to utilize the Sweet potato flour and oyster mushroom powder for preparation of Tikki mix. The sweet potato tubers were brought from local market of Allahabad and oyster mushroom obtained from Department of Plant protection, SHIATS Allahabad and then tubers with sorted washed, peeled, sliced, blanched, dried and milled into flour form. Sweet potato flour contains less amount of protein, although rich in dietary fiber content and carbohydrate, so a successful combination with oyster mushroom powder for Tikki mix production would be nutritionally advantageous. In this experiment Sweet potato flour was blended with oyster mushroom powder in ratio of 94%, 88%, 82% with control 100% Sweet potato flour. These were evaluated for sensory analysis that included color, flavor, taste, texture and overall acceptability of SPF and mushroom powder Tikki mix and analyzed for chemical properties viz; moisture, protein, fiber, fat and ash contents. On the basis of nutritional value T2 was found high fiber content than other samples and high score for over-all acceptability with containing of 88% sweet potato flour. Thus, the product was found to be acceptable after the storage period.

Proximate composition and functional properties of extruded snacks from breadfruit-sweet potato flour

Objective: The objective of the study was to determine the proximate composition and functional properties of extruded snacks from breadfruit-sweet potato flour blends.Materials and methods: African bread fruit and sweet potato tubers were processed into flour and formulated into different proportions (100: 0; 90: 10; 80:20; 70:30; 60:40and 50: 50% of breadfruit and sweet potato, respectively). The proximate composition, functional properties and sensory acceptability of the composite flour and extruded snacks were evaluated using standard methods. Extruded snacks were made from varying combinations of breadfruit and sweet potato flour using a single screw cooking extruder. The proximate composition, functional properties and sensory acceptability of the composite flour and extruded snacks were determined using standard laboratory procedures. Data obtained were subjected to analysis of variance using SPSS version 20.Results: Moisture, ash, fat, protein, crude fibre and carbohydrate contents of the composite flour ranged from 5.70 to 15.00%, 1.34 to 2.67%, 0.40 to 0.80%, 2.11 to 3.12%, 2.55 to 5.29% and 81.77 to 73.47%, respectively while that of the snacks ranged from 5.70 to 7.32%, 7.11 to 9.46%, 2.18 to 9.28%, 8.56 to 12.68%, 8.16 to 10.95% and 54.61 to 64.54%, respectively. Breaking force, lateral expansion and bulk density of the snacks ranged from 12.60 to 34.20 N, 6.80 to 7.76 and 0.03 to 0.05 g/cm3, respectively; while water solubility and water absorption indices ranged from2.81 to 3.25 and 1.48-2.15, respectively. The proportions of the composite flour did not (p≥ 0.05)influence the sensory acceptability of the snack samples.Conclusions: The study showed that extruded snacks with higher protein and crude fibre proximate composition, functional properties and sensory acceptability can be prepared from breadfruit-sweet potato flour blends.Keywords: Snacks, sweet potato, breadfruit, texture, sensory acceptability

Added Value Improvement of Taro and Sweet Potato Commodities by Doing Snack Processing Activity

Tubers processing is one of efforts to support program on food diversification utilizing local foods. Introduction of processing technology of taro and sweet potato tubers to be flour and snack products (stick and chip) was done to disseminate the technology in farmer level in order to improve the commodities’ added value and later could improve farmer's welfare. The introduction was done in “Mekar Sari” women group in Bali on June up to December 2013. The result showed that women group can prepare good quality products by themselves. With R/C ratio is more than one, food processing activities are feasible to be done. By selling flour, prospective revenue accepted was IDR 85,125 or 3.4 times higher than selling fresh tubers and even could become IDR 191,906 or 7.7 times higher if they processed at least one of snack products (stick).

Production and Quality Evaluation of Noodles From Sweet Potato Starch

The effect of extrusion parameters (feed moisture content, barrel temperature, and screw speed) on the quality of noodles produced from sweet potato starch was investigated. Starch was extracted from the tuber of sweet potato and processed into noodles using single screw cooking extruder. The moisture, protein, and ash contents of the noodles decreased linearly with the feed moisture content and barrel temperature but decreased with increasing screw speed. Increased feed moisture content also led to decrease in water absorption capacity, cooking time, and water solubility index. Lateral expansion increased with increasing barrel temperature. Barrel temperature had significant effect (p < 0.05) on lateral expansion while screw speed and feed moisture content had significant effect (p < 0.05) on cooking time. Significant (p < 0.05) positive correlation was obtained between the overall sensory acceptability, appearance, firmness, and chewiness. The study showed that noodles of desirable functional qualities and sensory acceptability can be obtained from sweet potato starch using barrel temperature of 110°C, screw speed of 100 rpm, and feed moisture content of 47.5%.

Assessment of sweet potato [Ipomoea batatas (L.) Lam] for bioethanol production in southern Italy

The potential of sweet potato as an alternative crop for bioethanol production has been assessed. We evaluated the amount of soluble sugars, starch and cell wall polysaccharides in tubers of three sweet potato cultivars characterized by different pulp and peel colouration: “Yellow yam” with yellow flesh and brown peel, “White yam” with white flesh and white peel and “Orange yam” with orange flesh and brown peel. The results confirm the high concentration of carbohydrates in sweet potato tubers, especially “Yellow yam”, mainly in the form of starch (67%) and soluble sugars (26%). “Yellow yam”, which is the most widespread cultivar in Salento, appeared the best choice as biomass for bioethanol production. It is characterized by high productivity (20–40 tons/ha year). Results also suggest that “Yellow yam” cultivar has great potential as a bioethanol source in southern Italy with an estimated agroindustrial production yield higher than 2032 l/ha year.

Investigation on the activities of yeasts in the post harvest spoilage of sweet potato(&lt;i&gt;Ipomea batatas &lt;/i&gt;L.)

Postharvest losses due to the activities of indigenous microorganisms occur in many crops such as sweet potato (Ipomoea batatas) which result in heavy financial losses for farmers. Correct identification of the pathogen responsible for postharvest infection is central to adopting an appropriate control strategy. Samples of sweet potato tubers were purchased from the local market and stored at three temperatures: 13°C, 21°C and 29° for four weeks. Spoilage yeasts were isolated from the tuber samples. The isolates were characterized using yeast genomic DNA extraction, polymerase chain amplification of rRNA and sequence determination. The yeasts were identified on the basis of the 26S rDNA. Six yeast species were identified as Rhodotorula mucilaginosa, R. minuta, Pichiaguilliermondii, P. anomala, Sporobolomyces marcillae and Saccharomycopsis fibuligera. The results indicated that the D1 and D2 domains of the 5’ end of the 26S rDNA showed a high degree of interspecies sequence variation for the isolates. Two of the yeasts; P. anomala and R. minuta were selected for further investigations namely pathogenicity testing and assay for extracellular enzymes. Results of the pathogenicity tests showed that P. anomala and R. minuta were clearly able to infect the sweet potato tubers. The results of the enzyme assay revealed that P. anomala and R. minuta were able to secrete varying amounts of eight extracellular enzymes: cellulose, amylase, polygalacturonase, glucanase, xylanase, xylosidase, arabinofuranosidase and ferulic acid esterases. These enzymes have the capacity to degrade plant cell walls and possibly enhanced the pathogenicity of the yeasts. Key Words: Sweet-potato, yeast, Postharvest, Pathogenicity, Ipomoea batatas

Organochlorine (chlordecone) uptake by root vegetables

Chlordecone, an organochlorine insecticide, continues to pollute soils in the French West Indies. The main source of human exposure to this pollutant is food. Root vegetables, which are staple foods in tropical regions, can be highly contaminated and are thus a very effective lever for action to reduce consumer exposure.We analyzed chlordecone contamination in three root vegetables, yam, dasheen and sweet potato, which are among the main sources of chlordecone exposure in food in the French West Indies. All soil types do not have the same potential for the contamination of root vegetables, allophanic andosols being two to ten times less contaminating than non-allophanic nitisols and ferralsols. This difference was only partially explained by the higher OC content in allophanic soils. Dasheen corms were shown to accumulate more chlordecone than yam and sweet potato tubers. The physiological nature of the root vegetable may explain this difference. Our results are in good agreement with the hypothesis that chlordecone uptake by root vegetables is based on passive and diffusive processes and limited by transport and dilution during growth.

Isolation and analysis of the promoter of an anthocyanin synthase gene from purple-fleshed sweet potato tubers

Purple-fleshed sweet potato (Ipomoea batatas (L.) Lam) accumulates a large amount of anthocyanins in its tubers. Activation of anthocyanin gene expression requires transcription factors such as MYB domain, basic helix-loop-helix domain, or WD40-repeat domain-containing proteins. However, the mechanisms controlling pigmentation in underground organs remain unresolved. We used a principal component analysis to identify the most important gene in anthocyanin biosynthesis in pigmented sweet potato tubers, because this gene was the most likely to be regulated by IbMYB1. Anthocyanidin synthase was identified as the most important gene. Functional analysis of its promoter identified four MYB DNA-binding sites. In gel mobility shift experiments with recombinant IbMYB1, the IbMYB1 protein bound specifically to TAACCG box and TATCC box motifs in vitro. We conducted transient expression experiments in which various promoter fragments were used to drive expression of the LUC reporter gene. The reporter gene was strongly expressed under the control of the full-length promoter, but weakly expressed under the control of promoter fragments that lacked the MYB DNA-binding domains. This provided direct evidence that IbMYB1 activates the expression of this structural anthocyanin gene. Together, these results show that IbMYB1 is important in controlling the expression of genes in the anthocyanin biosynthetic pathway in cells.

The use of plant cell wall–degrading enzymes from newly isolated Penicillium ochrochloron Biourge for viscosity reduction in ethanol production with fresh sweet potato tubers as feedstock

Penicillium ochrochloron Biourge, which was isolated from rotten sweet potato, can produce plant cell wall-degrading enzymes (PCWDEs) with high viscosity reducing capability for ethanol production using fresh sweet potato tubers as feedstock. The enzyme preparation was characterized by a broad enzyme spectrum including 13 kinds of enzymes with the activity to hydrolyze cellulose, hemicellulose, pectin, starch, and protein. The maximum viscosity-reducing capability was observed when the enzyme preparation was obtained after 5 days of fermentation using 20 g/L corncob as a sole carbon source, 4.5 g/L NH4 NO3 as a sole nitrogen source, and an initial medium pH of 6.5. The sweet potato mash treated with the enzyme preparation exhibited much higher fermentation efficiency (92.58%) compared with commercial cellulase (88.06%) and control (83.5%). The enzyme production was then scaled up to 0.5, 5, and 100 L, and the viscosity-reducing rates were found to be 85%, 90%, and 91%, respectively. Thus, P. ochrochloron Biourge displays potential viscosity-reducing capability for ethanol production.

Effect of acid modification on the material and compaction properties of fonio and sweet potato starches

Starches obtained from the grains of white fonio (Digitaria exilis) and tubers of sweet potato (Ipomea batatas) have been modified by acid hydrolysis at different steeping times – (0, 24 and 96 h) and the physicochemical, material and compaction properties of the modified starches have been evaluated in comparison with official corn starch. The effect of acid modification on the compaction properties of the starches were evaluated with the aim of determining their usefulness as excipients in direct compression. The results showed that the physicochemical and material properties of the starches varied considerably depending on their botanical source. Acid modification led to an increase in solubility and relative crystallinity but decrease in swelling and viscosity of the starches. The effects were found to depend on the steeping time during acid hydrolysis. The results of the compressional properties indicated that the starches formed intact tablets at relatively low compression pressure with acid modified starches forming tablets with higher tensile strength than the natural starches. The results indicate that the physicochemical and compaction properties of white fonio and sweet potato starches were improved by acid modification yielding starches that could be suitable as directly compressible excipient.

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China.

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

First report of Pythiogeton ramosum (Pythiales) in Australia

In 2012, a project was initiated to assess if the soft rot disease of ginger in Australian fields was associated with pathogens other than Pythium myriotylum. Together with nine Pythium spp., ten isolates of a Pythium-like organism were also recovered from ginger with soft rot symptoms. These Pythium-like isolates were identified as Pythiogeton (Py.) ramosum based on its morphology and ITS sequences. In-vitro pathogenicity tests allowed confirmation of pathogenicity of Py. ramosum on excised carrot (Daucus carota), sweet potato (Ipomoea batatas) and potato (Solanum tubersum) tubers, although it was not pathogenic on excised ginger (Zingiber officinale) and radish (Raphanus sativus) rhizome/roots. In addition it was found to be pathogenic on bean (Phaseolus vulgaris), capsicum (Capsicum annuum) and cauliflower (Brassica oleracea var. botrytis) seedlings. This is the first record of Py. ramosum and its pathogenicity in Australia.

BLOOD ANTHOCYANIN LEVELS OF HEALTHY AND DIABETIC RATS AFTER FEED WITH A SINGLE DOSE OF PURPLE SWEET POTATO TUBERS AQUEOUS EXTRACT

Background: Aqueous extract of purple sweet potato tuber shown to decrease the blood glucose levels and has antioxidant properties in rats with streptozotocin-induced diabetes. The purpose of this study is to prove that an increase in anthocyanin levels in the blood of rats after administration of aqueous extract of purple sweet potato tubers in healthy and diabetic rats. Methods: This is an experimental study with randomized post-test only control group design. The subject of experiments were 72 rats, divided into two major groups, namely diabetic rats (treatment group 36 rats) and control group (36 healthy rats). Each major group was divided into 6 small groups each 6 rats. The control group was given aqueous extract of purple sweet potato tuber with a dose of 4 ml single dose. The diabetic group were given streptozotocin and followed by aqueous extract of purple sweet potato tuber 4 ml single dose. Observed variables include: blood glucose levels to define diabetes. To determine the levels of anthocyanin, the blood were taken and the level of anthocyanin were examination by HPLC method, in healthy and diabetic rats after 30 min, 1 hours, 2 hours, 4 hours, 8 hours and 16 hours of giving single dose of aqueous extract of purple sweet potato tubers. Results: The results showed an increase in blood sugar levels were significant (p &lt; 0.05) in group given streptozotocin compared to control. Anthocyanin levels in the blood of two groups were significantly different from 30 min after administration of the extract to 8 hours after administration of the extract (p &lt; 0.05). Higher anthocyanin levels (p &lt; 0.05) was observed in control group (healthy rats) compared to rats with streptozotocin-induced diabetes. Peak levels of anthocyanin in blood were achieved after 2 hours of feeding. Conclusion: The conclusion of this study is the absorption of anthocyanin in aqueous extract of purple sweet potato tuber better in healthy rats compared to diabetic rats. The peak levels of anthocyanin was reached after 2 hours of aqueous extract of purple sweet potato tubers single dose consumption either in healthy rats and in diabetic rats.

Aqueous Extract of Ipomoea batatas Reduces Food Intake in Male Wistar Rats: A Pilot Study.

Background:Food intake is regulated by the complex interaction of psychological and physiological events associated with ingestion. Food that increases short-term satiety decreases the amount of energy ingested subsequently and thus could potentially help in weight management in the long run. Potato, a common starchy tuber in our environment is believed to contain substances that can help maintain and increases short-term satiety.Aim:This study was conducted to determine the effect of the aqueous extract of sweet potato (Ipomoea batatas [IB]) on food intake in male Wistar rats.Materials and Methods:The sweet potato tubers were chopped into small pieces and homogenized in distilled water for 30 s. Homogenate was filtered through muslin cloth and then centrifuged at 120 rpm for 20 min. For use, the residue was evaporated to dryness. The dried extract was reconstituted in freshly prepared normal saline for administration to test animals. The 20 acclimatized male Wistar rats weighing 170-180 g were used for this study. The animals were randomly assigned into four groups of five rats each. Group 1 served as the control and was fed with 0.3 ml of normal saline while Groups 2-4 were fed with IB extract.Results:The results showed that in the extract-treated groups, the food intake was significantly reduced at P < 0.01 in a dose dependent manner when compared with the control group.Conclusion:Consumption of IB caused a reduction in food intake probably by reducing appetite and increasing satiety.

Effect of Boiling and Frying on the Total Carbohydrate, Vitamin C and Mineral Contents of Irish (Solanun tuberosum) and Sweet (Ipomea batatas) Potato Tubers

ABSTRACT In a study aimed at ascertaining whether boiling or frying best conserves nutrients; since the two methods are commonly adapted in Nigeria, the effect of boiling and frying on total carbohydrate, vitamin C and mineral contents of Irish (Solanum tuberosum) and sweet (Ipomea batatas) potato tubers were investigated. The determination of total carbohydrate was carried out using the phenol-sulphuric acid method and the spectrophotometric method was used to determine vitamin C content at 520 nm. The minerals evaluated are iron, zinc, magnesium, sodium, calcium and copper. These were determined by the atomic absorption spectrophotometric method. There was no significant difference (p > 0.05) in the total carbohydrate content of the boiled and fried sweet and Irish potatoes compared with their raw tubers. There was significant difference (p

SWEET POTATO CULTURE – PROMISING TREND OF RUSSIAN VEGETABLE GROWING

Results of research of possibility of introduction of a new for the Russian Federation tuberous crop culture, sweet potato, are presented. The influence of planting dates on the yield of this culture was studied. According to the field experiment, the high yield of sweet potato tuber and resistance to diseases and pests were revealed.

Effect of tuber skin on the thermal properties of whole tubers of potato and sweet potato

Temperature-dependent thermal coefficients of mathematical models of the postharvest storage process play an important role in determining the models accuracy. Thermal properties of tubers under storage available in literature are generally of those in semi processed form (skinless) such as those having undergone peeling, dicing and cutting actions. This study investigates the effect of tuber skin on the thermal properties of whole tubers of potato and sweet potato. A direct approach was used to measure the tubers' density and thermal conductivity and thermal diffusivity by the transient heat transfer method. Indirect approach was used to measure the tubers' specific heat. Experimental data were used to develop empirical models of the thermal coefficients as a function of temperature. Results of the study should find great use in the modeling of potato and sweet potato storage process.

English

Yellow variety of sweet potato tubers lots were processed with different pre-drying treatments of peeled washed chips: Unblanched without Sodium Metabisulphite (UB-SMBS), blanched without sodium metabisulphite (B-SMBS), unblanched with sodium metabisulphite (UB+SMBS) and blanched with sodium metabisulphite (B+SMBS) for production of dried chips for confectionery flours. Low moisture contents in the range of 2.48 to 5.00% were achieved for the dried chips lots in 20 h of drying at about 55 to 60°C using NSPRI’s Cabinet Crop Dryer without smoking. The dried chips had no visible mould growths in the duration of drying and mould loads were low (in the order of 102cfu/g). However, different colours and textures were observed in dried chips and flours depending on pre-drying treat-ment. While UB-SMBS and UB+SMBS sweet potato chips’ flours were suitable and acceptable for production of chin-chin, the B-SMBS and B+SMBS were unsuitable and unacceptable at 100% composition of the flour. Key words: Sweet potato, blanching, sodium metabisulphite, dried chips, flour.

THE ROLE OF THE SWEET POTATO IN THE CROP DIVERSIFICATION OF SMALL-SCALE FARMERS IN SOUTHERN PROVINCE, ZAMBIA

Stable maize production and increased productivity are important for improved food security in Zambia. Because most farmers cultivate maize under rain-fed agriculture, a maize monoculture is vulnerable to drought or excessive rainfall. Therefore, increasing the diversification of crops and crop varieties is important to achieve food security in the face of a changing climate. The sweet potato (Ipomoea batatas) has great potential as a crop for consumption and as a source of income. The aim of this study was to determine farmers' familiarity with sweet potato varieties and their features, and to clarify production and consumption patterns in a rural area in Southern Province, Zambia. Field studies were conducted at three sites. Farmers in the study area planted sweet potatoes in both the rainy and dry seasons. As a group, farmers were able to identify a total of 22 sweet potato varieties, but all varieties that were identified were not actually cultivated. Sweet potato production was much greater at one site. Further study of some households at this site indicated that sweet potato tubers were consumed about twice per week. Consumption was highest during and immediately after the harvest, and then decreased gradually. Annual sweet potato sales per person generated sufficient income .

Fermentation and quality of yellow pigments from golden brown rice solid culture by a selected Monascus mutant

A single peak (λmax 370) yellow pigment-producing mutant derived from Monascus sp. TISTR 3179 was used for the pigment production in solid rice culture. Various factors affecting yellow tones were investigated. Hom-mali rice variety was the best amongst five Thai local varieties used for fungus culture. It was also better than corn, mungbean, soybean, potato, sweet potato, or cassava tubers. The moisture content and temperature were the key environmental factors affecting the color tones of creamy, tangerine, and golden brown rice solid cultures. The golden brown rice culture gave the highest yellow pigment concentration. Under an optimum room temperature of 28-32 °C, an initial moisture content of 42 %, and 7-day-old inoculum size of 2 % (v/w) the maximum yield at 2,224.63 A370U/gdw of yellow pigment was produced. A mellow yellow powder at 550 A370U/gdw could be obtained using spray-drying techniques. The powder had a moisture content of 5.15 %, a water activity value of 0.398, a hue angle of 73.70 ° (yellowish orange), high lightness (L) of 74.63, color saturation (C) of 28.97, a neutral pH of 7.42, 0.12 % acidity and solubility of 0.211 g/10 ml. It was noteworthy that the Chinese fresh noodle with spray-dried yellow powder showed no discoloration during 8-day storage.