Sweet Pepper Cultivars Research Articles

Productivity, Quality and Economics of Sweet Pepper (Capsicum annum) Cultivars under Modified Net House Conditions in Arid Regions

Productivity, Quality and Economics of Sweet Pepper (Capsicum annum) Cultivars under Modified Net House Conditions in Arid Regions

Molecular characterization and host reaction to tomato mottle mosaic virus isolated from sweet pepper seeds in Japan.

Many countries have identified tomato mottle mosaic virus (ToMMV) as a serious threat to tomato production. Here, we constructed and characterized infectious clones of ToMMV isolated from Japanese sweet pepper seeds. The genome of the Japanese isolate is 6399 nucleotides in length and exhibits thehighest identity withpreviously characterized isolates. For example, it is 99.7% identical to that of the Mauritius isolate, which occurs worldwide. Phylogenetic analysis based on complete genome sequences revealed that the Japanese isolates clustered in the same clade as those from other countries. When homozygous tomato cultivars with tobamovirus resistance genes were inoculated with an infectious cDNA clone of ToMMV, the virus systemically infected tomato plants with symptoms typical of Tm-1-carrying tomato cultivars. In contrast, tomato cultivars carrying Tm-2 or Tm-22 showed symptoms only on the inoculated leaves. Furthermore, when commercial cultivars of Tm-22 heterozygous tomato were inoculated with ToMMV, systemic infections were observed in all cultivars, with infection frequencies ranging from 25 to 100%. Inoculation of heterozygous sweet pepper cultivars with tobamovirus resistance genes (L1, L3, and L4) with ToMMV resulted in an infection frequency of about 70%, but most of the infected L1, L3, and L4 cultivars were symptomless, and 10-20% showed symptoms of necrosis and yellowing. Tomato mosaic virus strain L11A, an attenuated virus, did not provide cross-protection against ToMMV and led to systemic infection with typical symptoms. These results suggest that ToMMV might cause extensive damage to existing tomato and sweet pepper cultivars commonly grown in Japan.

Effect of Bioactive Compound (Poultry Manure) on the Yield and Capsaicinoid Content of Sweet Pepper (Capsicum annuum L.) Cultivars

To assess the impact of poultry manure fertilization on the yield and capsaicinoid content of sweet pepper cultivars, field experiments were carried out during the 2018 rainy seasons at two locations within the Sudan savanna agro-ecological region: the Teaching and Research Farm Bayero University Kano (l1o 58 N, 8o 25 E, and altitude 458 m) and Kadawa Irrigation Scheme Bunkure (l1o 42 N, 8o 33 E, and altitude 476 m). The experiment was a 4 x 3 factorial laid out in a randomized complete block design with four replicates comprising four levels of poultry manure (PM) (0, 1.0, 2.0, and 3.0 tha-1) and three cultivars of sweet pepper (Tattasai Dan Damasak, Yolo wonder and Nsukka yellow). The result reveals that the growth, yield and capcisinoid content of sweet pepper cultivars were greatly influenced by the application of PM. The application of 3.0 tha-1 of PM significantly gave taller plants, more branches, larger leaves, and a higher number of fruits. Similarly, the Dan Damasak cultivar significantly produced higher growth characters above, except for the number of fruits plant-1. The Dan Damasak and Yolo wonder cultivars at BUK and Yolo wonder at BKR significantly gave a higher number of fruit plants. Fresh fruit yield, total fruit yield, and capsaicinoid content were significantly higher with 3.0 tha-1 of PM at both locations. The Dan Damasak cultivar resulted in higher yield related characters at both locations. The capsaicinoid content was, however, significantly higher with Nsukka yellow (17.43 and 18.83 mg kg-1) at BUK and BKR locations, respectively. Thus, the application of 3.0 tha-1 PM combined with the Dan Damasak cultivar for improved growth and yield, while the Nsukka Yellow cultivar and the application of 3.0 tha-1 PM for higher capsaicinoid could be suggested to the farmers in the study area to improve the productivity of the crop.

Effect of Salicylic Acid and Calcium on Growth, Yield, and Fruit Quality of Pepper (Capsicum annuum L.) Grown Hydroponically

The aim of this study was to investigate the effects of spraying plants with 0.03% salicylic acid (SA), 0.7% calcium nitrate (Ca), and 0.03% salicylic acid together with 0.7% calcium nitrate (SA + Ca) on plant growth, yield, and fruit quality of peppers grown in a mineral wool substrate. The control plants were sprayed with water (C). Two red-fruited sweet pepper cultivars were used in the study: ‘Aifos’, and ‘Palermo’, which produce fruits characterized by different shapes. Biometric measurements of the plants showed a higher growth rate of pepper plants when SA and Ca were applied foliarly compared to the control. Plants treated simultaneously with SA and Ca were characterized by the highest steady-state fluorescence yield [Fs]. The relative chlorophyll content of pepper leaves was also higher in plants sprayed with SA, Ca, and SA + Ca than in plants in the control. The analysis of pepper yield showed in both cultivars the effect of foliar treatment of plants with SA and Ca and SA + Ca on increasing pepper resistance to the occurrence of Ca deficiency on pepper fruit (Blossom end rot). Pepper fruits harvested from plants treated with SA, Ca, and SA + Ca had more juicy flesh.

Deficit Irrigation on Fruit Yield and Quality of Sweet Pepper

Background: Deficit irrigation is an approach to use less water in crop growth in places where water resources are the limiting factor for agricultural production, to maximize the production per unit of volume of water available. Objective: The study aimed to evaluate the effect of four levels of irrigation applied to replenish soil moisture depletion on the growth and yield of two sweet pepper cultivars. Methods: The experiment was performed on field conditions from January to June 2020 in a randomized block experimental design with three repetitions arranged in divided plots, the main plot was the four irrigation depths, and the sub-plots were the two cultivars (Tres Filos and Pepón) for a total of eight treatments. The irrigation depths applied corresponded to 60%, 80%, 100%, and 120% of the crop evapotranspiration. Results: The ANOVA (analysis of variance) of the main factors indicates that for the irrigation treatment factor, the number of fruits per plant for the two varieties is statistically equal when irrigation is applied at 120, 100 and 80% of the crop evapotranspiration (ETc) and greater than the one obtained with irrigation at 60% of ETc. For the cultivars factor, the number of fruits per plant and the fruit yield (g plant-1) in the different irrigation treatments was higher in the cv Tres Filo, but the weight of the fruit was higher in the cv Pepón. Conclusion: The application of irrigation at 60% of the ETc represents a saving of 40% of the volume of water compared to the application at 100% of ETc. The reduction in the number of fruits per plant, fruit weight, and average yield (g plant-1) of both cultivars was only 4.21%, 7.47%, and 11.95%, respectively. Therefore, if the limiting factor for agricultural production is water availability, it is advisable to irrigate at 60% of the ETc and increase the surface for irrigation to increase total production.

Enhancing the nutritional value of sweet pepper through sustainable fertilization management

IntroductionThe need for healthy foods has become a major concern in our modern world, as the global population continues to grow and environmental challenges intensify. In response to these challenges, researchers have started to explore a range of sustainable solutions, including organic farming practices, precision agriculture, and the development and testing of innovative biofertilizers. Consistent with these ideas come the aim of this study, which sets out to give new insights into the cultivation of two sweet pepper cultivars with economic and nutritional importance in Romania.MethodsTwo sweet pepper cultivars (Blancina and Brillant), chemically (Nutrifine®), organically (Orgevit®) and biologically (Micoseed®) fertilized were cultivated over the course of two years (2019 and 2020), between April and October, in high-tunnel, by following a split-plot design with three replications. Production parameters (number of fruits, fruit weight, yield), proximate composition (water content, dry matter, total soluble solids, acidity, ash), the content of phytonutrients (polyphenols, lycopene, β-carotene, antioxidant activity), phytochemical composition (phenolic compounds) and minerals (macro- and micro-elements) were analyzed in order to determine the impact of fertilization on the quality of sweet peppers.ResultsThe results showed that the biological and organic fertilizations had a significant positive impact on most of the parameters analyzed, starting with yield and continuing with acidity, phytonutrient content (total phenolic content, lycopene, β-carotene), antioxidant activity and phytochemical composition (chlorogenic acid, p-coumaric acid, quercetin and isoquercetin). Only in the case of mineral content, the chemical treatment gave better results compared with the organic and biological fertilizers.ConclusionOverall, this study provides valuable information on the potential of organic and biological fertilizers to enhance the nutritional value of sweet peppers from Blancina F1 and Brillant F1 cultivars, paving the way for subsequent research aimed at achieving superior quality and increased yields.

Modeling Short-term Yield Changes in Sweet Pepper Based on Dry Matter Production and Fruit Growth

Large fluctuations in fruit set and fresh yield are issues associated with the production of sweet pepper. Fluctuations in fresh yield (i.e., flush) result in improper labor distributions and price fluctuations for growers. Modeling the fruit set is a promising way to improve the profits of growers and allow the arrangement of labor distribution and logistics. Therefore, this study aimed to develop a model for predicting the short-term yield changes of sweet pepper by integrating two sub-models: one model for predicting the production of total dry matter and one model for predicting the individual fruit growth. We hydroponically grew four sweet pepper cultivars (Artega, Nagano, Nesbitt, and Trirosso) in a greenhouse to investigate the accuracy of the proposed model. Comparisons between observed and predicted fresh yields showed that the peaks and troughs of fresh yields were accurately predicted, regardless of cultivar differences. The average root mean square error between them was within the range of 0.24 to 0.39 t⋅ha−1⋅d−1. Therefore, growers will be able to predict short-term yield changes of sweet pepper by obtaining coefficients for predicting the production of total dry matter and fruit growth curve of the cultivar scheduled to be cultivated.

Evaluation of the Growth and Yield Characteristics of Six Domestic Sweet Pepper Cultivars

Evaluation of the Growth and Yield Characteristics of Six Domestic Sweet Pepper Cultivars

Fungal strain and crop cultivar affect growth of sweet pepper plants after root inoculation with entomopathogenic fungi.

As endophytes, entomopathogenic fungi can protect plants against biotic and abiotic stresses and at the same time promote plant growth and plant health. To date, most studies have investigated whether Beauveria bassiana can enhance plant growth and plant health, while only little is known about other entomopathogenic fungi. In this study, we evaluated whether root inoculation of the entomopathogenic fungi Akanthomyces muscarius ARSEF 5128, B. bassiana ARSEF 3097 and Cordyceps fumosorosea ARSEF 3682 can promote plant growth of sweet pepper (Capsicum annuum L.), and whether effects are cultivar-dependent. Plant height, stem diameter, number of leaves, canopy area, and plant weight were assessed four weeks following inoculation in two independent experiments using two cultivars of sweet pepper (cv. 'IDS RZ F1' and cv. 'Maduro'). Results showed that the three entomopathogenic fungi were able to enhance plant growth, particularly canopy area and plant weight. Further, results showed that effects significantly depended on cultivar and fungal strain, with the strongest fungal effects obtained for cv. 'IDS RZ F1', especially when inoculated with C. fumosorosea. We conclude that inoculation of sweet pepper roots with entomopathogenic fungi can stimulate plant growth, but effects depend on fungal strain and crop cultivar.

Sweet pepper (<i>Capsicum annuumL.</i>) breeding on yield and fruits qualityaccording to the cultivar model for unheated soil greenhouses

Relevance. An important proviso for the commercially effective cultivation of vegetable crops in different types of greenhouses is high yield, which significantly depends on modern cultivars with different characteristics and properties. When creating a new cultivar, it is necessary to present its model in accordance with the expected ecological and agrotechnical conditions of planting, the purpose of use, the level of manifestation of morphological and biochemical characteristics, which together will ensure a high yield. The goal of research – to create early ripening, high-yielding cultivars of sweet pepper with high taste assessment of fresh fruits and content of biologically valuable substances.Materials and methods. The studies were conducted in 2015-2018 and 2020-2021 in the Belarusian State Agricultural Academy. The objects were 46 breeding lines of sweet pepper. An evaluation of fruits and plants morphological characteristics, yield traits, fruits biochemical composition, and tasting were carried out.Results. Valuable lines for breeding were selected with a gross yield of 5.60–6.71 kg/m2, with large fruits (150–220 g), thick pericarp (>7 mm),with a high content of biologically valuable substances and fruit quality 4.3–4.7 points. Lines with a complex of economically valuable traits including high tasting score, were transferred to the State Inspection for Testing and Protection of Plant Varieties and recommended for commercial use in the Republic of Belarus under the names Altyn, Chervonets, Karat, Goretsky Krasny, Garlachyk Zhovty and Chyrvony Magnat.

Application of Genetic Resources in the Development of New Lithuanian Vegetable Cultivars

The investigations of genetic resources in Lithuania started in 1924. Collections including more than 110 samples of different vegetable species have been accumulated and continue to expand. The breeding program is focused on productivity, quality traits and biochemical composition, and tolerance of unfavorable environmental factors in changing climates. Currently, over 95 cultivars and hybrids of vegetables have been released, about 40 of which are included in the EU Common catalogue of varieties of vegetable species. From 2012 to 2021, twelve cultivars were developed at the Lithuanian Research Centre for Agriculture and Forestry, seven of which are fruit vegetables, four are root crops, and two are in the onion group. The breeding direction was to increase the sustainable production of vegetables and improve the quality of the products by using national and adapted genetic resources as valuable parental forms. For 10 years, vegetable plant hybrids and cultivars were developed to meet commercial cultivars' market requirements. The tomato cultivars 'Ainiai' H, 'Adas' H, 'Auksiai' H, 'Alvita' and cucumber cultivar 'Roliai' are distinguished by a good biochemical composition and taste, while the sweet pepper cultivar 'Gabija' has high productivity and fruit quality. The carrot hybrids 'Ieva', 'Rokita', 'Jola', garlic cultivar 'Dangiai', and onion cultivar 'Joriai' are distinguished by their productivity and good storage ability. The Jerusalem artichoke cultivar 'Sauliai' has tubers with white skin and the colour of the flowers is yellow.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Macroscopic and microscopic characterization of fluorescence properties of multiple sweet pepper cultivars (Capsicum annuum L.) using excitation-emission matrix and UV induced fluorescence imaging

Sweet peppers are a popular vegetable with various surface colors, such as green, purple, red, or yellow. To characterize the unique fluorescence properties associated with a broad range of sweet peppers of various colors (14 varieties), a fluorescence spectrofluorometer and imaging were used. The results showed that all cultivars in the experiment had blue fluorescence emissions when excited with light in the UV-A region, while chlorophyll fluorescence could be observed in green peppers. The emitted blue fluorescence originated from the epidermis (cuticle layer). The color distribution of these sweet peppers in the a* and b* color space were compared to the image obtained under white LED light. Yellow and red pepper cultivars have thicker, multiple cuticular wax layers and more distinct maturity stages than other sweet pepper varieties observed. With the establishment of this basic fluorescence database, further applications of fluorescence-based techniques and the unification of evaluation methods for pepper quality will be more easily established.

Comparison of Physiological Traits of Two Sweet Pepper Cultivars under Salinity Stress

Comparison of Physiological Traits of Two Sweet Pepper Cultivars under Salinity Stress

Nitrogen Effect on Fruit Quality and Yield of Muskmelon and Sweet Pepper Cultivars

Yield and fruit quality are two of the most important parameters for the profitability of vegetable crops. In commercial vegetable production, nitrogen (N) is commonly applied in excess, which is associated with nitrate (NO3−) leaching loss. In addition, excess N application may affect yield and fruit quality. The aim of this study was to evaluate the effect of N applications of very deficient N (N1, 2 mmol L−1), deficient N (N2, 8 mmol L−1), and conventional N (N3, 14 mmol L−1), according to local fertigation practices, in soil-grown muskmelon and sweet pepper crops in Almeria, South-Eastern Spain. The evaluation was conducted in three cultivars of each species. The yield and the fruit quality parameters of firmness, colour, total soluble solids (TSS) and morphometric variables were evaluated in two years for each species. For most parameters in both species, the effects of N, when significant, occurred regardless of cultivar. In muskmelon and sweet pepper, application of 8.2 mmol N L−1 (i.e., N2) was sufficient to achieve a maximum yield of 6.7 and 7.4 kg m−2, respectively. In muskmelon, very deficient N application led to an increase of 58% in the percentage of fruit discarded, mostly due to malformed and undersized fruits. Fruit firmness and red–green axis coordinate (a*) were not consistently affected by N in any of the crops. However, the fruit lightness (L*) increased with N addition in both species, likely because of increased chlorophyll pigments. With N addition, fruit TSS slightly decreased in muskmelon and slightly increased in sweet pepper. However, fruit TSS of both species were within reference values for commercialisation in the three N treatments. There were differences in yield between cultivars in muskmelon but not in sweet pepper, likely due to differences in fruit number in muskmelon. There were differences between cultivars in TSS and colour a* coordinate in both muskmelon and sweet pepper. Cultivars with higher TSS and a* coordinate will likely be more desirable for consumers because of the sweeter taste and more intense orange colour in muskmelon and reddish colour in sweet pepper. Overall, our manuscript showed that N application can be reduced, relative to the conventional N application, without reducing yield or fruit quality in muskmelon, yet additional studies should be conducted in sweet pepper to complement the results of the 2020 crop.

Differential reaction of sweet pepper to infection with the crinivirus tomato chlorosis virus probably depends on the viral variant

AbstractThe tomato chlorosis virus (ToCV), transmitted by whitefly species of the genera Bemisia and Trialeurodes in a semipersistent manner, causes significant losses in solanaceous crops including tomato (Solanum lycopersicum) and sweet pepper (Capsicum annuum). Worldwide reports of natural and experimental infection of sweet pepper plants with ToCV are contradictory, raising the question of whether the critical factor determining infection is related to the susceptibility of sweet pepper cultivars or the genetics of virus isolates. In this work, ToCV isolates obtained from different hosts and geographical origins were biologically and molecularly analysed, transmitted by B. tabaci MEAM1 and MED, and the reaction of different sweet pepper cultivars was evaluated under different environmental conditions. Brazilian ToCV isolates from tomato, potato (S. tuberosum), S. americanum, and Physalis angulata did not infect plants of five sweet pepper cultivars when transmitted by B. tabaci MEAM1. Temperatures did not affect the sweet pepper susceptibility to tomato‐ToCV isolates from São Paulo, Brazil, and Florida, USA. However, sweet pepper‐ToCV isolates from Spain and São Paulo, Brazil, were transmitted efficiently to sweet pepper plants by B. tabaci MEAM1 and MED. Although the results indicated that ToCV isolates from naturally infected sweet pepper plants seem to be better adapted to plants of C. annuum, phylogenetic analyses based on the complete nucleotide sequences of RNA1 and RNA2 as well as the p22 gene did not reveal significant nucleotide differences among them. Additional studies are needed to identify intrinsic characteristics of ToCV isolates that favour infection of sweet pepper plants.

Genotype-Dependent Antioxidative Response of Four Sweet Pepper Cultivars to Water Deficiency as Affected by Drought-Tolerant Bacillus safensis SS-2.7 and Bacillus thuringiensis SS-29.2 Strains

We examined the effect of drought-tolerant Bacillus safensis SS-2.7 and B. thuringiensis SS-29.2 strains on the response of four (133, 274, California Wonder—CalW, and Matica) sweet pepper genotypes to water deficiency conditions. Pepper seeds were sown in pots with (treated) and without (control) bacterial strain inoculation. After four weeks of growth under controlled conditions and regular watering, drought was imposed by completely withholding watering for seven days. Under conditions of normal watering, genotype 274 showed better seedling establishment than genotype 133 and CalW, while the slowest was genotype Matica. Antioxidant enzyme activity under drought conditions was genotype and bacterial treatment-dependent. The best response to bacterial treatment in order to cope with severe drought was found in the CalW genotype, while in genotype 133, we determined even faster plant decay during water deficiency in treated seeds. Inoculated seeds of the Matica genotype did not show different antioxidant enzyme activity under normal and drought conditions. According to the obtained results, we concluded that under drought conditions, the most susceptible was genotype 274, moderate susceptibility was detected in genotype 133, and CalW and Matica were the most tolerant genotypes. Our study demonstrates (1) that drought-tolerant Bacillus strains showed a plant growth-promoting effect on some selected pepper genotypes; (2) that there were genotype-dependent antioxidant enzyme activities under drought conditions in response to treatment with a particular bacterial strain; and (3) that we could expect a genotype-dependent response during biostimulant application, especially under stress conditions.

The performance of sweet pepper cultivars under different nitrogen levels in a semi-arid environment

Nitrogen is the most important and widely applied nutrient in sweet pepper production as it improves vegetative growth as well as fruit production. Therefore, the present research was aimed to evaluate promising sweet pepper cultivars as a function of different nitrogen fertilizer levels for semi-arid conditions of Pakistan during 2018 and 2019. Four nitrogen levels (75, 100, 125 and 150 kgha−1) and three sweet pepper cultivars (Ganga, Winner and Savio) were adopted in this study. Vegetative growth as well yield attributes were found highest during the cropping season of 2019 as compared with 2018. Plant height, stem diameter, canopy diameter, fresh and dry biomass of sweet pepper enhanced by the increased application of nitrogen from 75 to 125 kgha−1. All the yield contributing traits including number of fruits per plant, fruit fresh weight per plant and fruit yield per hectare were found the highest with nitrogen application of 150 kgha−1. In most of the crop traits, application of 125 kg Nha−1 and 150 kg Nha−1 produced statistically similar results. Cultivars respond differently to the nitrogen application. Ganga and Savio behaved similarly in response to nitrogen application. They had a quadratic response to nitrogen application; maximum growth and yield were at 125 kg Nha−1 and then decreased at 150 kg Nha−1. In contrast, Winner showed a somewhat linear response to nitrogen application and maximum growth, biomass and yield were recorded at 150 kg Nha−1. Planting a pepper cultivar with improved nitrogen use efficiency can result in maximum yield in a semi-arid region.

High-quality chromosome-scale genomes facilitate effective identification of large structural variations in hot and sweet peppers.

Pepper (Capsicum annuum) is an important vegetable crop that has been subjected to intensive breeding, resulting in limited genetic diversity, especially for sweet peppers. Previous studies have reported pepper draft genome assemblies using short read sequencing, but their capture of the extent of large structural variants (SVs), such as presence-absence variants (PAVs), inversions, and copy-number variants (CNVs) in the complex pepper genome falls short. In this study, we sequenced the genomes of representative sweet and hot pepper accessions by long-read and/or linked-read methods and advanced scaffolding technologies. First, we developed a high-quality reference genome for the sweet pepper cultivar 'Dempsey' and then used the reference genome to identify SVs in 11 other pepper accessions and constructed a graph-based pan-genome for pepper. We annotated an average of 42 972 gene families in each pepper accession, defining a set of 19 662 core and 23 115 non-core gene families. The new pepper pan-genome includes informative variants, 222 159 PAVs, 12 322 CNVs, and 16 032 inversions. Pan-genome analysis revealed PAVs associated with important agricultural traits, including potyvirus resistance, fruit color, pungency, and pepper fruit orientation. Comparatively, a large number of genes are affected by PAVs, which is positively correlated with the high frequency of transposable elements (TEs), indicating TEs play a key role in shaping the genomic landscape of peppers. The datasets presented herein provide a powerful new genomic resource for genetic analysis and genome-assisted breeding for pepper improvement.

Flowering Time and Productivity of Interspecific Grafts Between Pepper Species in Contrasting High Tunnel-sheltered and Open-field Production Environments in Costa Rica

The production of sweet peppers (Capsicum annuum) is often constrained in tropical environments by susceptibility to persistent soil-borne diseases, including bacterial wilt (Ralstonia solanacearum). However, the production of sweet peppers in high tunnels using sterile soilless media irrigated with nutrient solution offers the potential to reduce the incidence of bacterial wilt. An additional strategy for disease management is the use of sweet pepper scions grafted onto rootstocks that are resistant to soil-borne pathogens. Two sweet pepper cultivars grown extensively in the tropics, Nathalie and 4212, were used as scions and grafted onto the habanero pepper cultivar Habanero TEC (Capsicum chinense) and the aji pepper cultivar Baccatum TEC (Capsicum baccatum). Two cultivars related to the two rootstocks were prescreened for susceptibility to two virulent strains of bacterial wilt. Graft combinations were grown in two environments, a high tunnel with automatic nutrient solution irrigation of containers filled with sterile coconut fiber and an open field with known high levels of bacterial wilt inoculum. Self-grafted and nongrafted plants of scions were included as checks. The disease susceptibility screening showed that the area under the disease progress curve was consistently low for ‘Habanero TEC’ and ‘Baccatum TEC’ when inoculated with two virulent strains of bacterial wilt, suggesting that habanero pepper cultivars and, to a lesser degree, aji pepper cultivars may be useful as rootstocks in soils with bacterial wilt inoculum. Significant increases in yield, fruit number, and reduced time to flowering were observed in the high tunnel compared with the open-field environment. Individual fruit weight was reduced in the high tunnel compared with the field. Yield, fruit number, fruit weight, and time to flowering were consistent between scions regardless of rootstock. No differences were observed for yield, fruit number, fruit weight, or time to flowering of self-grafted and nongrafted scion checks. In the high tunnel, yield was higher in scions grafted onto ‘Habanero TEC’ compared with self-grafted and nongrafted checks. In the open field, yield and fruit number were highest on scions grafted onto ‘Habanero TEC’. Regardless of graft treatment, high-tunnel production in tropical environments can result in significant increases in yield and fruit number compared with open-field production. No advantage of grafted plants was observed in the high-tunnel production environment. In contrast, in the open-field environment, grafting sweet pepper scions onto pungent habanero rootstocks resulted in a significant increase in yield, fruit number, and fruit size compared with self-grafted and nongrafted checks. The increase was likely attributable to the resistance of habanero pepper cultivars to soil-borne diseases, including bacterial wilt.