Susceptible Clones Research Articles

A late blight resistant potato plant overexpresses a gene coding for α-galactosidase upon infection by Phytophthora infestans

Late blight of potato, caused by Phytophthora infestans was studied by using a resistant clone of potato on one side and a susceptible clone on the other side. A gene coding putatively for an α-galactosidase has been isolated by mRNA reverse transcription polymerase chain reaction differential display and was shown to be differentially expressed between the resistant and the susceptible clone. α-Galactosidases catalyse the hydrolysis of α-1,6 linked α-galactose residues from oligosaccharides and it could be shown in the present work that raffinose content decreases at 30 h after infection by P. infestans in the resistant clone.

Genomic Backgrounds of Drug-Resistant Streptococcus pneumoniae in Ankara, Turkey: Identification of Emerging New Clones

Streptococcus pneumoniae exhibiting decreased susceptibility to penicillin are isolated with an increasing prevalence in Turkey during the last decade. This study was undertaken to investigate the molecular epidemiology of non-penicillin-susceptible pneumococci isolated in Ankara, Turkey. Among a population of 246 pneumococci, 90 pneumococci with penicillin MIC > or = 0.1 microg/ml were serotyped, genotyped by pulsed-field gel electrophoresis (PFGE), and sequence typed by multilocus sequence typing (MLST). The overall resistance to penicillin, cefotaxime, erythromycin, clindamycin, chloramphenicol, tetracycline, rifampicin, ciprofloxacin, and vancomycin were 36.6%, 4%, 27.6%, 10.9%, 5.3%, 22.4%, 4.5%, 2%, and 0, respectively. The most frequent serotypes were 14, 23B, 9V, 19F, 19A, and 23F. PFGE types represented 17 genetic clusters. PFGE and MLST data revealed that there were isolates identical or closely related to the Spain(9V)-3 ST 156 clone, Portugal(19F)- 21 ST 177 clone, and Spain(23F)-1 ST81 clone. Eleven serotype 14 isolates with emerging resistance to penicillin belonged to the ST 230 complex, a predominantly susceptible clone. Serotype 19A, 19F, and 7F variants of the ST 230 clone were also identified in the study population. Eight serotype 23B isolates with a new ST 1349 (18-13-8-6-3-6-8) created another clone with no relation to the currently defined international clones. Although the pandemic clones Spain(9V)-3, Portugal1(9F)-21, and Spain(23F)-1 are present in our region, the emergence of a new 23B clone with a unique ST and the emergence of resistance in the ST230 clone, has presumably contributed to the increase in the prevalence of drug-resistant pneumococci in Turkey.

DISSEMINATION OF SALMONELLA ENTERICA SEROTYPE AGONA AND MULTIDRUG-RESISTANT SALMONELLA ENTERICA SEROTYPE TYPHIMURIUM IN CUBA

The molecular epidemiology, antimicrobial susceptibility, and mechanisms of resistance of 34 Salmonella spp. strains causing acute gastroenteritis, isolated from different provinces in Cuba, were determined. Sixty-four percent of the strains showed multiresistance. Salmonella typhimurium was the most frequent with 15 strains (44%), 13 of which belonged to phagotype 104 and presented similar genetic profiles of pulsed field gel electrophoresis. High levels of resistance to tetracycline (53%), spectinomycin (50%), ampicillin (44%), and chloramphenicol (41%) were found. Resistance to tetracycline was associated with the tet G and tet A genes. Resistance to ampicillin was caused by the presence of beta-lactamases, mainly the CARB type. The floR gene was the main mechanism of resistance to chloramphenicol. Our results showed an antimicrobial susceptible clone of Salmonella enterica serotype Agona in two separate regions. This is the first report of the widespread dissemination of a multiresistant clone of S. enterica serotype Typhimurium definitive phage type 104 in Cuba.

Cultural and PCR‐based detection of Septoria musiva in inoculated hybrid poplar stems

SummaryThe fungal pathogen Septoria musiva can be difficult to isolate from cankers that result from its colonization of poplar stems, and its persistence in these cankers has not been well studied. In order to compare cultural and polymerase chain reaction (PCR)‐based assays for detection of S. musiva in cankers, stems of susceptible hybrid poplar clone NC11505 were wounded and inoculated in August 2003. At 8, 16, 24 and 32 weeks after inoculation (October and December 2003, February and April 2004, respectively), 110 inoculated stems (plus controls) were harvested and a semiselective culture medium was used in attempts to detect the pathogen in bark and wood. Six chips of bark and six chips of underlying wood from one half of each canker were incubated on the semiselective medium for 2 weeks until pycnidia and conidia of S. musiva could be identified. The number of positive cankers and positive chips (out of six attempts per tissue per canker) was recorded. The remaining halves of cankers from subsets of 70 inoculated stems (plus controls) of those harvested in October 2003 and April 2004 were tested using a PCR‐based assay. Three chips of bark and three chips of underlying wood were ground, and DNA was extracted and then amplified using S. musiva‐specific primers designed from the internal transcribed spacer (ITS) region of nuclear rDNA repeats. The number of positive cankers and positive chips (out of three attempts per tissue per canker) was recorded. For both assays, the number of positive cankers and the number of positive chips per canker decreased with time. Using either assay, however, the pathogen was still detected from at least 49% of cankers at 32 weeks after inoculation.

Macrolide-Resistant Streptococcus pyogenes in Norway: Population Structure and Resistance Determinants

A 2.7% prevalence of macrolide resistance in 1,657 Norwegian clinical Streptococcus pyogenes isolates was primarily due to erm(TR) (59%) and mef(A) (20%). Four clonal complexes comprised 75% of the strains. Macrolide resistance in S. pyogenes in Norway is imported as resistant strains or locally selected in internationally disseminated susceptible clones.

Stage-dependency of apoptosis and the blood-testis barrier in the dogfish shark (Squalus acanthias): cadmium-induced changes as assessed by vital fluorescence techniques

Naturally occurring heavy metals and synthetic compounds are potentially harmful for testicular function but evidence linking heavy metal exposure to reduced semen parameters is inconclusive. Elucidation of the exact stage at which the toxicant interferes with spermatogenesis is difficult because the various germ cell stages may have different sensitivities to any given toxicant, germ cell development is influenced by supporting testicular somatic cells and the presence of inter-Sertoli cell tight junctions create a blood-testis barrier, sequestering meiotic and postmeiotic germ cells in a special microenvironment. Sharks such as Squalus acanthias provide a suitable model for studying aspects of vertebrate spermatogenosis because of their unique features: spermatogenesis takes place within spermatocysts and relies mainly on Sertoli cells for somatic cell support; spermatocysts are linearly arranged in a maturational order across the diameter of the elongated testis; spermatocysts containing germ cells at different stages of development are topographically separated, resulting in visible zonation in testicular cross sections. We have used the vital dye acridine orange and a novel fluorescence staining technique to study this model to determine (1) the efficacy of these methods in assays of apoptosis and blood-testis barrier function, (2) the sensitivity of the various spermatogonial generations in Squalus to cadmium (as an illustrative spermatotoxicant) and (3) the way that cadmium might affect more mature spermatogenic stages and other physiological processes in the testis. Our results show that cadmium targets early spermatogenic stages, where it specifically activates a cell death program in susceptible (mature) spermatogonial clones, and negatively affects blood-testis barrier function. Since other parameters are relatively unaffected by cadmium, the effects of this toxicant on apoptosis are presumably process-specific and not attributable to general toxicity.

Progresso de epidemias e avaliação de danos da ferrugem em clones de álamo

A ferrugem do álamo (Melampsora medusae) causa sérios prejuízos no viveiro e tem sido cada vez mais freqüente em plantações, principalmente nos clones mais suscetíveis. O comportamento dos clones em relação a epidemias de ferrugem nas plantações brasileiras não é conhecido. Este trabalho teve como objetivos quantificar o progresso de epidemias em sete clones de álamo e correlacionar doença com produção por meio de relações entre incidência, severidade e índice de área foliar com o diâmetro do tronco do hospedeiro. As avaliações foram realizadas em sete clones de álamo: 'Argos'; 'Gaupiara'; 'Guarani'; 'JB'; 'Latorre'; 'SJ'; 'SM'. Cada clone compunha um talhão, todos com seis anos de idade. A severidade e a incidência da doença, o índice de área foliar (IAF) e o diâmetro à altura do peito (DAP) foram quantificados em dez plantas escolhidas aleatoriamente dentro de cada talhão de novembro a abril de 98/99, 99/00 e 00/01. Os clones mais suscetíveis à doença foram Latorre e Guarani, SJ foi resistente e Guapiara, SM, JB e Argos, intermediários. O modelo logístico apresentou um bom ajuste aos dados de severidade da ferrugem e a epidemia foi mais severa no ciclo de 99/00, onde as temperaturas variaram entre 15,5 e 26,5 ºC. Não houve relação significativa entre severidade da doença e diâmetro à altura do peito (DAP). Nos clones suscetíveis, a duração da área foliar (DAF), que é a integralização da curva do IAF, foi relacionada com o DAP com coeficientes de determinação da regressão linear de 0,73 e 0,56 para Guarani e Latorre, respectivamente. O clone Latorre mostrou-se relativamente tolerante à doença, com alta severidade (100 a 150 pústulas/cm²) e redução do DAP de 5%, enquanto no Guarani a redução do DAP foi de 17%.

SCAR marker for the selection of Ry-duplex potato clones immune to potato virus Y

Vegetative propagation of potato allows the dissemination of viruses that can cause drastic drops in tuber yield. Potato virus Y (PVY) is one of the most important viruses of potato due to the non-persistent mode of transmission through vector insects. Genetic resistance is the recommended control measure since the chemical control of vector insects is not effective. This study aimed to identify PVY-immune clones through potato grafting onto virus-infected tobacco plants, check their genetic constitution for the Ry allele through PCR and evaluate the clones' field performance. Sixty-two clones were identified as PVY-immune through grafting. The SCAR marker allowed the identification of two duplex clones for the Ry allele (RyRyryry), which can be used as parents to originate progenies with about 80% PVY-immunity in crossings with susceptible clones. Besides, the clones were productive and presented high tuber dry matter content.

Changes in host chitinase isoforms in relation to wounding and colonization by Heterobasidion annosum: early and strong defense response in 33-year-old resistant Norway spruce clone

We studied the defense reactions of 33-year-old susceptible and resistant clones of Norway spruce (Picea abies (L.) Karst.) to the major root-rot fungus Heterobasidion annosum (Fr.) Bref. and determined if tissue cultures can be used as a model system for studying defense responses of mature trees at the molecular level. Quantitative PCR analysis of genomic DNA obtained from samples taken at different times along the lesion length in living bark indicated that the fungus was present in higher amounts and extended further into the host tissue in the susceptible clone than in the resistant clone. In protein extracts from the same lesion samples, there were differences in temporal and spatial changes in host chitinase isoform profiles between the resistant and susceptible clones. Host chitinase isoforms with pI values approximately 4.8, 4.4 and 3.7 increased more during the first 7 days after wounding and inoculation and extended further along the lesion length in the resistant clone than in the susceptible clone. These results suggest that the time from wounding and infection to induction of defense-related expression is shorter in the resistant clone indicating a more efficient host defense response than in the susceptible clone. Tissue cultures from the same clones were not resistant to H. annosum and showed no difference in the timing of the increase in chitinase isoforms in response to the pathogen. However, tissue cultures from both clones showed an increase in chitinase isoforms within 6 to 24 h past inoculation, indicating that increased chitinase expression in response to the pathogen is part of a general defense response common to both mature clones and tissue cultures.

First Report of Leifsonia xyli subsp. xyli, Causal Agent of Ratoon Stunting of Sugarcane, in Jamaica.

To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica.

The Dynamics of Antimicrobial-Resistant Campylobacter jejuni on Japanese Broiler Farms

We investigated for dynamics of Campylobacter clones on 2 different managerial broiler farms. Campylobacter isolates were differentiated by resistance typing and molecular typing methods. On farm I, the same C. jejuni clones resistant to fluoroquinolone and oxytetracycline were isolated after one and half years again and another susceptible clone was invaded. The susceptible clone was isolated again after half year. Broiler flocks on the farm may be repeatedly infected with a few C. jejuni clones. On farm II, new clones including antimicrobial resistant one, were often invaded. The change of predominant C. jejuni clone in each flock on both the farms was observed, in the absence of antimicrobial selective pressure.

Genetic improvement of lucerne for anthracnose (Colletotrichum trifolii) resistance

Anthracnose, caused by Colletotrichum trifolii, is one of the most serious diseases influencing lucerne persistence and productivity in eastern Australia. The disease is largely controlled by plant resistance; however, new pathotypes of C. trifolii have developed in Australia, seriously limiting the productive life of susceptible cultivars. This paper describes an incompletely recessive and quantitatively inherited resistance to C. trifolii identified in a clone (W116) from cv. Sequel. S1, F1, F2 and backcross populations of W116 and D (highly susceptible clone) were studied for their reaction to C. trifolii race 1. Resistance was found to be quantitatively inherited, and quantitative trait loci associated with resistance and susceptibility were identified in a backcross population (D × W116) × D using random amplified polymorphic DNA and amplified fragment length polymorphic markers. A multi-locus region on linkage group 4 was found to contribute significantly to the resistance phenotype. The application of DNA markers to allow exploitation of this quantitatively inherited resistance in lucerne breeding is discussed.

Hybrid Poplar Clones with Populus maximowiczii Parentage Demonstrate Postoviposition Antibiosis to Cryptorhynchus lapathi (Coleoptera: Curculionidae)

Damage caused by the poplar-and-willow borer, Cryptorhynchus lapathi (L.) (Coleoptera: Curculionidae), is reported to vary among hybrid poplar clones. We evaluated oviposition preferences and larval success in four hybrid poplars on potted and field-planted trees. Oviposition occurred somewhat less frequently and abundantly on two clones with Populus maximowiczii Henry parentage in field-planted and potted trees, and significantly fewer larvae survived to adulthood on those clones. No adults emerged from field-planted NM 6 (Populus nigra L. x P. maximowiczii) and four emerged from TM 256-28 (Populus trichocarpa Torrey & Gray x P. maximowiczii) on which male-female pairs of C. lapathi had been caged. In contrast, 50 and 140 adults emerged over the same 2-yr period from two susceptible clones (n = 20), TD 52-226 (P. trichocarpa x Populus deltoides Bartram ex Marshall) and TN 302-9 (P. trichocarpa x P. nigra), respectively. Thus, resistance expressed by clones with P. maximowiczii parentage partially involves decreased levels of oviposition, but more significantly, antibiosis in resistant clones prevents the development of larvae, probably in early spring.

Certain factors associated with blister blight resistance in Camellia sinensis (L.) O. Kuntze

The role played by certain factors, physical barriers and chitinase enzyme, associated with blister blight resistance in tea was investigated. The blister blight resistance of the tea clone SA-6 was due to higher amounts of epicuticular wax and increased thickness of cuticle/epidermal layer, functioning as physical barriers to hyphal penetration of Exobasidium vexans. Higher quantum of chitinase in intercellular spaces of palisade tissues was observed in the resistant clone SA-6 through immunolocalization study. Both chitinase assay as well as western blotting studies confirmed that the constitutive level of chitinase expression was higher in the resistant clone when compared with the susceptible tea clone.

Olfactory and Feeding Preferences of <I>Cryptorhynchus lapathi</I> L. (Coleoptera: Curculionidae) Among Hybrid Clones and Natural Poplars

Abstract Hybrid poplar clones show varying levels of attack by Cryptorhynchus lapathi (L.), a wood-boring weevil. We studied differences in olfactory and feeding behavior among four different hybrid poplars in a series of laboratory bioassays. Weevils did not discriminate between resistant and susceptible clones based on olfaction in pitfall bioassays or antennal responses but did discriminate against the most resistant hybrid, NM 6 (P. nigra L. × P. maximowiczii Henry), in choice and no-choice paired-twig feeding bioassays. In addition, the susceptible hybrid, TN 302–9 (P. trichocarpa Torrey and Gray × P. nigra), was preferred for feeding over Salix scouleriana Barratt ex Hooker, a preferred host in the wild. We conclude that resistance among hybrid poplars is in part based on antixenotic cues before oviposition.

Induction and differential expression of -1,3-glucanase mRNAs in tolerant and susceptible Hevea clones in response to infection by Phytophthora meadii

Most cultivated rubber tree (Hevea brasiliensis Willd. ex A. Juss.) clones in India are susceptible to abnormal leaf fall disease (ALF), which is caused by various Phytophthora species and results in yield losses of up to 40%. Because the conventional breeding programs for this perennial tree crop are complex and time consuming, we attempted to find a molecular solution to increase the tolerance of rubber trees to ALF. The expression patterns of the gene coding for the pathogenesis-related beta-1,3-glucanase (beta-glu) enzyme in a tolerant (RRII 105) and a highly susceptible (RRIM 600) clone of rubber tree were examined, following infection with ALF-causing Phytophthora meadii McRae. Infected leaf samples were collected at different times after inoculation, and RNA was extracted and subjected to Northern blot hybridization and reverse transcriptase polymerase chain reaction (RT-PCR). On hybridization with a 1.25 kb beta-glu probe, Northern blots showed a marked increase in beta-glu transcript levels in both clones 48 h after inoculation. However, compared with the susceptible RRIM 600 clone, the tolerant RRII 105 clone had a higher rate of increase and a more prolonged induction, with beta-glu transcript levels remaining high for 4 days after inoculation. In RRIM 600, the mRNA levels decreased significantly 48 h after inoculation. On re-hybridization with an 18S rRNA probe, uniform signals were detected in all the lanes, indicating that an equal amount of total RNA was present in all samples. Similar results were obtained in relative quantitative RT-PCR experiments with the housekeeping actin gene as an internal control. Thus, although induction of the beta-glu gene occurred in both tolerant and susceptible clones, the predominant difference between clones was in the intensity and duration of the response. The tolerance of clone RRII 105 may be associated with the prolonged expression of the gene following infection. The antifungal activity of these hydrolase enzymes makes them rational candidates for overexpression by genetic transformation to produce disease resistant crops.

Accumulation of the Long Clas of siRNA Is Associated with Resistance to Plum pox virus in a Transgenic Woody Perennial Plum Tree

We investigated the hallmarks of posttranscription gene silencing (PTGS) in mature plants, embryos, and seedlings of the transgenic plum trees (Prunus sp.) that are resistant to Plum pox virus (PPV). We previously demonstrated that the transgene insert and resistance to PPV were mutually inherited in progeny of line C5. We show here that C5 constitutively produces a short (22 nt) and a long (25 to 26 nt) species of short interfering (si)RNA from embryo to mature plant in the absence of PPV inoculation. Unlike siRNA, methylation and transcription of the PPV-coat protein transgene were 're-set' following seed germination. Uninoculated transgenic susceptible clones did not display DNA methylation, nor did they produce detectable levels of siRNA. Upon infection, susceptible clones, transgenic or untransformed, did produce siRNA but only the short 22-nt species. These findings show that plum trees respond to virus infection by initiating PTGS-like mechanisms that involve the production of siRNA. We further suggest that high-level virus resistance in transgenic Prunus species requires the production of the long-size class of siRNA. The research adds new insights into PTGS silencing in woody perennial plant species.

Nosocomial Outbreak of Pediatric Gastroenteritis Caused by CTX-M-14-Type Extended-Spectrum β-Lactamase-Producing Strains of Salmonella enterica Serovar London

CTX-M-14-type extended-spectrum beta-lactamase was first detected in Salmonella enterica serovar London strains which were isolated from three hospitalized pediatric patients with gastroenteritis. The isolates had pulsed-field gel electrophoresis patterns identical to those of the previously isolated antimicrobial-susceptible strains from community-acquired gastroenteritis, suggesting the susceptible clone acquired the resistance.

Susceptibility of invasive taxa of European blackberry to rust disease caused by the uredinial stage of Phragmidium violaceum under field conditions in Australia

European blackberry (Rubus fruticosus agg.) is an aggregate of closely related taxa, with at least 15 taxa naturalized in Australia. Biological control of this Weed of National Significance, using the nonindigenous rust fungus Phragmidium violaceum, is effective when the weather is conducive to multiple cycles of infection, but some blackberry taxa escape severe disease. Thirty‐one taxa of naturalized R. fruticosus agg. from southeastern Australia were isolated, their DNA phenotype determined and clones of each taxon inoculated with P. violaceum isolate SA1. Disease development was monitored for at least four generations of uredinia on large potted plants under field conditions. Although variation in mean disease severity appeared continuous over the range of Rubus clones tested, counts of uredinia and telia enabled identification of eight resistant taxa. Fine scale variation in susceptibility to rust disease was observed when different clones of R. leucostachys with the same DNA phenotype were found to express either resistance or susceptibility to P. violaceum (SA1). There were significant differences among 23 Rubus taxa rated as susceptible to rust disease in the mean number of leaves emerging per latent period of uredinia (LELPU). Mean LELPU appeared to account for some of the variation in two measures of mean disease severity observed among susceptible Rubus clones, although the correlation was insignificant (0·10 < P > 0·05).

1006. Analysis of Resistance to Viral Oncolysis in Primary Ovarian Cancer Cell Cultures

We have generated a new type of capsid-modified, conditionally replicating, oncolytic adenovirus (Ad5/35.E1A/TRAIL). Tumor targeting of this vector is achieved via binding of the Ad serotype 35 fiber to CD46, which is upregulated, several orders of magnitude, on most tumor cells in situ. Furthermore, this vector employs a new concept for tumor-specific gene expression that is based on homologous recombination between inverted repeats (IR) in Ad genomes (Ad.IR). Ad5/35.IR-E1A/TRAIL was highly efficient in elimination of liver metastases derived from various human tumor cell lines in mice and did not cause unspecific toxicity in mice or baboons. So far, Ad5/35.IR-E1A/TRAIL has been tested in vitro and in vivo on established tumor cell lines, including ovarian cancer cell lines. Established tumor cell lines, however, often do not reflect the phenotypic and genetic heterogeneity of tumors in situ and appear not to be adequate models to assess the clinical performance of oncolytic adenoviruses. We therefore tested our oncolytic vector on cultures of primary ovarian cancer cells. Cultures were established from 25 biopsies and 6 ascites fluids from ovarian cancer patients. Tumor cells were either expanded in culture or as subcutaneous xenografts in immuno-deficient mice. Tumor cells within a given culture showed great heterogeneity in Ad infectibility. We therefore obtained clones from single tumor cells after limiting dilution and analyzed them for susceptibility to lysis by Ad5/35.IR-E1A/TRAIL. So far we have studied 16 clones derived from one ovarian biopsy culture. In 14 clones, 100% of tumor cells were lysed by the oncolytic vector. Resistant tumor cells can be efficiently infected with Ad5/35-GFP and supported viral replication. This indicates that resistance to Ad5/35.IR-E1A/TRAIL is due to a block in execution of TRAIL-mediated apoptosis. To corroborate heterogeneity of tumor cells in susceptibility to our oncolytic vector, over the next two months we will perform transduction with clones derived from biopsies from at least four additional ovarian cancer patients. The fact that clones derived from the same tumor cultures display different susceptibility also gives us a means to study and identify genes or pathways that are involved in mediating resistance. So far, using DNA arrays, we have compared expression profiles of the original biopsy with those of the corresponding tumor cell culture at different passage numbers. We also included SKOV-3 cells, an established ovarian cancer cell line, in this study. These studies indicated that the expression profile of primary ovarian cancer cultures were closer to that of SKOV-3 than to the original biopsy. We plan to repeat this study and use laser capture to obtain tumor cells from biopsy sections. We have also started array analyses with RNA isolated from resistant and susceptible clone and the results of these studies will be presented.