Surface Appendages Research Articles

Control of archaellation in Sulfolobus acidocaldarius: unravelling of the regulation of surface structure biosynthesis in Archaea begins

Archaea have a variety of surface appendages including archaella (archaeal flagella), pili, hami and cannulae. While expected to be energetically expensive to express, studies focused on the regulation of such structures are nevertheless lacking. In the current issue of Molecular Microbiology, Reimann et al. (2012) identified a two-partner system called ArnA and ArnB in Sulfolobus acidocaldarius that interact strongly with each other and are repressors of archaella expression while also having an enhancing effect on the appearance of type IV pili. ArnA is a forkhead-associated domain-containing protein while ArnB is a von Willebrand domain-containing protein. Both proteins can be phosphorylated in vitro by S. acidocaldarius protein kinases. The repression of archaella expression is dependent on dephosphorylation of the Arn proteins. Deletions of arnA or arnB resulted in increased levels of archaella operon proteins and cells that were hypermotile due to increased archaellation. Direct effects of ArnA/ArnB on transcription from fla promoters were demonstrated using arnA and arnB deletion strains but only a modest increase in transcription was demonstrated in each mutant suggesting that the repression effect observed may be due to protein-protein interactions. This paper represents a significant step forward in our understanding of archaeal surface structure biogenesis.

Effect of iacP Mutation on Flagellar Phase Variation in Salmonella enterica Serovar Typhimurium Strain UK-1

Flagella are surface appendages that are important for bacterial motility and invasion of host cells. Two flagellin subunits in Salmonella enterica serovar Typhimurium, FliC and FljB, are alternatively expressed by a site-specific DNA inversion mechanism called flagellar phase variation. Although this inversion mechanism is understood at the molecular level, the key factor controlling the expression of the two flagellin subunits has not been determined. In this study, we found that a putative acyl carrier protein, IacP, affects flagellar phase variation in S. Typhimurium strain UK-1 under Salmonella pathogenicity island 1 (SPI1)-inducing conditions. Liquid chromatography-mass spectrometry analysis of the secreted proteins from S. Typhimurium determined that the amount of FljB secreted was significantly higher in the iacP mutant strain, a finding confirmed by Western blot analysis. Northern blotting, quantitative PCR, and microarray data showed that the level of FljB in the iacP mutant strain was regulated at the transcriptional level, although the transcription and expression of the fliC gene were independent of IacP. FljB production was abolished by the deletion of the Hin DNA invertase but could be restored by the introduction of a plasmid carrying the hin gene. We also found that in the iacP mutant strain, the orientation of the invertible H segment is in the FljB-expressing phase. Furthermore, electron microscopy observations indicated that the iacP mutant strain had more flagella per cell than the wild-type strain. These results suggest that IacP is associated with flagellar phase switching under SPI1-inducing conditions.

Outer Membrane Targeting, Ultrastructure, and Single Molecule Localization of the Enteropathogenic Escherichia coli Type IV Pilus Secretin BfpB

Type IV pili (T4P) are filamentous surface appendages required for tissue adherence, motility, aggregation, and transformation in a wide array of bacteria and archaea. The bundle-forming pilus (BFP) of enteropathogenic Escherichia coli (EPEC) is a prototypical T4P and confirmed virulence factor. T4P fibers are assembled by a complex biogenesis machine that extrudes pili through an outer membrane (OM) pore formed by the secretin protein. Secretins constitute a superfamily of proteins that assemble into multimers and support the transport of macromolecules by four evolutionarily ancient secretion systems: T4P, type II secretion, type III secretion, and phage assembly. Here, we determine that the lipoprotein transport pathway is not required for targeting the BfpB secretin protein of the EPEC T4P to the OM and describe the ultrastructure of the single particle averaged structures of the assembled complex by transmission electron microscopy. Furthermore, we use photoactivated localization microscopy to determine the distribution of single BfpB molecules fused to photoactivated mCherry. In contrast to findings in other T4P systems, we found that BFP components predominantly have an uneven distribution through the cell envelope and are only found at one or both poles in a minority of cells. In addition, we report that concurrent mutation of both the T4bP secretin and the retraction ATPase can result in viable cells and found that these cells display paradoxically low levels of cell envelope stress response activity. These results imply that secretins can direct their own targeting, have complex distributions and provide feedback information on the state of pilus biogenesis.

The influence of ionic strength on the adhesive bond stiffness of oral streptococci possessing different surface appendages as probed using AFM and QCM-D

Bacterial adhesion to surfaces poses threats to human-health, not always associated with adhering organisms, but often with their detachment causing contamination elsewhere. Bacterial adhesion mechanisms may not be valid for their detachment, known to proceed according to a visco-elastic mechanism. Here we aimed to investigate influences of ionic strength on the adhesive bond stiffness of two spherically shaped Streptococcus salivarius strains with different lengths of fibrillar surface appendages. The response of a Quartz-Crystal-Microbalance-with-Dissipation (QCM-D) upon streptococcal adhesion and changes in the ionic strength of the surrounding fluid indicated that the bond stiffness of S. salivarius HB7, possessing a dense layer of 91 nm long fibrils, was unaffected by ionic strength. Atomic-force-microscopic (AFM) imaging in PeakForce-QNM mode showed a small decrease in bond stiffness from 1200 to 880 kPa upon decreasing ionic strength from 57 to 5.7 mM, while Total-Internal-Reflection-Microscopy suggested a complete collapse of fibrils. S. salivarius HBV51, possessing a less dense layer of shorter (63 nm) fibrils, demonstrated a strong decrease in bond stiffness both from QCM-D and AFM upon decreasing the ionic strength, and a partial collapse of fibrils. Probably, the more hydrophobic and less negatively charged long fibrils on S. salivarius HB7 collapse side-on to the cell surface, while the more hydrophilic and negatively charged fibrils of S. salivarius HBV51 remain partially stretched. In summary, we demonstrate how a combination of different methods can yield a description of the structural changes occurring in the interfacial region between adhering, fibrillated streptococci and a substratum surface upon changing the ionic strength.

Nanoscale imaging of Bacillus thuringiensis flagella using atomic force microscopy

Because bacterial flagella play essential roles in various processes (motility, adhesion, host interactions, secretion), studying their expression in relation to function is an important challenge. Here, we use atomic force microscopy (AFM) to gain insight into the nanoscale surface properties of two wild-type and four mutant strains of Bacillus thuringiensis exhibiting various levels of flagellation. We show that, unlike AFM in liquid, AFM in air is a simple and reliable approach to observe the morphological details of the bacteria, and to quantify the density and dimensions of their flagella. We found that the amount of flagella expressed by the six strains, as observed at the nanoscale, correlates with their microscopic swarming motility. These observations provide novel information on flagella expression in gram-positive bacteria and demonstrate the power of AFM in genetic studies for the fast assessment of the phenotypic characteristics of bacterial strains altered in cell surface appendages.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Influence of cell surface structures on crenarchaeal biofilm formation using a thermostable green fluorescent protein

The thermoacidophilic crenarchaeote Sulfolobus acidocaldarius displays three distinct type IV pili-like structures on its surface: (i) the flagellum, (ii) the UV-induced pili and (iii) the adhesive pili. In bacteria, surface appendages play an important role in the spatial organization of cells from initial surface attachment to the development of mature community structures. To investigate the influence of the diverse set of type IV pili-like structures in S. acidocaldarius, single, double and triple mutants lacking the cell surface appendages were constructed and analysed for their behaviour in attachment assays and during biofilm formation. A heat stable green fluorescent protein was employed the first time in a hyperthermophilic archaeon. A codon adjusted eCGP123 was expressed to study mixed biofilms of different deletion mutants to understand the interplay of the surface structures during biofilm formation. During this process the deletion of the adhesive pili and UV-induced pili led to the most pronounced effects, either an increase in cell density or increased cluster formation respectively. However, all three cell surface appendages played a role in the colonization of surfaces and only the interplay of all three appendages leads to the observed wild-type biofilm phenotype.

Involvement of Type IV Pili in Pathogenicity of Plant Pathogenic Bacteria.

Type IV pili (T4P) are hair-like appendages found on the surface of a wide range of bacteria belonging to the β-, γ-, and δ-Proteobacteria, Cyanobacteria and Firmicutes. They constitute an efficient device for a particular type of bacterial surface motility, named twitching, and are involved in several other bacterial activities and functions, including surface adherence, colonization, biofilm formation, genetic material uptake and virulence. Tens of genes are involved in T4P synthesis and regulation, with the majority of them being generally named pil/fim genes. Despite the multiple functionality of T4P and their well-established role in pathogenicity of animal pathogenic bacteria, relatively little attention has been given to the role of T4P in plant pathogenic bacteria. Only in recent years studies have begun to examine with more attention the relevance of these surface appendages for virulence of plant bacterial pathogens. The aim of this review is to summarize the current knowledge about T4P genetic machinery and its role in the interactions between phytopathogenic bacteria and their plant hosts.

Susceptibility of piglets to enterotoxigenic Escherichia coli is not related to the expression of MUC13 and MUC20

Enterotoxigenic Escherichia coli (ETEC) is one of the most frequently isolated enteropathogens in production animals, especially pigs and calves. Economically, the swine industry is by far the most affected by infections with ETEC because of mortality, morbidity and decreased growth rate of newborn and early-weaned piglets. After ingestion by the animal, these bacteria attach themselves to specific receptors on the small intestinal epithelium by means of proteinaceous surface appendages, the fimbriae. The F4 fimbriae, which attach to the F4 receptor, are the most studied. The aim of our study was to investigate gene expression in the small intestine of piglets of MUC13 and MUC20 in relation to animals with a different treatment towards or a different reaction on ETEC-F4ac by means of quantitative reverse transcription chain reaction (qRT/PCR). MUC13 and MUC20 are positional candidate genes for this F4ac receptor and are located in the region on SSC13q41 that segregates with the susceptibility to ETEC-F4ac. The condition of the small intestine is crucial when examining expression differences between different samples. Therefore, the expression of two genes, fatty-acid binding protein 2, intestinal (FABP2) and pancreatitis-associated protein (PAP), now known as regenerating islet-derived 3 alpha (REG3A) in the small intestine was simultaneously checked. FABP2, a standard for epithelial content, reflects the state of damage, whereas REG3A is a measure for inflammation in the small intestine. The four different substudies presented here suggest that expression of MUC13 and MUC20 is not related to the susceptibility of piglets to ETEC-F4ac.

Bacterial Pili exploit integrin machinery to promote immune activation and efficient blood-brain barrier penetration.

Group B Streptococcus (GBS) is the leading cause of meningitis in newborn infants. Bacterial cell surface appendages, known as pili, have been recently described in streptococcal pathogens, including GBS. The pilus tip adhesin, PilA, contributes to GBS adherence to blood-brain barrier (BBB) endothelium; however, the host receptor and the contribution of PilA in central nervous system (CNS) disease pathogenesis are unknown. Here we show that PilA binds collagen, which promotes GBS interaction with the α2β1 integrin resulting in activation of host chemokine expression and neutrophil recruitment during infection. Mice infected with the PilA-deficient mutant exhibit delayed mortality, a decrease in neutrophil infiltration and bacterial CNS dissemination. We find that PilA-mediated virulence is dependent on neutrophil influx as neutrophil depletion results in a decrease in BBB permeability and GBS–BBB penetration. Our results suggest that the bacterial pilus, specifically the PilA adhesin, has a dual role in immune activation and bacterial entry into the CNS.

Correction: Bacterial Surface Appendages Strongly Impact Nanomechanical and Electrokinetic Properties of Escherichia coli Cells Subjected to Osmotic Stress

Figure 4 was erroneously uploaded as a duplicate of Figure 3. The correct Figure 4 can be viewed here:

Distinct Cell Surface Appendages Produced by Sinorhizobium fredii USDA257 and S. fredii USDA191, Cultivar-Specific and Nonspecific Symbionts of Soybean

Sinorhizobium fredii USDA257 and S. fredii USDA191 are fast-growing rhizobia that form nitrogen-fixing nodules on soybean roots. In contrast to USDA191, USDA257 exhibits cultivar specificity and can form nodules only on primitive soybean cultivars. In response to flavonoids released from soybean roots, these two rhizobia secrete nodulation outer proteins (Nop) to the extracellular milieu through a type III secretion system. In spite of the fact that Nops are known to regulate legume nodulation in a host-specific manner, very little is known about the differences in the compositions of Nops and surface appendages elaborated by USDA191 and USDA257. In this study we compared the Nop profiles of USDA191 and USDA257 by one-dimensional (1D) and 2D gel electrophoresis and identified several of these proteins by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and liquid chromatography-tandem MS (LC-MS/MS). Examination of the surface appendages elaborated by these two strains of soybean symbionts by transmission electron microscopy revealed distinct differences in their morphologies. Even though the flagella produced by USDA191 and USDA257 were similar in their morphologies, they differed in their flagellin composition. USDA257 pili resembled long thin filaments, while USDA191 pili were short, rod shaped, and much thinner than the flagella. 2D gel electrophoresis of pilus-like appendages of USDA191 and USDA257 followed by mass spectrometry resulted in the identification of several of the Nops along with some proteins previously undetected in these strains. Some of the newly identified proteins show homology to putative zinc protease and a LabA-like protein from Bradyrhizobium sp. ORS278, fimbrial type 4 assembly proteins from Ralstonia solanacearum, and the type III effector Hrp-dependent protein from Rhizobium leguminosarum bv. trifolii.

Bacterial surface appendages strongly impact nanomechanical and electrokinetic properties of Escherichia coli cells subjected to osmotic stress.

The physicochemical properties and dynamics of bacterial envelope, play a major role in bacterial activity. In this study, the morphological, nanomechanical and electrohydrodynamic properties of Escherichia coli K-12 mutant cells were thoroughly investigated as a function of bulk medium ionic strength using atomic force microscopy (AFM) and electrokinetics (electrophoresis). Bacteria were differing according to genetic alterations controlling the production of different surface appendages (short and rigid Ag43 adhesins, longer and more flexible type 1 fimbriae and F pilus). From the analysis of the spatially resolved force curves, it is shown that cells elasticity and turgor pressure are not only depending on bulk salt concentration but also on the presence/absence and nature of surface appendage. In 1 mM KNO3, cells without appendages or cells surrounded by Ag43 exhibit large Young moduli and turgor pressures (∼700–900 kPa and ∼100–300 kPa respectively). Under similar ionic strength condition, a dramatic ∼50% to ∼70% decrease of these nanomechanical parameters was evidenced for cells with appendages. Qualitatively, such dependence of nanomechanical behavior on surface organization remains when increasing medium salt content to 100 mM, even though, quantitatively, differences are marked to a much smaller extent. Additionally, for a given surface appendage, the magnitude of the nanomechanical parameters decreases significantly when increasing bulk salt concentration. This effect is ascribed to a bacterial exoosmotic water loss resulting in a combined contraction of bacterial cytoplasm together with an electrostatically-driven shrinkage of the surface appendages. The former process is demonstrated upon AFM analysis, while the latter, inaccessible upon AFM imaging, is inferred from electrophoretic data interpreted according to advanced soft particle electrokinetic theory. Altogether, AFM and electrokinetic results clearly demonstrate the intimate relationship between structure/flexibility and charge of bacterial envelope and propensity of bacterium and surface appendages to contract under hypertonic conditions.

Analyses of Soluble and Membrane Proteomes of Ralstonia eutropha H16 Reveal Major Changes in the Protein Complement in Adaptation to Lithoautotrophy

The soil-dwelling lithoautotrophic bacterium Ralstonia eutropha H16 utilizes hydrogen as the key source of energy during aerobic growth on hydrogen and carbon dioxide. We examined the soluble and membrane protein complements of lithoautotrophically grown cells and compared them to the protein complements of cells grown organoheterotrophically on succinate. (14)N/(15)N-based inverse metabolic labeling in combination with GeLC-MS led to the identification of 1452 proteins, 1174 of which could be quantitated. Far more proteins were found to be more abundant in the lithoautotrophically than in the organoheterotrophically grown cells. In addition to the induction of the key enzymes of hydrogen oxidation and carbon dioxide fixation, we observed several characteristic alterations in the proteome correlated with lithoautotrophic growth. (I) Genes for three terminal oxidases were upregulated. (II) NAD(P) transhydrogenase and enzymes for the accumulation of poly(3-hydroxybutyrate) (PHB) showed increased protein abundance. (III) Lithoautotrophically grown cells were equipped with an enhanced inventory of transport systems. (IV) The expression of cell surface appendages involved in cell movement was markedly increased, while proteins involved in cell adhesion were decreased. Our data show that the hydrogen-based lifestyle of R. eutropha H16 relies on an extensive protein repertoire adapting the organism to the alternative energy and carbon sources.

Flagella and pili are both necessary for efficient attachment of Methanococcus maripaludis to surfaces

Methanococcus maripaludis has two surface appendages, namely flagella and pili. Flagella have been shown to be required for swimming, but no specific role has been assigned as yet to pili. In this report, wild-type M. maripaludis cells are compared with mutants lacking either pili or flagella or both surface appendages in their ability to attach to a variety of surfaces including nickel, gold and molybdenum grids as well as glass, silicon and mica. Wild-type cells attached to varying degrees to all surfaces tested, except mica, via their flagella as observed by scanning electron microscopy. Large cables of flagella were found to leave the cell and to be unwound on the surface. In addition, such cables were often found to connect cells. In contrast, cells lacking either flagella or pili or both surface appendages were unable to attach efficiently to any surfaces. This indicates a second role for flagella in addition to swimming in M. maripaludis, as well as a first role for pili in this organism, namely in surface attachment.

Multifaceted microbes

Multifaceted microbes

Comparative analyses of the Moraxella catarrhalis type-IV pilus structural subunit PilA

Moraxella catarrhalis is a Gram-negative aerobic diplococcus that is a mucosal pathogen of the upper and lower respiratory tracts in humans. In order to colonize the human host and establish an infection, M. catarrhalis must be able to effectively attach to the respiratory mucosal epithelia. Although little is known about M. catarrhalis pathogenesis, our laboratory has previously shown that expression of type IV pili (TFP) contributes to mucosal colonization. TFP are filamentous surface appendages primarily composed of a single protein subunit termed pilin, which is encoded by pilA in M. catarrhalis. These surface structures play a crucial role in the initiation of disease by a wide range of pathogenic bacteria. Our studies also indicate that unlike the pilin of the pathogenic Neisseria species, which exhibit both phase and antigenic variation, the pilin subunit of M. catarrhalis appears to be more highly conserved as there are no major pilin variants produced by a single strain and only two major PilA antigenic variants, termed clade 1 and clade 2, have been observed between strains. Moreover, we have determined that these highly conserved bacterial surface structures are expressed by all M. catarrhalis clinical isolates evaluated. Therapeutic or vaccine-based interventions that prevent or diminish nasopharyngeal colonization will likely decrease acute and recurrent M. catarrhalis infections in prone populations. Thus, our data indicate that additional studies aimed at elucidating the role of PilA in the pathogenesis and host response to M. catarrhalis infections are warranted.

The Mode of Cell Wall Growth in Selected Archaea Is Similar to the General Mode of Cell Wall Growth in Bacteria as Revealed by Fluorescent Dye Analysis

The surfaces of 8 bacterial and 23 archaeal species, including many hyperthermophilic Archaea, could be stained using succinimidyl esters of fluorescent dyes. This allowed us for the first time to analyze the mode of cell wall growth in Archaea by subculturing stained cells. The data obtained show that incorporation of new cell wall material in Archaea follows the pattern observed for Bacteria: in the coccoid species Pyrococcus furiosus incorporation was in the region of septum formation while for the rod-shaped species Methanopyrus kandleri and Methanothermus sociabilis, a diffuse incorporation of cell wall material over the cell length was observed. Cell surface appendages like fimbriae/pili, fibers, or flagella were detectable by fluorescence staining only in a very few cases although their presence was proven by electron microscopy. Our data in addition prove that Alexa Fluor dyes can be used for in situ analyses at temperatures up to 100°C.

When whorls collide: the development of hair patterns in frizzled 6 mutant mice.

Surface appendages such as bristles, feathers and hairs exhibit both long- and short-range order. In the frizzled 6 null (Fz6(-/-)) mouse the orientations of the earliest born hair follicles are uncorrelated, but over time the follicles reorient to create patterns that are characterized by a high degree of local order. By quantifying follicle orientations over time, in both living and fixed tissues, we define the time course of local hair follicle refinement and the resulting evolution of a montage of competing patterns in Fz6(-/-) skin. We observe an apparently local process that within one week can organize a field of many tens of thousands of follicles, generating long-range order that extends over distances of more than one centimeter. Physical systems that undergo an analogous ordering of vector components suggest potential mechanisms that might apply to the patterning of hair follicles and related biological structures.

Economical Evolution: Microbes Reduce the Synthetic Cost of Extracellular Proteins

Protein evolution is not simply a race toward improved function. Because organisms compete for limited resources, fitness is also affected by the relative economy of an organism’s proteome. Indeed, many abundant proteins contain relatively high percentages of amino acids that are metabolically less taxing for the cell to make, thus reducing cellular cost. However, not all abundant proteins are economical, and many economical proteins are not particularly abundant. Here we examined protein composition and found that the relative synthetic cost of amino acids constrains the composition of microbial extracellular proteins. In Escherichia coli, extracellular proteins contain, on average, fewer energetically expensive amino acids independent of their abundance, length, function, or structure. Economic pressures have strategically shaped the amino acid composition of multicomponent surface appendages, such as flagella, curli, and type I pili, and extracellular enzymes, including type III effector proteins and secreted serine proteases. Furthermore, in silico analysis of Pseudomonas syringae, Mycobacterium tuberculosis, Saccharomyces cerevisiae, and over 25 other microbes spanning a wide range of GC content revealed a broad bias toward more economical amino acids in extracellular proteins. The synthesis of any protein, especially those rich in expensive aromatic amino acids, represents a significant investment. Because extracellular proteins are lost to the environment and not recycled like other cellular proteins, they present a greater burden on the cell, as their amino acids cannot be reutilized during translation. We hypothesize that evolution has optimized extracellular proteins to reduce their synthetic burden on the cell.