Inhibition Of Airway Hyperresponsiveness Research Articles

Inhibition of airway hyperresponsiveness and pulmonary inflammation by roflumilast and other PDE4 inhibitors

Roflumilast is an oral, once-daily phosphodiesterase 4 (PDE4) inhibitor with anti-inflammatory activity. We compared the anti-inflammatory effects of roflumilast with those of PDE4 inhibitors rolipram, piclamilast, and cilomilast in ovalbumin (OVA)-sensitized and challenged Brown-Norway rats. Animals were treated orally 1 h before OVA challenge with roflumilast (0.3, 1.0, and 3.0 mg/kg), rolipram (0.8, 2.8, and 8.3 mg/kg), piclamilast (10.0, 20.0, and 30.0 mg/kg), or cilomilast (10.3, 34.3, and 103.0 mg/kg). Airway hyperresponsiveness (AHR) against adenosine was investigated by measuring airway resistance 200 min after OVA challenge. Subsequently, neutrophil influx and tumor necrosis factor-alpha (TNF- α) release in the lungs were determined by bronchoalveolar lavage. Direct bronchodilation at the time point of AHR assessment by PDE4 inhibitors was examined in serotonin-challenged animals. Evaluation of neutropenic animals or treatment with anti-TNF- α antibody revealed that AHR was independent of neutrophil accumulation or TNF- α release. Roflumilast (50% inhibitory dose [ID 50]=1.5 mg/kg) inhibited AHR 3-, 16-, and 27-fold more potently than rolipram, piclamilast, and cilomilast, respectively. Likewise, roflumilast was a more potent inhibitor of neutrophil influx (ID 50=0.9 mg/kg) than rolipram (ID 50=6.9 mg/kg), piclamilast (ID 50=28.1 mg/kg), or cilomilast (ID 50=37.7 mg/kg). Roflumilast, rolipram, and piclamilast—but not cilomilast—suppressed OVA-induced TNF- α release in a dose-dependent manner. Roflumilast (ID 50=0.9 mg/kg) exhibited 9- and 23-fold more potent inhibition of TNF- α release than rolipram and piclamilast, respectively. Roflumilast did not inhibit serotonin-induced bronchoconstriction 4.5 h after administration, suggesting that inhibition of AHR by roflumilast results from anti-inflammatory, not bronchodilatory, effects. This study suggests that roflumilast has anti-inflammatory action and provides rationale for the investigation of roflumilast in asthmatic patients.

TNF-α induces the late-phase airway hyperresponsiveness and airway inflammation through cytosolic phospholipase A 2 activation

Late-phase airway hyperresponsiveness (AHR) in asthma is considered the event leading to persistent inflammation in the lungs, but the molecular mechanisms involved in this process are poorly understood. To examine the role of TNF-alpha in the development of a late AHR and airway inflammation in asthma. We established a murine model of asthma with not only biphasic AHR to methacholine but also airway eosinophilia. The effect of TNF-alpha blockade was determined by using anti-TNF-alpha antibody and TNF-alpha knockout mice. Cytosolic phospholipase A(2) (cPLA(2)) mRNA expression and activity were assessed by using RT-PCR and 1-stearoyl-2-[1-(14)C] arachidonyl-sn-glycero-3-phosphocholine as the substrate, respectively. TNF-alpha blockade resulted in significant inhibition of the late AHR without affecting the early AHR, and reduction in airway eosinophilia and inflammation. cPLA(2) activity was increased in asthmatic lungs in a TNF-alpha-dependent way, and cPLA(2) inhibitor blocked late AHR and airway eosinophilia. TNF-alpha also stimulated the synthesis of cPLA(2) metabolites such as leukotriene B(4) and platelet-activating factor in the airway. Specific inhibitors of cPLA(2) metabolites inhibited the late AHR and airway eosinophilia. TNF-alpha is the proximal key cytokine capable of developing late-phase AHR and subsequent airway inflammation through expression/activation of cPLA(2).

Thioredoxin suppresses airway hyperresponsiveness and airway inflammation in asthma

Thioredoxin (TRX) is a 12-kDa redox (reduction/oxidation)-active protein that has a highly conserved site (-Cys-Gly-Pro-Cys-) and scavenges reactive oxygen species. Here we examined whether exogenously administered TRX modulated airway hyperresponsiveness (AHR) and airway inflammation in a mouse asthma model. Increased AHR to inhaled acetylcholine and airway inflammation accompanied by eosinophilia were observed in OVA-sensitized mice. Administration of wild-type but not 32S/35S mutant TRX strongly suppressed AHR and airway inflammation, and upregulated expression of mRNA of several cytokines (e.g., IL-1α, IL-1β, IL-1 receptor antagonist, and IL-18) in the lungs of OVA-sensitized mice. In contrast, TRX treatment at the time of OVA sensitization did not improve AHR or airway inflammation in OVA-sensitized mice. Thus, TRX inhibited the asthmatic response after sensitization, but did not prevent sensitization itself. TRX and redox-active protein may have clinical benefits in patients with asthma.

α-Galactosylceramide, a Ligand of Natural Killer T Cells, Inhibits Allergic Airway Inflammation

alpha-Galactosylceramide (alpha-GalCer) is a specific ligand of natural killer T cells (NKT cells) that regulates the immune responses such as tumor rejection and autoimmunity by producing interferon (IFN)-gamma and interleukin (IL)-4. However, it has not been determined whether alpha-GalCer-activated NKT cells modulate allergic inflammation. Because alpha-GalCer induces a large amount of IFN-gamma production by NKT cells, we hypothesized that an in vivo administration of alpha-GalCer could inhibit allergic airway inflammation in mice. Strikingly, a single intraperitoneal injection of alpha-GalCer almost completely abrogated an infiltrate with eosinophils in the lung tissue as well as in the bronchoalveolar lavage. This inhibition of allergic inflammation was associated with a significant decrease in the levels of IL-4, IL-5, and IL-13 in bronchoalveolar lavage fluid and in the number of goblet cells. In addition, this ligand significantly inhibited airway hyperresponsiveness to inhaled methacholine and raised the serum levels of ovalbumin-specific IgG2a with a decrease in those of ovalbumin-specific IgE. In IFN-gamma knockout mice, however, alpha-GalCer failed to exert such inhibitory effects in this asthma model. These results indicate that alpha-GalCer prevents allergic airway inflammation possibly through IFN-gamma production by ligand-activated NKT cells, suggesting the potential therapeutic application of alpha-GalCer in asthma.

Mismatched Antigen Prepares γδ T Cells for Suppression of Airway Hyperresponsiveness

Gammadelta T cells suppress airway hyperresponsiveness (AHR) induced in allergen-challenged mice but it is not clear whether the suppression is allergen specific. The AHR-suppressive cells express TCR-Vgamma4. To test whether the suppressive function must be induced, we adoptively transferred purified Vgamma4(+) cells into gammadelta T cell-deficient and OVA-sensitized and -challenged recipients (B6.TCR-Vgamma4(-/-)/6(-/-)) and measured the effect on AHR. Vgamma4(+) gammadelta T cells isolated from naive donors were not AHR-suppressive, but Vgamma4(+) cells from OVA-stimulated donors suppressed AHR. Suppressive Vgamma4(+) cells could be isolated from lung and spleen. Their induction in the spleen required sensitization and challenge. In the lung, their function was induced by airway challenge alone. Induction of the suppressors was associated with their activation but it did not alter their ability to accumulate in the lung. Vgamma4(+) gammadelta T cells preferentially express Vdelta4 and -5 but their AHR-suppressive function was not dependent on these Vdeltas. Donor sensitization and challenge not only with OVA but also with two unrelated allergens (ragweed and BSA) induced Vgamma4(+) cells capable of suppressing AHR in the OVA-hyperresponsive recipients, but the process of sensitization and challenge alone (adjuvant and saline only) was not sufficient to induce suppressor function, and LPS as a component of the allergen was not essential. We conclude that AHR-suppressive Vgamma4(+) gammadelta T cells require induction. They are induced by allergen stimulation, but AHR suppression by these cells does not require their restimulation with the same allergen.

Pharmacological Targeting of Anaphylatoxin Receptors during the Effector Phase of Allergic Asthma Suppresses Airway Hyperresponsiveness and Airway Inflammation

Airway hyperresponsiveness and airway inflammation are hallmarks of allergic asthma, the etiology of which is crucially linked to the presence of Th2 cytokines. A role for the complement anaphylatoxins C3a and C5a in allergic asthma was suggested, as deficiencies of the C3a receptor (C3aR) and of complement factor C5 modulate airway hyperresponsiveness, airway inflammation, and Th2 cytokine levels. However, such models do not allow differentiation of effects on the sensitization phase and the effector phase of the allergic response, respectively. In this study, we determined the role of the anaphylatoxins on the effector phase of asthma by pharmacological targeting of the anaphylatoxin receptors. C3aR and C5a receptor (C5aR) signaling was blocked using the nonpeptidic C3aR antagonist SB290157 and the neutralizing C5aR mAb 20/70 in a murine model of Aspergillus fumigatus extract induced pulmonary allergy. Airway hyperresponsiveness was substantially improved after C5aR blockade but not after C3aR blockade. Airway inflammation was significantly reduced in mice treated with the C3aR antagonist or the anti-C5aR mAb, as demonstrated by reduced numbers of neutrophils and eosinophils in bronchoalveolar lavage fluid. Of note, C5aR but not C3aR inhibition reduced lymphocyte numbers in bronchoalveolar lavage fluid. Cytokine levels of IL-5 and IL-13 in bronchoalveolar lavage fluid were not altered by C3aR or C5aR blockade. However, blockade of both anaphylatoxin receptors markedly reduced IL-4 levels. These data suggest an important and exclusive role for C5aR signaling on the development of airway hyperresponsiveness during pulmonary allergen challenge, whereas both anaphylatoxins contribute to airway inflammation and IL-4 production.

Suplatast Tosilate Alters DC1/DC2 Balance in Peripheral Blood in Bronchial Asthma

Suplatast tosilate is an antiallergic drug that selectively suppresses Th2-cytokine production and inhibits airway hyperresponsiveness and eosinophilic airway inflammation. This drug has been also shown to improve pulmonary function and symptoms in steroid-dependent asthma, resulting in a decrease in doses of inhaled corticosteroid. However, the precise mechanism by which suplatast tosilate exerts an antiasthmatic effect in vivo remains to be known. Our previous study showed the polarization of circulating type 1 dendritic cells (DC1)/type 2 dendritic cells (DC2) balance toward DC2 in asthma, which might be associated with its Th2-dominant immune response. In the present study, we attempted to clarify the effect of suplatast tosilate on DC1/DC2 balance in asthma. Using multicolor flow cytometry, we enumerated circulating DC1 and DC2 before and 8 weeks after treatment with suplatast tosilate in nine patients with asthma. Before the treatment, the patients with asthma had a significant higher percentage of DC2 together with a significant lower ratio of DC1/DC2 compared with normal subjects. Administration of suplatast tosilate significantly decreased the percentage of DC2, but not that of DC1, resulting in a significant raises of the ratio of DC1/DC2. Concomitantly, intracellular cytokine analysis showed that the percentage of IL-4 producing CD4+ T cells was significantly decreased after the treatment. These data suggest that suplatast tosilate normalizes the polarized DC1/DC2 balance toward DC2 in asthma, which may also alter its Th2-dominant Th1/Th2 balance toward Th1.

Different roles of interleukin‐10 in onset and resolution of asthmatic responses in allergen‐challenged mice

Although interleukin (IL)-10 is an immunoregulatory cytokine produced by various cells including T cells, its precise role in asthma remains uncertain. The aim of this study was to investigate the role of IL-10 in experimental asthma using ovalbumin (OVA)-sensitized mice. Mice were challenged with OVA aerosol, and airway responsiveness and inflammation were measured. OVA-specific IL-10-producing CD4+ T cells were counted from lung cells collected by enzymatic digestion and stimulated ex vivo with OVA. The effects of an anti-IL-10 antibody on airway responsiveness and inflammation were also evaluated. The OVA challenge caused airway hyperresponsiveness and eosinophilic inflammation. A significant increase in IL-10-producing CD4+ T cells was observed, mainly in the CD45RB(low) subset, for several days after the OVA challenge. Anti-IL-10 antibody treatment before the OVA challenge did not affect eosinophilic inflammation but significantly inhibited airway hyperresponsiveness 24 h after the OVA challenge. However, anti-IL-10 antibody treatment just before the last OVA challenge significantly attenuated the resolution of eosinophilic inflammation without affecting airway responsiveness 2 weeks after the OVA challenge. Intrinsic IL-10 may have a distinct role in the early and late phases of asthmatic responses. In the early phase, IL-10 induces airway hyperresponsiveness, while in the late phase IL-10 contributes to the resolution of eosinophilic inflammation.

Anti-IL-13 monoclonal antibody inhibits airway hyperresponsiveness, inflammation and airway remodeling

Asthma is a chronic inflammatory disease characterized by reversible bronchial constriction, pulmonary inflammation and airway remodeling. Current standard therapies for asthma provide symptomatic control but fail to target the underlying disease pathology. Furthermore, no therapeutic agent is effective in preventing airway remodeling. Interleukin 13 (IL-13) is a pleiotropic cytokine produced mainly by T cells. A substantial amount of evidence suggests that IL-13 plays a critical role in the pathogenesis of asthma. Therefore, a neutralizing anti-IL-13 monoclonal antibody could provide therapeutic benefits to asthmatic patients. To test the concept we have generated a neutralizing rat anti-mouse IL-13 monoclonal antibody, and evaluated its effects in a chronic mouse model of asthma. Chronic asthma-like response was induced in ovalbumin (OVA) sensitized mice by repeated intranasal OVA challenges. After weeks of challenge, mice developed airway hyperresponsiveness (AHR) to methacholine stimulation, severe airway inflammation, hyper mucus production, and subepithelial fibrosis. When given at the time of each intranasal OVA challenge, anti-IL-13 antibody significantly suppressed AHR, eosinophil infiltration, proinflammatory cytokine/chemokine production, serum IgE, and most interestingly, airway remodeling. Taken together, these results strongly suggest that a neutralizing anti-human IL-13 monoclonal antibody could be an effective therapeutic agent for asthma.

Nociceptin inhibits vanilloid TRPV-1-mediated neurosensitization induced by fenoterol in human isolated bronchi.

Chronic exposure to beta(2)-adrenoceptor agonists, especially fenoterol, has been shown to increase smooth muscle contraction to endothelin-1 in human bronchi partly through tachykinin-mediated pathways. The purpose of this work was to further investigate the role of sensory nerves in fenoterol-induced sensitization of human airways and the effect of nociceptin, a nociceptin/orphanin FQ (NOP) receptor agonist, on the increase in contraction after fenoterol exposure. Human bronchi from 62 patients were sensitized to endothelin-1 by prolonged incubation with fenoterol (0.1 microM, 15 h). The sensitizing effect of fenoterol was inhibited by high concentration of capsaicin (10 microM, 30 min before fenoterol sensitization), which induces depletion of mediators from sensory nerves, or co-incubation of fenoterol and capsazepine (1 microM), a vanilloid TRPV-1 receptor antagonist. Moreover, short pretreatment of bronchi with capsaicin (10 microM) or capsazepine (1 microM) after sensitization by fenoterol decreased the rise in smooth muscle contraction to endothelin-1. Nociceptin (1 microM) also inhibited the increased contraction in fenoterol-sensitized bronchi. Tertiapin (10 microM), an inhibitor of the inward-rectifier K(+) channels, but not naloxone (0.1 microM), a DOP/KOP/MOP receptor antagonist, prevented the inhibitory effect of nociceptin. In conclusion, fenoterol induces sensitization of human isolated bronchi to endothelin-1 in part through the stimulation of the vanilloid TRPV-1 receptor on tachykininergic sensory nerves. Nociceptin inhibits airway hyperresponsiveness via NOP receptor activation. This effect involves inward-rectifier K(+) channels.

The effect of CpG-oligodeoxynucleotides with different backbone structures and 3' hexameric deoxyriboguanosine run conjugation on the treatment of asthma in mice

Rationale 3' dG 6 run conjugation to CpG-ODN, which was injected at the time of sensitization, enhanced the protective effect against asthma. We examined treatment effect of CpG-ODN with different backbone and 3' dG 6 run on asthma in mice that were already sensitized. Methods BALB/c mice were sensitized with ovalbumin 20ug and alum 2mg by intraperitoneal injection on days 1, 14. The mice were challenged with 1% ovalbumin on days 21, 22, 23. As asthma phenotypes, airway hyperresponsiveness, BAL fluid analysis, serum ovalbumin-specific antibodies were evaluated. 100ug of CpG-ODN or PBS was injected 27 hours before the initial challenge and 3 hours before each challenge. (1826: TCCATGACGTTCCTGACGTT, T: phosphorothioate, D: phosphodiester, M21: 1826 with 3' dG6 run, M21E': 5' 3 nucleotides of M21D were phosphorothioate backboned). Results 1826T enhanced the production of OVA (ovalbumin)-specific IgG2a, decreased eosinophilic airway inflammation and inhibited airway hyperresponsiveness (IgG2a 142.1 ± 6.4 vs 36.2 ± 10.6 A.U., BAL eosinophil proportion: 4.2 ± 1.2 vs 70.7 ± 2.0%, PC200: 21.69 ± 3.20 vs 12.80 ± 2.00 mg/dL, p<.05). 1826D did not show any treatment effect. M21D enhanced the production of OVA-specific IgG2a. M21E' enhanced specific IgG2a production but also decreased BAL fluid eosinophils and airway hyperresponsivenss as 1826T (p>.05). M21T also enhanced the production of OVA-specific IgG2a and decreased BAL fluid eosinophils (not airway hyperresponsiveness) but the treatment effect was weaker than that of 1826T. Conclusions 3' dG 6 run conjugation enhances the immunogenecity of phosphodiester CpG-ODN but not phosphorothioate backbone CpG-ODN in the treatment of presensitized asthmatic mice.

Mycobacterium vaccae administration during allergen sensitization or challenge suppresses asthmatic features.

The hygiene hypothesis suggests that a lack of bacterial infections would favour the development of allergic disease. For this reason, bacteria or their components can be used as potential treatment for allergic asthma. We investigated whether heat-killed Mycobacterium vaccae is either able to suppress the induction of allergic asthma or able to suppress already established allergic asthma. Mice were sensitized with ovalbumin (OVA)/alum on days 0 and 14. Thereafter, mice were challenged on days 35, 39 and 42 by inhalation of either OVA or saline aerosols. M. vaccae-treated mice received an injection with 106, 107 or 108 CFU heat-killed M. vaccae on days 0 and 14 or 107 CFU on days 35 and 39. On day 43, the airway responsiveness of the mice to increasing concentrations of methacholine was assessed, blood was withdrawn to measure serum parameters, and lung lavage was performed to detect cytokines and inflammatory cell number. Treatment of OVA-sensitized mice with 107 CFU M. vaccae either during sensitization or challenge suppresses airway hyper-responsiveness, airway eosinophilia and IL-5 production after OVA challenge. The increases in OVA-specific serum IgE and in IL-4 by respiratory challenges with OVA were only diminished after M. vaccae treatment (107 CFU) during sensitization. Heat-killed M. vaccae prevents allergic and asthmatic manifestations in a mouse model and, more importantly, M. vaccae treatment during challenge suppresses features of asthma, which opens up possibilities for new therapeutic interventions.

Ca 2+ sensors modulate asthmatic symptoms in an allergic model for asthma

We previously described two novel peptides, Ca 2+-like peptide (CALP) 1 and CALP2, which interact with Ca 2+-binding EF hand motifs, and therefore have the characteristics to define the role of the Ca 2+-sensing regulatory protein calmodulin in asthma. In the present study, the effects of the calcium-like peptides were investigated in an animal model for allergic asthma. For that purpose, sensitized guinea pigs were intratracheally pretreated with CALP1 or CALP2. Thirty minutes later, the animals were challenged with aerosolized ovalbumin. Acute bronchoconstriction was measured as well as characteristic features of asthma 6 and 24 hours (h) after challenge. Neither CALP1 nor CALP2 prevented the anaphylactic response elicited by ovalbumin challenge. However, CALP1 pretreatment attenuated the influx of inflammatory cells in the lungs 6 h after challenge. Furthermore, radical production by these cells was diminished both 6 and 24 h after challenge. Moreover, CALP1 completely inhibited airway hyperresponsiveness in vitro 24 h after challenge. We conclude that CALP1, as a selective calmodulin agonist, inhibits the development of asthmatic features probably via the attenuation of mast cell degranulation and radical production. Specific modulation of calmodulin activity might therefore be a potential new target for the treatment of allergic asthma.

The Slc11a1 (Nramp1) gene controls efficacy of mycobacterial treatment of allergic asthma.

Genes controlling antibacterial resistance may be important in the hygiene hypothesis, which states that lack of bacterial infections during childhood would favor development of allergic disease. We, therefore, studied whether Nramp1 (Slc11a1) alleles, which determine susceptibility (Nramp1(s)) or resistance (Nramp1(r)) to intracellular bacteria, affect the efficacy of heat-killed Mycobacterium vaccae in the treatment of allergic asthma in a mouse model. Treatment of OVA-sensitized Nramp1(s) mice with M. vaccae suppressed airway hyperresponsiveness, airway eosinophilia, Ag-specific IgE, and IL-4 and IL-5 production after OVA aerosol challenge. In contrast, M. vaccae hardly affected these parameters in Nramp1(r) mice. In addition, The Nramp1 gene affected both T cell-mediated responses to M. vaccae in vivo and the level of macrophage activation after stimulation with M. vaccae in vitro. In conclusion, the efficacy of M. vaccae in preventing allergic and asthmatic manifestations in a mouse model is strongly affected by Nramp1 alleles. These findings could have important implications for the future use of mycobacteria and their components in the prevention or treatment of allergic asthma. A new link is described between genes, the environment, and the development of allergy, in which the Nramp1 gene fine tunes the hygiene hypothesis.

Inhibition of allergic airways inflammation and airway hyperresponsiveness in mice by dexamethasone: Role of eosinophils, IL-5, eotaxin, and IL-13

Background: Glucocorticoids inhibit allergen-induced airway eosinophilia and airway hyperresponsiveness (AHR). Whether glucocorticoids mediate their effects on AHR by inhibiting eotaxin and IL-5, 2 of the principal mediators of eosinophilia, or through IL-13, an important mediator of AHR, has not been established. Objective: We sought to investigate the effects of glucocorticoids on airway eosinophilia and the expression of IL-5, eotaxin, and IL-13 in relation to the induction of AHR in a murine model of allergic asthma. Methods: Dexamethasone (4 mg/kg) and mAbs against eotaxin (80 μg/kg) and IL-5 (100 μg/kg) singly and in combination were administered to immunized mice before antigen challenge. Airway responsiveness to methacholine was measured in anesthetized and mechanically ventilated animals. Eotaxin, IL-5, and IL-13 in bronchoalveolar lavage fluid (BALF), lung homogenates, or both were measured by means of ELISA. Results: A single antigen challenge induced AHR that lasted at least 10 days. Eotaxin protein and mRNA levels increased in lung tissue but not in BALF after challenge. IL-5 protein and mRNA levels increased both in BALF and in lung tissue. Dexamethasone reduced airway eosinophilia, AHR, and protein and mRNA for eotaxin and IL-5. Anti-murine eotaxin and anti-IL-5 antibodies alone and in combination reduced the ovalbumin-induced airway eosinophilia significantly but failed to inhibit AHR. Both dexa-methasone and anti-IL-5/anti-eotaxin inhibited the increases in lung IL-13 levels after ovalbumin challenge to a similar extent. Conclusion: These findings suggest that the inhibition of AHR by the glucocorticoid dexamethasone does not appear to be explained by effects on eosinophilia, eotaxin, IL-5, or IL-13. (J Allergy Clin Immunol 2003;111:1049-61.)

Exploring new approaches to the treatment of asthma: potential roles for lipoxins and aspirin-triggered lipid mediators.

The prevalence of asthma continues to increase and its optimal treatment remains a challenge. During asthma, leukotrienes and prostaglandins are generated in human airways, leading to bronchoconstriction and airway inflammation. Several pharmaceutical agents are currently available to inhibit the formation or action of these lipid mediators, but asthmatic individuals have heterogeneous and often incomplete therapeutic responses. Lipoxins are a class of eicosanoids distinct from leukotrienes and prostaglandins. Temporal analyses in experimental models of acute inflammation reveal early coordinate appearance of leukotrienes and prostaglandins followed by delayed lipoxin biosynthesis concurrent with resolution of the inflammatory response. Of interest, lipoxins display unique antiinflammatory actions and, in an experimental model of asthma, administration of a stable analog of 15-epi-lipoxin A(4) markedly decreased both airway hyperresponsiveness and inflammation. In addition, overexpression of human lipoxin A(4) (LXA(4)) receptors in murine leukocytes also protected animals from the development of airway inflammation. Inhibition of airway hyperresponsiveness and allergic airway inflammation with a LXA(4) stable analog highlights a unique counterregulatory profile for LXA(4) and its leukocyte receptor in airway responses and suggests that lipoxins and related pathways present novel multipronged therapeutic approaches for consideration in airway inflammation and human asthma.

Traditional Oriental Herbal Medicine, Bakumondo-to, Suppresses Vagal Neuro-effector Transmission in Guinea Pig Trachea

Objective. Bakumondo-to (Maimendong tang) is a traditional oriental herbal medicine that has been used as an antitussive agent. We previously demonstrated that Bakumondo-to attenuates airway hyperresponsiveness induced by ozone. However, the mechanism(s) responsible for this effect remains unclear. In the present study, we examined the mechanism whereby Bakumondo-to inhibits ozone-induced airway hyperresponsiveness. First, we examined the effect of Bakumondo-to on prostanoids production, which are key mediators to airway hyperresponsiveness after ozone exposure. Second, we studied its effects on the vagal neuroeffector transmission, because vagal nerve is likely to play an important role in airway hyperresponsiveness after ozone. Methods. We measured the effects of Bakumondo-to on the concentrations of prostanoids in bronchoalveolar lavage fluid before and after ozone. We evaluated the effects of Bakumondo-to on the contraction of guinea pig tracheal smooth muscle evoked by electrical field stimulation (EFS) or the exogenous application of acetylcholine (ACh). Isometric tension of tracheal strips was measured in the presence of indomethacin (10−6 M) and of guanethidine (10−6 M). Results. Ozone caused significant increase in prostaglandin E2 (PGE2) and thromboxane B2 (TXB2); however, Bakumondo-to did not affect the increase in these prostanoids. Bakumondo-to (0.01 mg/mL–1 mg/mL) significantly suppressed the contraction evoked by EFS, but did not affect the ACh-evoked contraction, indicating that Bakumondo-to suppressed tracheal smooth muscle contraction pre-junctionally. Conclusion. These results suggest that the mechanism by which Bakumondo-to inhibits airway hyperresponsiveness depends on inhibiting the release of acetylcholine from vagal nerve terminals.

An endothelin receptor antagonist, SB-217242, inhibits airway hyperresponsiveness in allergic mice.

Within the airways, endothelin-1 (ET-1) can exert a range of prominent effects, including airway smooth muscle contraction, bronchial obstruction, airway wall edema, and airway remodeling. ET-1 also possesses proinflammatory properties and contributes to the late-phase response in allergic airways. However, there is no direct evidence for the contribution of endogenous ET-1 to airway hyperresponsiveness in allergic airways. Allergic inflammation induced in mice by sensitization and challenge with the house dust mite allergen Der P1 was associated with elevated levels of ET-1 within the lung, increased numbers of eosinophils within bronchoalveolar lavage fluid and tissue sections, and development of airway hyperresponsiveness to methacholine (P < 0.05, n = 6 mice per group). Treatment of allergic mice with an endothelin receptor antagonist, SB-217242 (30 mg x kg(-1) x day(-1)), during allergen challenge markedly inhibited airway eosinophilia (bronchoalveolar lavage fluid and tissue) and development of airway hyperresponsiveness. These findings provide direct evidence for a mediator role for ET-1 in development of airway hyperresponsiveness and airway eosinophilia in Der P1-sensitized mice after antigen challenge.

Potential role of potassium channel openers in the treatment of asthma and chronic obstructive pulmonary disease

Airway smooth muscle (ASM) cells express various types of potassium (K +) channels which play a key role in determining the resting membrane potential, a relative electrical stability and the responsiveness to both contractile and relaxant agents. In addition, K + channels are also involved in modulation of neurotransmitter release from airway nerves. The most important K + channels identified in airways include large and small Ca 2+-activated, delayed-rectifier, and ATP-sensitive channels. These K + channels are structurally and functionally different, thus playing distinct roles in airway electrophysiology and pharmacology. Many in vitro and in vivo studies, performed in both animals and humans, have shown that K + channel openers are able to induce hyperpolarization of ASM cells, bronchodilation, suppression of airway hyperresponsiveness (AHR), and inhibition of neural reflexes. Therefore, airway K + channels represent a suitable pharmacological target for the development of new effective therapeutic options in the treatment of asthma and chronic obstructive pulmonary disease (COPD).

Perioperative corticosteroids for intermittent and mild persistent asthma

Asthmatics are considered to be at high risk for pulmonary complications during general anesthesia with tracheal intubation. The purpose of the present study was to determine the usefulness of perioperative corticosteroids for mild asthmatics in preventing perioperative exacerbation of asthma. Airway hyperresponsiveness to inhaled methacholine was determined in patients with intermittent (n = 27) and mild persistent (n = 48) asthma before general anesthesia who underwent surgery between January 1990 and January 1999. All patients were treated with corticosteroids during the perioperative period, consisting of a course of oral prednisolone 10–20 mg/day for 1–2 days pre-operatively, methylprednisolone 80–125 mg 2 h before the operation, followed by 80 mg methylprednisolone just after the operation. The incidence of perioperative bronchospasm was evaluated based on medical records. Airway hyperresponsiveness to inhaled methacholine was determined in six other asthmatics before and after a similar regimen of perioperative corticosteroids treatment. Only three cases (4.0%) developed mild asthma during the perioperative period. No evidence of adverse effects of corticosteroids was noted in any case. The use of the same therapeutic regimen in another six asthmatics significantly suppressed airway hyperresponsiveness to inhaled methacholine. Our results suggest that perioperative corticosteroids are effective in preventing perioperative bronchospasm in stable asthmatics during surgery under general anesthesia by suppressing airway hyperresponsiveness.