Support Nitrogen Fixation Research Articles

Glacial meltwater and seasonality influence community composition of diazotrophs in Arctic coastal and open waters.

The Arctic Ocean is particularly affected by climate change with unknown consequences for primary productivity. Diazotrophs-prokaryotes capable of converting atmospheric nitrogen to ammonia-have been detected in the often nitrogen-limited Arctic Ocean but distribution and community composition dynamics are largely unknown. We performed amplicon sequencing of the diazotroph marker gene nifH from glacial rivers, coastal, and open ocean regions and identified regionally distinct Arctic communities. Proteobacterial diazotrophs dominated all seasons, epi- to mesopelagic depths and rivers to open waters and, surprisingly, Cyanobacteria were only sporadically identified in coastal and freshwaters. The upstream environment of glacial rivers influenced diazotroph diversity, and in marine samples putative anaerobic sulphate-reducers showed seasonal succession with highest prevalence in summer to polar night. Betaproteobacteria (Burkholderiales, Nitrosomonadales, and Rhodocyclales) were typically found in rivers and freshwater-influenced waters, and Delta- (Desulfuromonadales, Desulfobacterales, and Desulfovibrionales) and Gammaproteobacteria in marine waters. The identified community composition dynamics, likely driven by runoff, inorganic nutrients, particulate organic carbon, and seasonality, imply diazotrophy a phenotype of ecological relevance with expected responsiveness to ongoing climate change. Our study largely expands baseline knowledge of Arctic diazotrophs-a prerequisite to understand underpinning of nitrogen fixation-and supports nitrogen fixation as a contributor of new nitrogen in the rapidly changing Arctic Ocean.

Evolving a New Electron Transfer Pathway for Nitrogen Fixation Uncovers an Electron Bifurcating-Like Enzyme Involved in Anaerobic Aromatic Compound Degradation.

Nitrogenase is the key enzyme involved in nitrogen fixation and uses low potential electrons delivered by ferredoxin (Fd) or flavodoxin (Fld) to reduce dinitrogen gas (N2) to produce ammonia, generating hydrogen gas (H2) as an obligate product of this activity. Although the phototrophic alphaproteobacterium Rhodopseudomonas palustris encodes multiple proteins that can reduce Fd, the FixABCX complex is the only one shown to support nitrogen fixation, and R. palustris Fix- mutants grow poorly under nitrogen-fixing conditions. To investigate how native electron transfer chains (ETCs) can be redirected toward nitrogen fixation, we leveraged the strong selective pressure of nitrogen limitation to isolate a suppressor of an R. palustris ΔfixC strain that grows under nitrogen-fixing conditions. We found two mutations were required to restore growth under nitrogen-fixing conditions in the absence of functional FixABCX. One mutation was in the gene encoding the primary Fd involved in nitrogen fixation, fer1, and the other mutation was in aadN, which encodes a homolog of NAD+-dependent Fd:NADPH oxidoreductase (Nfn). We present evidence that AadN plays a role in electron transfer to benzoyl coenzyme A reductase, the key enzyme involved in anaerobic aromatic compound degradation. Our data support a model where the ETC for anaerobic aromatic compound degradation was repurposed to support nitrogen fixation in the ΔfixC suppressor strain. IMPORTANCE There is increasing evidence that protein electron carriers like Fd evolved to form specific partnerships with select electron donors and acceptors to keep native electron transfer pathways insulated from one another. This makes it challenging to integrate a Fd-dependent pathway such as biological nitrogen fixation into non-nitrogen-fixing organisms and provide the high-energy reducing power needed to fix nitrogen. Here, we show that amino acid substitutions in an electron donor for anaerobic aromatic compound degradation and an Fd involved in nitrogen fixation enabled electron transfer to nitrogenase. This study provides a model system to understand electron transfer chain specificity and how new electron transfer pathways can be evolved for biotechnologically valuable pathways like nitrogen fixation.

Opportunities for carbon sequestration in intensive soft fruit production systems

Abstract The historical contribution of agriculture to human-induced climate change is indisputable; the removal of natural vegetation and soil cultivation to feed the growing human population has resulted in a substantial carbon transfer to the atmosphere. While maintaining their food production capacity, soft fruit production systems now have an opportunity to utilise a recent technology change to enhance their carbon sequestration capacity. We use an example of a farm in South-East England to illustrate how the soft fruit crop production system can be optimised for carbon storage. We performed an audit of carbon stocks in the soil and tree biomass and show that it is imperative to plan crop rotation to establish (semi) permanent inter-row strips that will remain in situ even if the main crop is replaced. These strips should be covered with grassland vegetation, preferable with deeper rooting grass species mixed with species supporting nitrogen fixation. Finally, grassland mowing cuttings should be left in situ and hedgerows and tree windbreaks should be expanded across the farm. Modern soft fruit production systems can enhance their carbon storage while maintaining commercially relevant levels of productivity.

Study on Interactive Effects of Different Levels of Lead and Mercury on Nitrogen Fixation of Some Diazotrophs

Researchers have studied the effects of addition of metal elements in combination with nitrogen fixing organisms as inoculants on the plants (growth) predominantly in legumes, however there is a major gap because responses and effects of these proposed micronutrients on the nitrogen fixation activity of these microbes both free living and symbiotic remains sketchy at best. Therefore, the effect of supplementation of lead and Mercury (bioaugmentation) on the nitrogen fixation potential of two (2) diazotrophs was evaluated in this study.
 Aims: To evaluate the interactive effects of different levels of Lead and Mercury on Nitrogen fixation of both Rhizobium and Xanthobactersppin-vitro.
 Place and Duration of Study: Sample organisms where collected from Groundnut rhizospheric soil of a farm in Cross River state, Nigeria. The microorganism isolation and nitrogen fixation analysis was further carried out at MacCliff General services Laboratory, Owerri, Nigeria for a duration of 3 months.
 Study Design: The interactive plots serve to show the effect of one variable (lead) on the value of mercury (the other) and is derived by selecting high and low values for lead (Pb) and entering them into the equation along with the range of values for Mercury (Hg). The values of independent variables (lead and mercury levels) used in the plots were selected by observing the highest concentration (+1) and lowest concentration (-1) values which are able to support nitrogen fixation independently in Rhizobium and Xanthobacter.
 Methodology: The soil samples were collected from groundnut rhizosphere at a 20 cm depth using sterile soil corer (sterilized with 95% ethanol) and matured Groundnut plants were uprooted with care. From these samples, both Rhizobium and Xanthobacterspp were isolated. The isolated organisms were re-vitalized in Jensen’s nitrogen free broth and standardized to 0.5 McFarland standards. To determine nitrogen fixation, the broth cultures were examined for nitrate nitrogen (NO3-N) and amino nitrogen (Amino-N) levels after ten days of the experiment under continuous airflow using the Jensen’s nitrogen free broth containing the metal salts, Mercury (II) chloride HgCl2 and Lead (II) acetate trihydratePb (CH3COO)2.3H2O). Nitrate nitrogen and amino Nitrogen was obtained using cataldo and ninhydrins methods respectively. The data obtained was made in triplicates and reported as mean values. Interactive effect plots and statistical analysis were done using Minitab 17 software at 5% level of significance (p<0.05).
 Results: The main effect plots illustrate that to maximize nitrogen fixation in Xanthobacterspthrough the utilization of the selected metals as micronutrient, we should use lead at 6.25 mg/L and mercury at 25mg/L yielding 0.508 mg/L for nitrogen fixation response. The plot also suggests that if lead metals are used at a higher concentration than stated nitrogen fixation will decline. On the interaction plots, the slopes indicate that an interference or antagonistic interaction effect (crossed lines) exist between lead and mercury in the nitrogen fixation activity of Xanthobacter. The R-squared adjusted value suggests that 70.87% of the variations in nitrogen fixation response is explained by the interaction of lead and mercury, hence the model likely fits the data. However, the P-value was not significant at 0.102. For Rhizobium sp. mercury also has a higher fixation magnitude than Lead but relatively at 0.554 mg/L. However, the interaction plot showed parallel lines indicating that there was no interaction effect. Therefore, one can say that the relationship between lead and nitrogen fixation does not depend on the concentration of mercury and vice versa. The model was also statistically insignificant at 0.981.
 Conclusion: Interactive effect only occurred in the nitrogen fixation of Xanthobactersp. This raises a need for further study combination of metal elements which could be utilized to stimulate nitrogen, phosphorus and potassium production in Diazotrophs both in the field and in-vitro.

Polyamines: Key elements in the rhizobia-legume symbiosis?

Polyamines (PAs) are ubiquitous low molecular weight, molecules found in all living cells with participation in a variety of processes. The establishment of symbiotic interactions between soil nitrogen fixing bacteria (rhizobia) and leguminous plants, as well as the formation of the root nodules where the rhizobia are hosted, depends on the production of PAs by both partners. In the bacteria, PAs provide certain traits that facilitate the recognition between the symbionts, while in the plant, PAs participate in the production of signaling molecules like hydrogen peroxide (H2O2) and nitric oxide (NO), detected during the initial stages of the symbiosis. Once the symbiosis is established, the high amount and variety of PAs in the root nodules together to their participation in the metabolic reactions supporting nitrogen fixation, suggest their involvement in the nodule functioning. In addition, PAs are key players in the response to abiotic stresses contributing to the adaptation of the symbiosis to salinity, specially, by an increment in the production of PAs in the bacteroids and their interactions with other anti-stress plant hormones. Considering the importance of biological nitrogen fixation in soil fertility and agriculture productivity in a context of climate change, in this review we describe the participation of PAs to the rhizobia-legume interaction and the nitrogen fixation process, as well as its involvement in the response to salinity in the symbiosis.

The Pseudomonas stutzeri-Specific Regulatory Noncoding RNA NfiS Targets katB mRNA Encoding a Catalase Essential for Optimal Oxidative Resistance and Nitrogenase Activity.

Pseudomonas stutzeri A1501 is a versatile nitrogen-fixing bacterium capable of living in diverse environments and coping with various oxidative stresses. NfiS, a regulatory noncoding RNA (ncRNA) involved in the control of nitrogen fixation in A1501, was previously shown to be required for optimal resistance to H2O2; however, the precise role of NfiS and the target genes involved in the oxidative stress response is entirely unknown. In this work, we systematically investigated the NfiS-based mechanisms underlying the response of this bacterium to H2O2 at the cellular and molecular levels. A mutant strain carrying a deletion of nfiS showed significant downregulation of oxidative stress response genes, especially katB, a catalase gene, and oxyR, an essential regulator for transcription of catalase genes. Secondary structure prediction revealed two binding sites in NfiS for katB mRNA. Complementation experiments using truncated nfiS genes showed that each of two sites is functional, but not sufficient, for NfiS-mediated regulation of oxidative stress resistance and nitrogenase activities. Microscale thermophoresis assays further indicated direct base pairing between katB mRNA and NfiS at both sites 1 and 2, thus enhancing the half-life of the transcript. We also demonstrated that katB expression is dependent on OxyR and that both OxyR and KatB are essential for optimal oxidative stress resistance and nitrogenase activities. H2O2 at low concentrations was detoxified by KatB, leaving O2 as a by-product to support nitrogen fixation under O2-insufficient conditions. Moreover, our data suggest that the direct interaction between NfiS and katB mRNA is a conserved and widespread mechanism among P. stutzeri strains.IMPORTANCE Protection against oxygen damage is crucial for survival of nitrogen-fixing bacteria due to the extreme oxygen sensitivity of nitrogenase. This work exemplifies how the small ncRNA NfiS coordinates oxidative stress response and nitrogen fixation via base pairing with katB mRNA and nifK mRNA. Hence, NfiS acts as a molecular link to coordinate the expression of genes involved in oxidative stress response and nitrogen fixation. Our study provides the first insight into the biological functions of NfiS in oxidative stress regulation and adds a new regulation level to the mechanisms that contribute to the oxygen protection of the MoFe nitrogenase.

Microbial communities and diazotrophic activity differ in the root‐zone of Alamo and Dacotah switchgrass feedstocks

AbstractNitrogen (N) bioavailability is a primary limiting nutrient for crop and feedstock productivity. Associative nitrogen fixation (ANF) by diazotrophic bacteria in root‐zone soil microbial communities have been shown to provide significant amounts of N to some tropical grasses, but this potential in switchgrass, a warm‐season, temperate, US native, perennial tallgrass has not been widely studied. ‘Alamo’ and ‘Dacotah’ are cultivars of switchgrass, adapted to the southern and northern regions of the United States, respectively, and offer an opportunity to better describe this plant–bacterial association. The nitrogenase enzyme activity, microbial communities, and amino acid profiles in the root‐zones of the two ecotypes were studied at three different plant growth stages. Differences in the nitrogenase enzyme activity and free soluble amino acid profiles indicated the potential for greater nitrogen fixation in the high productivity Alamo compared with the lower productivity Dacotah. Changes in the amino acid profiles and microbial community structure (rRNA genes) of the root‐zone suggest different plant–bacterial interactions can help to explain differences in nitrogenase activity. PICRUSt analysis revealed functional differences, especially nitrogen metabolism, that supported ecotype differences in root‐zone nitrogenase enzyme activity. It is thought that the greater productivity of Alamo increased the belowground flow of carbon into roots and root‐zone habitats, which in turn support the high energy demands needed to support nitrogen fixation. Further research is thus needed to understand plant ecotype and cultivar trait differences that can be used to breed or genetically modify crop plants to support root‐zone associations with diazotrophs.

MucR Is Required for Transcriptional Activation of Conserved Ion Transporters to Support Nitrogen Fixation of Sinorhizobium fredii in Soybean Nodules.

To achieve effective symbiosis with legume, rhizobia should fine-tune their background regulation network in addition to activating key genes involved in nodulation (nod) and nitrogen fixation (nif). Here, we report that an ancestral zinc finger regulator, MucR1, other than its paralog, MucR2, carrying a frameshift mutation, is essential for supporting nitrogen fixation of Sinorhizobium fredii CCBAU45436 within soybean nodules. In contrast to the chromosomal mucR1, mucR2 is located on symbiosis plasmid, indicating its horizontal transfer potential. A MucR2 homolog lacking the frameshift mutation, such as the one from S. fredii NGR234, can complement phenotypic defects of the mucR1 mutant of CCBAU45436. RNA-seq analysis revealed that the MucR1 regulon of CCBAU45436 within nodules exhibits significant difference compared with that of free-living cells. MucR1 is required for active expression of transporters for phosphate, zinc, and elements essential for nitrogenase activity (iron, molybdenum, and sulfur) in nodules but is dispensable for transcription of key genes (nif/fix) involved in nitrogen fixation. Further reverse genetics suggests that S. fredii uses high-affinity transporters to meet the demand for zinc and phosphate within nodules. These findings, together with the horizontal transfer potential of the mucR homolog, imply an intriguing evolutionary role of this ancestral regulator in supporting nitrogen fixation.

Diurnal rhythm of a unicellular diazotrophic cyanobacterium under mixotrophic conditions and elevated carbon dioxide

Mixotrophic cultivation of cyanobacteria in wastewaters with flue gas sparging has the potential to simultaneously sequester carbon content from gaseous and aqueous streams and convert to biomass and biofuels. Therefore, it was of interest to study the effect of mixotrophy and elevated CO2 on metabolism, morphology and rhythm of gene expression under diurnal cycles. We chose a diazotrophic unicellular cyanobacterium Cyanothece sp. ATCC 51142 as a model, which is a known hydrogen producer with robust circadian rhythm. Cyanothece 51142 grows faster with nitrate and/or an additional carbon source in the growth medium and at 3% CO2. Intracellular glycogen contents undergo diurnal oscillations with greater accumulation under mixotrophy. While glycogen is exhausted by midnight under autotrophic conditions, significant amounts remain unutilized accompanied by a prolonged upregulation of nifH gene under mixotrophy. This possibly supports nitrogen fixation for longer periods thereby leading to better growth. To gain insights into the influence of mixotrophy and elevated CO2 on circadian rhythm, transcription of core clock genes kaiA, kaiB1 and kaiC1, the input pathway, cikA, output pathway, rpaA and representatives of key metabolic pathways was analyzed. Clock genes' transcripts were lower under mixotrophy suggesting a dampening effect exerted by an external carbon source such as glycerol. Nevertheless, the genes of the clock and important metabolic pathways show diurnal oscillations in expression under mixotrophic and autotrophic growth at ambient and elevated CO2, respectively. Taken together, the results indicate segregation of light and dark associated reactions even under mixotrophy and provide important insights for further applications.

Physiological Roles of GlutathioneS-Transferases in Soybean Root Nodules

Glutathione S-transferases (GSTs) are ubiquitous enzymes that catalyze the conjugation of toxic xenobiotics and oxidatively produced compounds to reduced glutathione, which facilitates their metabolism, sequestration, or removal. We report here that soybean (Glycine max) root nodules contain at least 14 forms of GST, with GST9 being most prevalent, as measured by both real-time reverse transcription-polymerase chain reaction and identification of peptides in glutathione-affinity purified extracts. GST8 was prevalent in stems and uninfected roots, whereas GST2/10 prevailed in leaves. Purified, recombinant GSTs were shown to have wide-ranging kinetic properties, suggesting that the suite of GSTs could provide physiological flexibility to deal with numerous stresses. Levels of GST9 increased with aging, suggesting a role related to senescence. RNA interference studies of nodules on composite plants showed that a down-regulation of GST9 led to a decrease in nitrogenase (acetylene reduction) activity and an increase in oxidatively damaged proteins. These findings indicate that GSTs are abundant in nodules and likely function to provide antioxidant defenses that are critical to support nitrogen fixation.

NAD-Malic Enzyme Affects Nitrogen Fixing Activity of Bradyrhizobium japonicum USDA 110 Bacteroids in Soybean Nodules

The NAD(+)-dependent malic enzyme (DME) has been reported to play a key role supporting nitrogenase activity in bacteroids of Sinorhizobium meliloti. Genetic evidence for a similar role in Bradyrhizobium japonicum USDA110 was obtained by constructing a dme mutant. Soybean plants inoculated with a dme mutant did not show delayed nodulation, but formed small root nodules and exhibited significant nitrogen-deficiency symptoms. Nodule numbers and the acetylene reducting activity per nodule as a dry weight value 14 and 28 days after inoculation with the dme mutant were comparable to those of plants inoculated with wild-type B. japonicum. However, shoot dry weight and acetylene reducting activity per nodule decreased to ca. 30% of the values in plants with wild-type B. japonicum. The sucrose and organic acid (malate, succinate, acetate, α-ketoglutarate and lactate) contents of the nodules were investigated. Amounts of sucrose, malate and a-ketoglutarate increased on inoculation with the dme mutant, suggesting that the decreased DME and nitrogenase activities in the bacteroids resulted in a reduction in the consumption of these respiratory metabolites by the nodules. The data suggest that the DME activity of B. japonicum bacteroids plays a role in nodule metabolism and supports nitrogen fixation.

Phosphoenolpyruvate Carboxylase Plays a Crucial Role in Limiting Nitrogen Fixation in Lotus japonicus Nodules

Phosphoenolpyruvate carboxylase (PEPC, EC 4.1.1.31) is believed to play a significant role in supporting nitrogen fixation via anaplerotic CO2 fixation for recycling carbon in nodules. Using the antisense technique, we decreased the expression levels of the nodule-enhanced PEPC gene (Ljpepc1) in a determinate legume plant (Lotus japonicus) in order to look at the influence of the symbiotic phenotype and biochemical parameters. Three independent transgenic L. japonicus plants (designated as Asppc1, Asppc2 and Asppc3) were prepared using a Ljpepc1 DNA fragment which is under the control of the cauliflower mosaic virus 35S promoter. Extensive suppression of the Ljpepc1 transcript in nodules of Asppc plants (T3 homologous plants) was confirmed by RNA gel blot, Western blot and enzyme activity assays. In nodules of Asppc plants, PEPC activity was reduced to about 10% of that of non-transformants and the plants showed typical nitrogen-deficient symptoms without a supply of nitrogen nutrient, and returned to normal growth when nitrate was supplied at 2.5 mM. The acetylene reduction activity per fresh weight of nodules of these Asppc plants decreased by 29% at 35 dai (days after infection). Various enzyme activities and metabolite levels were surveyed using Asppc plants at 35 dai. Significant reduction of sucrose synthase and asparagine aminotransferase activities was observed in Asppc nodules. In addition, sucrose, succinate, asparagine, aspartate and glutamate contents also decreased in Asppc nodules. The data are discussed in terms of a role for PEPC in the carbon/nitrogen metabolic flux in nodules.

Bugging the Nucleus

Leguminous plants benefit from symbiosis with Rhizobium bacteria to support nitrogen fixation. The bacteria release factors (Nod factors) that stimulate plant receptors that cause developmental changes that promote colonization by the symbiont. Kanamori et al. studied mutants of a Lotus gene, Nup133 , that impaired nodulation (formation of the nodule on the root in which the bacteria reside). One of the early responses of root hair cells to Nod factors is pulsatile increases in the intracellular concentration of free calcium. However, in nup mutants, the authors were unable to detect such calcium oscillations with a calcium-sensitive dye. Positional cloning of Nup133 revealed sequence similarity to yeast and human nucleoporins. A role for NUP133 in general nuclear transport seems unlikely, given that the mutants appeared normal with the exception of impaired symbiosis. However, a green fluorescent protein (GFP)-NUP133 fusion protein expressed in transgenic Lotus roots was localized to the nuclear rim in root cells and root hair cells. The authors speculate that NUP133 may function as a key participant in the signaling pathway from receptors at the cell surface to nuclear events necessary for generation of second messengers that promote nodulation. N. Kanamori, L. H. Madsen, S. Radutoiu, M. Frantescu, E. M. H. Quistgaard, H. Miwa, J. A. Downie, E. K. James, H. H. Felle, L. L. Haaning, T. H. Jensen, S. Sato, Y. Nakamura, S. Tabata, N. Sandal, J. Stougaard, A nucleoporin is required for induction of Ca 2+ spiking in legume nodule development and essential for rhizobial and fungal symbiosis. Proc. Natl. Acad. Sci. U.S.A. 103 , 359-364 (2006). [Abstract] [Full Text]

Nitrogenase activity in composting horse bedding and leaves

To date little or no nitrogen fixation has been found in composting materials. However, some materials have high C:N ratios and thus might be expected to support nitrogen fixation. We examined windrows of composting horse bedding and leaves for nitrogenase activity via acetylene reduction and used carbon monoxide controls to differentiate ethylene evolved by nitrogenase from that evolved by endogenous processes. In both piles temperatures were substantially elevated and partial pressures of oxygen greatly reduced thus indicating vigorous microbial activity. In the horse bedding, there were only low rates of ethylene evolution and little of this was due to nitrogen fixation. In contrast, much higher rates of ethylene evolution were measured in the leaf pile and 94% of this was due to nitrogenase activity. We estimate that the leaf pile fixed approximately 0.062 mg N/g leaves during a 5-week period.

PatS Peptide Inhibits Heterocyst Development and Influences Pattern Formation in Anabaena

PatS PEPTIDE INHIBITS HETEROCYST DEVELOPMENT AND INFLUENCES PATTERN FORMATION IN ANABAENA James W. Golden James W. Golden (e-mail: jgolden@ tamu.edu), Department of Biology, Texas A & MUniversity, 3258 TAMU, CollegeStation, TX77843-3258, United StatesofAmerica. INTRODUCTION The developmental pattern of nitrogen-fixing het erocysts along filaments of multicellular cyano bacteria provides an interesting example of prokaryotic developmental biology (Wolk et al. 1994). To best serve the needs of the organism, the cyanobacterium must regulate the frequency and position of heterocysts along the filament to bal ance the supply of products from photosynthesis and nitrogen fixation. The pattern of heterocysts varies among different cyanobacterial strains and can be altered by the environment as well as in symbiotic associations. The study by Golden and Yoon (1998) reported on the genetics and molecu lar biology of heterocyst pattern formation in Anabaena sp. strain PCC 7120. The differentiation of a vegetative cell into a heterocyst is estimated to involve the regulation of hundreds of genes. Heterocysts possess amodified photosynthetic capability, grossly modified internal membranes, a specialised thickened cell envelope, an altered physiology adapted to support nitrogen fixation, large polar cyanophycin granules for ni trogen storage and the enzymes for nitrogen fix ation and uptake hydrogenase activity (Wolk et al. 1994). Heterocyst differentiation inmany strains is accompanied by programmed site-specific DNA rearrangements that result in the excision of DNA elements from within heterocyst-specific genes (Golden 1997). In Anabaena strain PCC 7120 het erocysts, DNA elements are excised from two genes involved in nitrogen fixation, nifD andfdxN, and an uptake hydrogenase gene, hupL (Carrasco et al. 1998). A variety of genetic and molecular tools are available for studies of Anabaena strain PCC 7120 (Wolk et al. 1994). The isolation of DNA, RNA and protein for a variety of procedures and assays is now routine. Although electroporation can be used to introduce DNA molecules into Anabaena strain PCC 7120, conjugation with Escherichia coli is the preferred method of genetic manipulation. Shuttle vectors can be used to introduce andmain tain genes for complementation and expression by their own or by heterologous promoters. Non replicating conjugal plasniids are used to obtain single or double recombination with homologous sequences on the chromosome for gene inactiva tion or manipulation. Gene fusions with lacZ, luxAB, and gfp reporter genes have been used to follow gene expression under a variety of environ mental, physiological and developmental con ditions. THE patS GENE ISREQUIRED FOR NORMAL HETEROCYST PATTERN FORMATION A long-standing model for the regulation of het erocyst pattern formation has been lateral inhibition, where a diffusible inhibitor originating from differentiating cells inhibits the differentiation of its neighbours. The product of the patS gene is predicted to be a small peptide that fulfils this role (Yoon and Golden 1998). The patS gene was identified during genetic experiments designed to identify cosmid shuttle vector clones that comple mented developmental mutants. One cosmid iden tified had the striking phenotype of completely inhibiting heterocyst development. A strain con taining this cosmid produced yellow non-growing colonies on medium lacking a source of reduced nitrogen. Subcloning expenrments were used to identify a lkb region of the cosniid that produced the strong heterocyst inhibition phenotype; how ever, no obvious open reading frames were im mediately recognised in the DNA sequence. Codon use analysis identified a small open reading frame consisting of seventeen codons that showed a strong codon bias, indicating that it might en code a peptide product (Fig. 1). Further subcloning experiments showed that a PCR fragment containing this open reading frame, named patS, would suppress heterocysts when placed in the sense orientation downstream of a glnA promoter (Yoon and Golden 1998). The antisense onrentation failed to inhibit heterocyst development. To test if the amount of transcrip tion through the patS gene was correlated with the strength of heterocyst inhibition, the patS gene was put under the control of the copper-regulated petE promoter on a shuttle plasmid. An Anabaena strain containing this plasmid showed heterocyst inhibition in response to increased copper concentrations. BIOLOGY ANi) ENVIRONMENT: PROCEEDINGS OF THEROYAL IRISHACADEMY, VOa. 1023, No. 1, 57-59 (2002). C ROYAL IRISHACADEMY 57 BIOLOGY AND ENVIRONMENT AGATTATGAAGGCAATTATGTTAGTGAATTTCTGTGATGAGCGCGGTAGTGGTAGATAGAACGA M K A I M L V N F C D...

PatS Peptide Inhibits Heterocyst Development and Influences Pattern Formation in <i>Anabaena</i>

The developmental pattern of nitrogen-fixing het erocysts along filaments of multicellular cyano bacteria provides an interesting example of prokaryotic developmental biology (Wolk et al. 1994). To best serve the needs of the organism, the cyanobacterium must regulate the frequency and position of heterocysts along the filament to bal ance the supply of products from photosynthesis and nitrogen fixation. The pattern of heterocysts varies among different cyanobacterial strains and can be altered by the environment as well as in symbiotic associations. The study by Golden and Yoon (1998) reported on the genetics and molecu lar biology of heterocyst pattern formation in Anabaena sp. strain PCC 7120. The differentiation of a vegetative cell into a heterocyst is estimated to involve the regulation of hundreds of genes. Heterocysts possess a modified photosynthetic capability, grossly modified internal membranes, a specialised thickened cell envelope, an altered physiology adapted to support nitrogen fixation, large polar cyanophycin granules for ni trogen storage and the enzymes for nitrogen fix ation and uptake hydrogenase activity (Wolk et al. 1994). Heterocyst differentiation in many strains is accompanied by programmed site-specific DNA rearrangements that result in the excision of DNA elements from within heterocyst-specific genes (Golden 1997). In Anabaena strain PCC 7120 het erocysts, DNA elements are excised from two genes involved in nitrogen fixation, nifD andfdxN, and an uptake hydrogenase gene, hupL (Carrasco et al. 1998). A variety of genetic and molecular tools are available for studies of Anabaena strain PCC 7120 (Wolk et al. 1994). The isolation of DNA, RNA and protein for a variety of procedures and assays is now routine. Although electroporation can be used to introduce DNA molecules into Anabaena strain PCC 7120, conjugation with Escherichia coli is the preferred method of genetic manipulation. Shuttle vectors can be used to introduce and main tain genes for complementation and expression by their own or by heterologous promoters. Non replicating conjugal plasniids are used to obtain single or double recombination with homologous sequences on the chromosome for gene inactiva tion or manipulation. Gene fusions with lacZ, luxAB, and gfp reporter genes have been used to follow gene expression under a variety of environ mental, physiological and developmental con ditions.

The Formation of Nitrogen-Fixing Bacteroids Is Delayed but Not Abolished in Soybean Infected by an [alpha]-Ketoglutarate Dehydrogenase-Deficient Mutant of Bradyrhizobium japonicum.

A mutant strain of Bradyrhizobium japonicum USDA 110 devoid of [alpha]-ketoglutarate dehydrogenase activity (LSG184) was used to test whether this tricarboxylic acid cycle enzyme is necessary to support nitrogen fixation during symbiosis with soybean (Glycine max). LSG184 formed nodules about 5 d later than the wild-type strain, and the nodules, although otherwise normal in structure, contained many fewer infected host cells than is typical. At 19 d after inoculation cells infected with the mutant strain were only partially filled with bacteroids and showed large accumulations of starch, but by 32 d after inoculation the host cells infected with the mutant appeared normal. The onset of nitrogen fixation was delayed about 15 d for plants inoculated with LSG184, and the rate, on a per nodule fresh weight basis, reached only about 20% of normal. However, because nodules formed by LSG184 contained only about 20% of the normal number of bacteroids, it could be inferred that the mutant, on an individual bacteroid basis, was fixing nitrogen at near wild-type rates. Therefore, the loss of [alpha]-ketoglutarate dehydrogenase in B. japonicum does not prevent the formation or the functioning of nitrogen-fixing bacteroids in soybean.

Metabolic changes in soybean nodules after inhibition of nitrogen fixation by treatment with oxygen

Metabolites that accumulated in soybean [Glycine max (L.) Merr.] nodules after inhibition of nitrogen fixation were analysed to determine what carbon compounds the bacteroids might obtain from their host. Exposure of roots of intact soybean plants to 100% O2 for 5 min caused a decrease in acetylene reduction activity within 10 min and then the activity recovered only slowly. Analysis of carbohydrates, organic acids, volatile compounds and amino acids in extracts of nodules revealed that succinate, malate and alanine all accumulated within 10 min after treatment with O2. The concentrations of sucrose, acetone, tyrosine, valine, isoleucine, leucine, and ornithine in the nodules increased slowly after such treatment. The results are discussed in terms of carbon sources for supporting nitrogen fixation of soybean bacteroids.

Diazotrophic synchronous growth of a marine unicellular cyanobacterium, Synechococcus sp. strain Miami BG 043511, under aerobic and microaerobic/anaerobic conditions

The growth attributes of an aerobic nitrogen-fixing Synechococcus strain, Miami BG 043511, under aerobic and microaerobic/anaerobic conditions were examined using conventional batch and synchronous culture methods. Generation times of this strain, estimated from the increase in cell density under aerobic and anaerobic batch culture conditions, were 19-23 h and 15-19 h at 30 °C, respectively. It seems, therefore, that atmospheric oxygen did not seriously affect diazotrophic growth in this strain. Under a periodic light-dark regime, cells grew synchronously even under microaerobic/anaerobic conditions. When the aerobic culture entered the light period, a peak of photosynthetic activity was followed by a peak of nitrogenase activity. In contrast, a peak of nitrogenase activity preceded a peak of photosynthetic activity under microaerobic/anaerobic conditions. In both cases, however, cell division was observed at or just after the peak of photosynthetic activity. The difference in the timing of the appearance of nitrogenase activity in microaerobic/anaerobic cultures was ascribed to the inability of cells to generate sufficient ATP under anaerobic dark conditions. Periodic changes in cellular carbohydrate content, associated with the periodic appearances of photosynthetic and nitrogen-fixing activities, were observed under both aerobic and microaerobic/anaerobic conditions. Cellular carbohydrate content increased from 10% to 60% of cell dry weight during the phase of photosynthesis under aerobic conditions, while it reached only 40% under microaerobic/anaerobic conditions. The amount of reserve polysaccharides required to support nitrogen fixation was larger in aerobic cultures than in microaerobic/anaerobic cultures.

Glutamate Oxaloacetate Transaminase in Pea Root Nodules

Glutamate oxaloacetate transaminase (l-glutamate: oxaloacetate aminotransferase, EC 2.6.1.1 [GOT]), a key enzyme in the flow of carbon between the organic acid and amino acid pools in pea (Pisum sativum L.) root nodules, was studied. By ion exchange chromatography, the presence of two forms of GOT in the cytoplasm of pea root nodule cells was established. The major root nodule form was present in only a small quantity in the cytoplasm of root cells. Fractionation of root nodule cell extracts demonstrated that the increase in the GOT activity during nodule development was due to the increase of the activity in the cytoplasm of the plant cells, and not to an increase in activity in the plastids or in the mitochondria. The kinetic properties of the different cytoplasmic forms of GOT were studied. Some of the K(m) values differed, but calculations indicated that not the kinetic properties but a high concentration of the major root nodule form caused the observed increase in GOT activity in the pea root nodules. It was found that the reactions of the malate/aspartate shuttle are catalyzed by intact bacteroids, and that these reactions can support nitrogen fixation. It is proposed that the main function of the nodule-stimulated cytoplasmic form of GOT is participation in this shuttle.