PatS Peptide Inhibits Heterocyst Development and Influences Pattern Formation in Anabaena

Abstract

PatS PEPTIDE INHIBITS HETEROCYST DEVELOPMENT AND INFLUENCES PATTERN FORMATION IN ANABAENA James W. Golden James W. Golden (e-mail: jgolden@ tamu.edu), Department of Biology, Texas A & MUniversity, 3258 TAMU, CollegeStation, TX77843-3258, United StatesofAmerica. INTRODUCTION The developmental pattern of nitrogen-fixing het erocysts along filaments of multicellular cyano bacteria provides an interesting example of prokaryotic developmental biology (Wolk et al. 1994). To best serve the needs of the organism, the cyanobacterium must regulate the frequency and position of heterocysts along the filament to bal ance the supply of products from photosynthesis and nitrogen fixation. The pattern of heterocysts varies among different cyanobacterial strains and can be altered by the environment as well as in symbiotic associations. The study by Golden and Yoon (1998) reported on the genetics and molecu lar biology of heterocyst pattern formation in Anabaena sp. strain PCC 7120. The differentiation of a vegetative cell into a heterocyst is estimated to involve the regulation of hundreds of genes. Heterocysts possess amodified photosynthetic capability, grossly modified internal membranes, a specialised thickened cell envelope, an altered physiology adapted to support nitrogen fixation, large polar cyanophycin granules for ni trogen storage and the enzymes for nitrogen fix ation and uptake hydrogenase activity (Wolk et al. 1994). Heterocyst differentiation inmany strains is accompanied by programmed site-specific DNA rearrangements that result in the excision of DNA elements from within heterocyst-specific genes (Golden 1997). In Anabaena strain PCC 7120 het erocysts, DNA elements are excised from two genes involved in nitrogen fixation, nifD andfdxN, and an uptake hydrogenase gene, hupL (Carrasco et al. 1998). A variety of genetic and molecular tools are available for studies of Anabaena strain PCC 7120 (Wolk et al. 1994). The isolation of DNA, RNA and protein for a variety of procedures and assays is now routine. Although electroporation can be used to introduce DNA molecules into Anabaena strain PCC 7120, conjugation with Escherichia coli is the preferred method of genetic manipulation. Shuttle vectors can be used to introduce andmain tain genes for complementation and expression by their own or by heterologous promoters. Non replicating conjugal plasniids are used to obtain single or double recombination with homologous sequences on the chromosome for gene inactiva tion or manipulation. Gene fusions with lacZ, luxAB, and gfp reporter genes have been used to follow gene expression under a variety of environ mental, physiological and developmental con ditions. THE patS GENE ISREQUIRED FOR NORMAL HETEROCYST PATTERN FORMATION A long-standing model for the regulation of het erocyst pattern formation has been lateral inhibition, where a diffusible inhibitor originating from differentiating cells inhibits the differentiation of its neighbours. The product of the patS gene is predicted to be a small peptide that fulfils this role (Yoon and Golden 1998). The patS gene was identified during genetic experiments designed to identify cosmid shuttle vector clones that comple mented developmental mutants. One cosmid iden tified had the striking phenotype of completely inhibiting heterocyst development. A strain con taining this cosmid produced yellow non-growing colonies on medium lacking a source of reduced nitrogen. Subcloning expenrments were used to identify a lkb region of the cosniid that produced the strong heterocyst inhibition phenotype; how ever, no obvious open reading frames were im mediately recognised in the DNA sequence. Codon use analysis identified a small open reading frame consisting of seventeen codons that showed a strong codon bias, indicating that it might en code a peptide product (Fig. 1). Further subcloning experiments showed that a PCR fragment containing this open reading frame, named patS, would suppress heterocysts when placed in the sense orientation downstream of a glnA promoter (Yoon and Golden 1998). The antisense onrentation failed to inhibit heterocyst development. To test if the amount of transcrip tion through the patS gene was correlated with the strength of heterocyst inhibition, the patS gene was put under the control of the copper-regulated petE promoter on a shuttle plasmid. An Anabaena strain containing this plasmid showed heterocyst inhibition in response to increased copper concentrations. BIOLOGY ANi) ENVIRONMENT: PROCEEDINGS OF THEROYAL IRISHACADEMY, VOa. 1023, No. 1, 57-59 (2002). C ROYAL IRISHACADEMY 57 BIOLOGY AND ENVIRONMENT AGATTATGAAGGCAATTATGTTAGTGAATTTCTGTGATGAGCGCGGTAGTGGTAGATAGAACGA M K A I M L V N F C D...