Waardenburg Syndrome Subtypes Research Articles

Genetic insights, disease mechanisms, and biological therapeutics for Waardenburg syndrome.

Waardenburg syndrome (WS), also known as auditory-pigmentary syndrome, is the most common cause of syndromic hearing loss (HL), which accounts for approximately 2-5% of all patients with congenital hearing loss. WS is classified into four subtypes depending on the clinical phenotypes. Currently, pathogenic mutations of PAX3, MITF, SOX10, EDN3, EDNRB or SNAI2 are associated with different subtypes of WS. Although supportive techniques like hearing aids, cochlear implants, or other assistive listening devices can alleviate the HL symptom, there is no cure for WS to date. Recently major progress has been achieved in preclinical studies of genetic HL in animal models, including gene delivery and stem cell replacement therapies. This review focuses on the current understandings of pathogenic mechanisms and potential biological therapeutic approaches for HL in WS, providing strategies and directions for implementing WS biological therapies, as well as possible problems to be faced, in the future.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Functional analysis of a nonstop mutation in MITF gene identified in a patient with Waardenburg syndrome type 2

Waardenburg syndrome (WS) is an autosomal dominant inherited neurogenic disorder with the combination of various degrees of sensorineural deafness and pigmentary abnormalities affecting the skin, hair and eye. The four subtypes of WS were defined on the basis of the presence or absence of additional symptoms. Mutation of human microphthalmia-associated transcription factor (MITF) gene gives rise to WS2. Here, we identified a novel WS-associated mutation at the stop codon of MITF (p.X420Y) in a Chinese WS2 patient. This mutation resulted in an extension of extra 33 amino-acid residues in MITF. The mutant MITF appeared in both the nucleus and the cytoplasm, whereas the wild-type MITF was localized in the nucleus exclusively. The mutation led to a reduction in the transcriptional activities, whereas the DNA-binding activity was not altered. We show that the foremost mechanism was haploinsufficiency for the mild phenotypes of WS2 induced in X420Y MITF.

SOX10 mutations mimic isolated hearing loss.

Ninety genes have been identified to date that are involved in non-syndromic hearing loss, and more than 300 different forms of syndromic hearing impairment have been described. Mutations in SOX10, one of the genes contributing to syndromic hearing loss, induce a large range of phenotypes, including several subtypes of Waardenburg syndrome and Kallmann syndrome with deafness. In addition, rare mutations have been identified in patients with isolated signs of these diseases. We used the recent characterization of temporal bone imaging aspects in patients with SOX10 mutations to identify possible patients with isolated hearing loss due to SOX10 mutation. We selected 21 patients with isolated deafness and temporal bone morphological defects for mutational screening. We identified two SOX10 mutations and found that both resulted in a non-functional protein in vitro. Re-evaluation of the two affected patients showed that both had previously undiagnosed olfactory defects. Diagnosis of anosmia or hyposmia in young children is challenging, and particularly in the absence of magnetic resonance imaging (MRI), SOX10 mutations can mimic non-syndromic hearing impairment. MRI should complete temporal bones computed tomographic scan in the management of congenital deafness as it can detect brain anomalies, cochlear nerve defects, and olfactory bulb malformation in addition to inner ear malformations.

A 725 kb deletion at 22q13.1 chromosomal region including SOX10 gene in a boy with a neurologic variant of Waardenburg syndrome type 2

Waardenburg syndrome (WS) is a rare (1/40,000) autosomal dominant disorder resulting from melanocyte defects, with varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. WS is classified into four clinical subtypes (WS1-S4). Six genes have been identified to be associated with the different subtypes of WS, among which SOX10, which is localized within the region 22q13.1. Lately it has been suggested that whole SOX10 gene deletions can be encountered when testing for WS. In this study we report a case of a 13-year-old boy with a unique de novo 725 kb deletion within the 22q13.1 chromosomal region, including the SOX10 gene and presenting clinical features of a neurologic variant of WS2.

Novel mutations of PAX3, MITF, and SOX10 genes in Chinese patients with type I or type II Waardenburg syndrome

Waardenburg syndrome (WS) is a rare disorder characterized by distinctive facial features, pigment disturbances, and sensorineural deafness. There are four WS subtypes. WS1 is mostly caused by PAX3 mutations, while MITF, SNAI2, and SOX10 mutations are associated with WS2. More than 100 different disease-causing mutations have been reported in many ethnic groups, but the data from Chinese patients with WS remains poor. Herein we report 18 patients from 15 Chinese WS families, in which five cases were diagnosed as WS1 and the remaining as WS2. Clinical evaluation revealed intense phenotypic variability in Chinese WS patients. Heterochromia iridis and sensorineural hearing loss were the most frequent features (100% and 88.9%, respectively) of the two subtypes. Many brown freckles on normal skin could be a special subtype of cutaneous pigment disturbances in Chinese WS patients. PAX3, MITF, SNAI2, and SOX10 genes mutations were screened for in all the patients. A total of nine mutations in 11 families were identified and seven of them were novel. The SOX10 mutations in WS2 were first discovered in the Chinese population, with an estimated frequency similar to that of MITF mutations, implying SOX10 is an important pathogenic gene in Chinese WS2 cases and should be considered for first-step analysis in WS2, as well as MITF.

Deletions at the SOX10 Gene Locus Cause Waardenburg Syndrome Types 2 and 4

Waardenburg syndrome (WS) is an auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair and skin. Depending on additional symptoms, WS is classified into four subtypes, WS1-WS4. Absence of additional features characterizes WS2. The association of facial dysmorphic features defines WS1 and WS3, whereas the association with Hirschsprung disease (aganglionic megacolon) characterizes WS4, also called "Waardenburg-Hirschsprung disease." Mutations within the genes MITF and SNAI2 have been identified in WS2, whereas mutations of EDN3, EDNRB, and SOX10 have been observed in patients with WS4. However, not all cases are explained at the molecular level, which raises the possibility that other genes are involved or that some mutations within the known genes are not detected by commonly used genotyping methods. We used a combination of semiquantitative fluorescent multiplex polymerase chain reaction and fluorescent in situ hybridization to search for SOX10 heterozygous deletions. We describe the first characterization of SOX10 deletions in patients presenting with WS4. We also found SOX10 deletions in WS2 cases, making SOX10 a new gene of WS2. Interestingly, neurological phenotypes reminiscent of that observed in WS4 (PCWH syndrome [peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung disease]) were observed in some WS2-affected patients with SOX10 deletions. This study further characterizes the molecular complexity and the close relationship that links the different subtypes of WS.