Subfamily Caprinae Research Articles

A molecular cytogenetic analysis of the tribe Bovini (Artiodactyla: Bovidae: Bovinae) with an emphasis on sex chromosome morphology and NOR distribution.

Q-band comparisons were made among representative species of the four genera of the tribe Bovini (Bos, Bison, Bubalus, Syncerus) as well as to selected outgroup taxa representing the remaining two tribes of the subfamily Bovinae (nilgai, Boselaphini; eland, Tragelphini), the Bovidae subfamily Caprinae (domestic sheep) and the family Cervidae (sika deer and white-tailed deer). Extensive autosomal arm homologies were noted, but relatively few derivative character states were shared. Focus was then made on variation of the sex chromosomes and the chromosomal distribution of nucleolar organizer regions (NORs). Bovine BAC clones were used in molecular cytogenetic analyses to decipher rearrangements of the sex chromosomes, and a pocket gopher 28s ribosomal probe was used to map the chromosomal locations of nucleolar organizing regions (NORs). Some of the more noteworthy conclusions drawn from the comparative analysis were that: 1. The Bovidae ancestral X chromosome was probably acrocentric and similar to acrocentric X chromosomes of the Bovinae; 2. The domestic sheep acrocentric X is probably a derivative character state that unites non-Bovinae subfamilies; 3. Bos and Bison are united within the tribe Bovini by the presence of shared derivative submetacentric X chromosomes; 4. Sika and white-tailed deer X chromosomes differ by inversion from X chromosomes of the Bovinae; 5. The Bovini ancestral Y chromosome was probably a small acrocentric; 6. Bos taurus, B. gaurus and B. banteng share derivative metacentric Y chromosomes; 7. Syncerus and Bubalus are united by the acquisition of X-specific repetitive DNA sequence on their Y chromosomes; 8. Bovinae and Cervidae X chromosome centromere position varies without concomitant change in locus order. Preliminary data indicate that a knowledge of the chromosomal distribution of NORs among the Bovidae will prove to be phylogenetically informative.

Molecular Systematics of the Subfamily Caprinae (Artiodactyla, Bovidae) as Determined from Cytochrome b Sequences

We have sequenced the complete mitochondrial DNA cytochrome b gene from 18 species of the subfamily Caprinae and two outgroup taxa. Additional sequences retrieved from the literature were used to constitute a data set of 32 cytochrome b sequences comprising all genera usually included within the Caprinae. Phylogenetic relationships were assessed by PAUP using three new weighting schemes based on homoplasy analyses. Each type of substitution considered at each of the three codon positions was weighted according to its homoplasy level, as measured by the consistency index (CI), the slope of saturation (S), or their product (CIS). These differentially weighted parsimony analyses indicate that (1) the subfamily Caprinae is monophyletic, but only with the exclusion of Saiga from the group; (2) there is no support for monophyly of the four tribes currently recognized (Caprini, Rupicaprini, Ovibovini, and Saigini), suggesting relationships different from those traditionally accepted; (3) the caprine group consists of three major clades corresponding to (a) Budorcas and Ovis, (b) Capricornis, Ovibos, and Naemorhedus, and (c) Capra, Hemitragus, and Pseudois; and (4) the basal branching pattern is very weakly supported by bootstrap or branch support values except for the sister-group relationship of Pantholops with all other caprines, and the phylogenetic positions of Ammotragus, Oreamnos, and Rupicapra remain unclear.

Mitochondrial Gene Sequences and the Molecular Systematics of the Artiodactyl Subfamily Bovinae

Nucleotide sequence evolution of the mitochondrial cytochrome c oxidase subunit II (COII) gene was used to examine the molecular phylogenetics and evolution of the Bovinae, a subfamily within the mammalian order Artiodactyla. The COII gene was sequenced in representatives of three bovine tribes (Bovini, Boselaphini, and Tragelaphini) and the outgroup taxonCapra(subfamily Caprinae). Although the phylogenetic analyses groupedBisonas sister toBos,the genusBisonwas paraphyletic, with the American bison being most closely related to species ofBosrather than to the European bison. COII data also supported a close relationship between African (Syncerus) and Asian (Bubalus) buffaloes, the monophyly of the tribe Bovini, and a sister-group relationship between the tribes Bovini and Boselaphini. Analysis of nucleotide substitutions in the COII gene prompted a system of differential weighting of nucleotide substitutions for inferring phylogenetic relationships across the range of divergence times examined here (2–20 million years). Rates of evolution in the COII gene are examined and compared to evolutionary rates in mtDNA tRNA/rRNA genes and the D-loop among other artiodactyl taxa.

Phylogenetics of the Caprinae Based on Cytochrome b Sequence

Relationships within the subfamily Caprinae have never been fully resolved. Phylogenies have been proposed based on morphological, behavioral, ecological, and some molecular comparisons. Because of the relatively poor fossil record of the Caprinae, paleontological evidence has not been extensively used in phylogenetic reconstruction for this group. Traditionally, four tribes: Saigini, Ovibovini, Rupicaprini, and Caprini, have been recognized. We investigated relationships within the Caprinae by comparing sequences of the cytochrome b gene of mitochondrial DNA from 11 species of Caprinae and 1 Bovinae species. Our analyses suggest that revisions to previous phylogenies, including the dissolution of the Ovibovini, are warranted.

Molecular phylogeny based on the ?-casein and cytochrome b sequences in the mammalian suborder Ruminantia

Nucleotide sequences for the kappa-casein precursor proteins have been determined from the genomic DNAs or hair roots of the Ruminantia. The coding regions, exons 2, 3, and 4, were amplified separately via the three kinds of PCRs and then directly sequenced. The primers were designed from the sequence of bovine kappa-casein gene; they were applicable for the amplification of the kappa-casein genes from the 13 species in the Ruminantia except exon 2 of the lesser mouse deer. These results permitted an easy phylogenetic analysis based on the sequences of an autosomal gene. A phylogenetic tree was constructed from the mature kappa-casein sequences and compared with the tree of the cytochrome b genes which were sequenced from the same individuals. The Cervidae (sika deer, Cervus nippon) were separated from the branch of the Bovidae on the tree of kappa-casein genes with a relatively high confidence level of the bootstrap analysis, but included in the branch of the Bovidae on the tree of cytochrome b genes. The kappa-casein tree indicated a monophyly of the subfamily Caprinae, although the internal branches were uncertain in the Caprinae. The tree based on the nucleotide sequences of cytochrome b genes clearly showed the relationships of the closely related species in the genus Capricornis consisting of serow (C. smatorensis), Japanese serow (C. crispus), and Formosan serow (C. swinhoei). These results would be explained by the difference of resolving power between the kappa-casein and the cytochrome b sequences.

Sequence evolution of SRY gene within Bovidae family

In mammals, male sex determination requires a dominant factor provided by the Y Chromosome (Chr). The SRY gene corresponds to this key factor (Sinclair et al. 1990) and is conserved in mammalian species (Foster et al. 1992). The predicted amino acid sequence of SRY contains a central "high mobility group" domain (HMG-box) characteristic of a wide variety of DNA-binding proteins (Nasrin et al. 1991). This conserved motif represents a functional protein domain necessary for DNA-binding activity of SRY, and mutations in this area are responsible for sex inversion (Harley et al. 1992). In contrast, no function has been assigned to terminal regions of the SRY protein which are poorly conserved between species (Whitfield et al. 1993; Tucker and Lundrigan 1993). Here, we investigated sequence evolution for the coding region of the SRY gene in ruminants (family Bovidae), and we compared the divergences inside two subfamilies: Bovinae and Caprinae. In previous work we cloned the HMG-box region of the sheep, cattle, and goat SRY gene (Payen and Cotinot 1993). Using 5'-RACE from sheep testicular RNA, we isolated a 400-bp fragment that hybridizes specifically with SRY. This fragment was used to screen a male sheep genomic library, and an insert of 12 kb containing the sheep SRY gene was obtained and partially sequenced. From this sequence, oligonucleotide primers flanking the open reading frame (ORF) were defined to amplify genomic DNA from males and females of the Bovidae family. The PCR conditions were: 30 cycles of 94~ for 1 min, 52~ for 1 min, 72~ for 1 min with Taq polymerase (Cetus) and forward (5' T G C C A G G A G G T A T T G A G G G G 3') and reverse primers (5' CAGAGGAGCAGTTATTTTGG 3'). The resulting male specific amplified fragments were cloned in the pBluescript vector KS + and sequenced. The sequences of four investigated species are available under the following accession numbers: Z30265 (sheep), Z30646 (goat), Z30327 (cattle), Z30321 (bison) [EMBL data bank]. The two members of the Caprinae subfamily (sheep and goat) possess the longest ORF: 723 bp against 690 bp for Bovinae. The length difference results in the position of the first ATG. Within the same subfamily, the homology per-

Serological Evidence on the Relationships of the Musk Ox

Opinions concerning the relationships of the musk ox to other members of the family Bovidae are varied and contradictory. Flower and Lydekker (1891) stated that “this genus is generally considered to be a connecting link between the Caprine and Bovine sections, but should rather be regarded as an aberrant type of the former.” Yet the idea, suggested indeed by the very name Ovibos , that the genus forms a link betwen sheep and cattle has never completely disappeared ( cf . Glover, 1953). The genus received monographic treatment by Allen (1913) who, largely on the basis of the morphology of the Recent forms, concluded that “ Ovibos finds its nearest ally among living mammals in the genus Bison .” This view has been largely followed by mammalogists ( cf . Anthony, 1928; Seton, 1929). On the other hand, paleontologists have concluded that Ovibos is most closely allied to goats. Thus Simpson (1945) placed Ovibos in the subfamily Caprinae; Miller and Kellogg (1955) followed his usage in doing so. Seemingly paleontologists have been influenced to this view by study of related Old World genera, especially Urmiatherium, Parurmiatherium, Criotherium and Plesiaddax , which combine to bridge the gap between ovibovine and caprine characteristics (Pocock, 1918; Sickenberg, 1933; Bohlin, 1935; Schwarz, 1937; Pilgrim, 1939). That the controversy is still current is attested by Tome XVII of Grasse, Traite de Zoologie. One contributor to this volume on mammals places the musk ox in the subfamily Bovinae (Frechkop, 1955) while a few pages later another contributor classifies it in the subfamily Caprinae (Lavocat, 1955). This diversity of practice in one volume lends point to the comment by Pilgrim (1939): “ Ovibos has been bandied about like a shuttlecock between the two groups of the oxen and the sheep.” When morphology …