Strong mRNA Expression Research Articles

FrzB-2: a human secreted frizzled-related protein with a potential role in chondrocyte apoptosis

Objective To characterize a novel secreted frizzled-related protein (SFRP) and determine its tissue distribution at the mRNA and protein level.Methods The FrzB-2 gene was identified by expressed sequence tag (EST) analysis of human tissue-derived libraries. Tissue distribution of FrzB-2 mRNA was determined by Northern blot analysis and in situ hybridization. FrzB-2 protein reactivity was localized in human OA articular cartilage by immunocytochemistry, using a polyclonal antibody against a peptide sequence unique to FrzB-2. Apoptosis was detected in articular cartilage sections using Tunel staining.Results ESTs corresponding to FrzB-2 were found in osteoblast, chondrosarcoma, osteosarcoma, osteoclastoma and synovial fibroblast libraries. FrzB-2 mRNA is expressed in a number of tissues and cell types including bone-related cells and tissues such as primary human osteoblasts and osteoclastoma. In situ hybridization studies showed strong FrzB-2 mRNA expression in human chondrocytes in human osteoarthritic (OA) cartilage but negligible levels in normal cartilage chondrocytes. The FrzB-2 cDNA encodes a secreted 40 kDa protein consisting of 346 amino acids. FrzB-2 is 92.5% identical to the rat orthologue, DDC-4, which has been shown to be associated with physiological apoptosis. FrzB-2 protein was selectively detected in human OA articular cartilage by immunocytochemistry, using a polyclonal antibody. Consistent with its potential role in apoptosis, positive FrzB-2 staining and Tunel positive nuclei staining were detected in chondrocyte clones in sections of human OA cartilage.Conclusion These data suggest that FrzB-2 may play a role in apoptosis and that the expression of this protein may be important in the pathogenesis of human OA.

Diversity of N-Acetylglucosamine-6-O-sulfotransferases: Molecular Cloning of a Novel Enzyme with Different Distribution and Specificities

N-Acetylglucosamine-6-O-sulfotransferase (GlcNAc6ST) transfers sulfate to the C-6 position of non-reducing N-acetylglucosamine (GlcNAc) residues. We cloned human and mouse cDNAs encoding a novel GlcNAc6ST, designated as GlcNAc6ST-4, which showed sequence identities of 26 to 41% to other GlcNAc6STs. Human organs with strong expression of the enzyme mRNA were the heart, spleen, and ovary, while in the mouse strong expression was detected in the kidney. The enzyme expressed in CHO cells preferentially acted on mannose-linked GlcNAc, while a core 2 mucin-type oligosaccharide and an N-acetyllactosamine oligomer also served as acceptors. The distribution and the specificity of GlcNAc6ST are different from those of GlcNAc6STs identified previously.

Connective tissue growth factor in human liver cirrhosis.

Connective tissue growth factor (CTGF) belongs to a family of factors that regulate fibrogenesis and wound healing. While the significance of transforming growth factor beta (TGF-beta) in liver fibrosis is well established, the role of CTGF in fibrosing hepatopathy is still unknown. CTGF was analyzed in 10 normal and in 16 cirrhotic liver tissue samples. Northern blot analysis was used to examine the concomitant expression of CTGF and TGF-beta1 mRNAs, and the cellular localization of CTGF mRNA was studied by in situ hybridization. For identification of myofibroblasts and activated hepatic stellate cells, alpha-smooth muscle actin (alpha-SMA) immunohistochemistry was used. Northern blot analysis showed 6.5-fold enhanced expression of CTGF mRNA and 7.8-fold enhanced expression of TGF-beta1 mRNA in liver cirrhosis in comparison with normal controls (p<0.01). By in situ hybridization, CTGF mRNA was detectable in only a few spindle cells in the portal tracts in normal liver samples. In contrast, there was strong expression of CTGF mRNA in fibroblasts and myofibroblast-like cells present in fibrous septa surrounding the cirrhotic nodules, in stellate cells, in endothelial cells and in mesenchymal cells around ductular proliferations, and in ductular epithelial cells. There was a strong correlation between CTGF mRNA and TGF-beta1 mRNA as well as the degree of fibrosis (p<0.01). Overexpression of CTGF in liver cirrhosis, especially in fibroblasts/myofibroblasts and stellate cells, suggests that this novel factor may play an important role in hepatic fibrosis.

Structure and expression of a novel frizzled gene isolated from the developing mouse gut.

The Wnt/APC (adenomatous polyposis coli)/beta-catenin pathway plays a central role in the pathogenesis of colorectal cancer and probably also in normal development of the gastrointestinal tract. Frizzled proteins function as cell-surface receptors for the Wnt family of extracellular ligands. Many components of the Wnt signalling pathway are expressed widely, and determinants of tissue-specific functions are poorly understood. A better understanding of how Wnt signalling regulates tissue-specific development and gut epithelial homoeostasis requires characterization of the many components of this signalling pathway. We therefore wished to identify frizzled genes with limited tissue distribution of expression and isolated Mfz10, a novel member of the mouse family of frizzled genes, from the developing fetal gut. Highest levels of Mfz10 mRNA are detected throughout late embryonic development, in the brain, heart, lung and digestive tract. In adult mice Mfz10 mRNA is detected at highest levels in the heart, brain and lung. Expression in the adult gastrointestinal tract is much weaker, with higher levels in foregut derivatives (oesophagus and stomach) compared with regions derived from the fetal midgut and hindgut; particularly strong mRNA expression is observed in the squamous epithelium of the oesophagus. The amino acid sequence of Mfz10 is nearly identical to that of human FzE2 (also known as FzD2). Interestingly, mRNA levels of human FzD2 are reported to be up-regulated in oesophageal squamous cell carcinomas. These findings suggest a likely role for Mfz10 in the developing and adult foregut.

Distribution of growth-blocking peptide in the insect central nervous tissue.

Parasitization of the armyworm Pseudaletia separata by the endoparasitic wasp Cotesia kariyai inhibits larval growth and delays pupation, conditions necessary for proper maturation of the parasite larvae. Parasitization is correlated with an elevated level of a 25-amino-acid hormone-like peptide, growth-blocking peptide (GBP, ENFSGGCVAGYMRTPDGRCKPTFYQ). Injection of synthetic GBP into nonparasitized larvae dose dependently mimics the effects of parasitization by delaying the larval development. Here we studied the relationship between parasitization and both the production and distribution of GBP in central nervous tissues. We found that parasitization is correlated with an elevated expression of GBP mRNA, and increased concentrations of both proGBP and GBP in the host insect brain and subesophageal ganglion. The increase in proGBP precedes that of the mature GBP by about 12 h. In situ hybridization analysis using sections of parasitized and nonparasitized larval brains showed strong expression of GBP mRNA in perineural cells and/or class I neuroglia in the rind of both larval brains. The expression in parasitized larval brain-subesophageal ganglion is approximately two- to threefold higher than that in nonparasitized larvae. The presence of GBP in insect neural tissue, and its role in inhibiting growth, suggest an involvement in the regulation of neurosecretory cells.

Clusterin may be involved in rat liver allograft tolerance

Little is known about the possible role of complement inhibitors on tolerance induced by liver allografts. Clusterin, which is a plasma glycoprotein, inhibits cytolytic membrane attack complex (MAC) of complement by binding to soluble C5b-7 complex. The role of clusterin in relation to the naturally achieved tolerance in a rat orthotopic liver transplantation (OLT) has not been investigated before. Here we determined the kinetics of clusterin expression at different post-transplantation time points in a tolerogenic model (DA-PVG) where rejection was naturally overcome without any immunosuppressive drugs in comparison with the syngenic OLT model (DA-DA). Peripheral blood and liver tissues were taken from OLT at various post-operative time points. A strong expression of soluble clusterin was observed on post-transplantation day 7, which occurred at the peak of the rejection in this tolerogenic OLT model. The expression of clusterin remained strong even after tolerance was achieved. The intensity of clusterin expression was much stronger when compared with the syngenic OLT (DA-DA) model after OLT. A strong expression of clusterin mRNA was also observed in the tolerogenic model on post-OLT day (POD) 7 and the expression persisted when compared with the syngenic model on post-OLT day 60. Our data have shown that the strongest levels of clusterin during the reaction phase in tolerogenic OLT may be involved in tolerance induction.

The Spatial and Temporal Expression Patterns of Netrin Receptors, DCC and Neogenin, in the Developing Mouse Retina

Recently it has been demonstrated that the guidance of retinal ganglion cell (rgc) axons through the optic disc is dependent on the DCC/netrin-1 axonal guidance system. To gain further insight into the function of the netrin receptors, DCC and Neogenin, in retinal development we have studied the expression patterns of these receptors in the embryonic mouse retina. Neogenin mRNA was restricted to a single neural cell type, the rgc. However, strong Neogenin mRNA expression was observed in the extending fiber cells of the developing lens suggesting a role for Neogenin in the migration events shaping the early lens. Our studies demonstrated that DCC mRNA was expressed at high levels in chains of closely opposed neurons as they migrated towards the emerging mantle layer in the early retina (E12.5–E13.5) suggesting a role for DCC in the migration of neurons out of the ventricular zone. DCC protein expression was high on rgc axons as they actively navigated through the optic disc into the optic nerve. At birth, when the majority of rgc axons had projected through the optic disc, DCC protein was no longer detectable on the distal axonal segments within the optic nerve despite significant DCC protein expression on the proximal axonal membranes in the nerve fiber layer. These observations suggest that a localized down-regulation of DCC protein occurs on projecting axonal membranes once the DCC guidance function is no longer required. We also demonstrated that DCC mRNA and protein were expressed by amacrine cells and Müller glial cells while DCC mRNA was detected in horizontal cells. Taken together, these expression patterns suggest a role for DCC in axon outgrowth and/or pathfinding for a variety of retinal neurons and in the migration of newly born neurons within the developing retina.

Molecular cloning and characterization of a human homologue of TBPIP, a BRCA1 locus-related gene

Here we clone the human homologue of TBPIP [Tat binding protein 1(TBP-1)-interacting protein]. TBPIP is a molecule that has been cloned from mouse as a cofactor of TBP-1. Eighty-eight per cent of the deduced amino acid sequence of human TBPIP coincides with that of mouse TBPIP. CAT assay reveals that human TBPIP could interact with human TBP-1, then enhance the function of TBP-1 on HIV (human immunodeficiency virus)-Tat-mediated transactivation. Our radiation hybrid mapping indicates that TBPIP is located on chromosome 17q12–21. A DNA database search uncovers that an apparent part of TBPIP has been obtained as a BRCA1 locus-related gene (OV-4) and mapped onto chromosome 17q12–21. Interestingly, the nucleotide structure of human TBPIP is very similar to that of the GT198 gene, which has been cloned from a human breast cancer cell line and also mapped onto the BRCA1 locus. Since a very high rate of gene mutation is observed in the BRCA1-related region in breast cancers and expression of authentic GT198 mRNA could not be confirmed in either BT-474 (other kind of human breast cancer cell line) or normal human testis (where the strong expression of GT198 mRNA is reported), it is likely that GT198 is a mutated form of human TBPIP.

EXPRESSION OF INTERLEUKIN 1α AND β, AND INTERLEUKIN 1 RECEPTOR ANTAGONIST mRNA IN THE RAT CENTRAL NERVOUS SYSTEM AFTER PERIPHERAL ADMINISTRATION OF LIPOPOLYSACCHARIDES

Interleukin 1α (IL-1α) and IL-1β, and the endogenous IL-1 receptor antagonist (IL-1ra) are known members of the IL-1 family. Using in situ hybridization histochemistry we demonstrated that following endotoxin injection (lipopolysaccharides, LPS, 2.0mg/kg, i.p.) a time dependent expression and partly different expression patterns of the cytokines occurred within the rat brain and pituitary gland. All cytokines were observed in the choroid plexus. In addition, IL-1ra mRNA expressing cells were observed scattered in the brain parenchyma, whereas scattered IL-1β mRNA expressing cells were restricted to central thalamic nuclei, the dorsal hypothalamus, and cortical regions, such as the parietal and frontal cortex. A strong IL-1β mRNA expression was found in the circumventricular organs. In the pituitary gland, a low IL-1α and a high IL-1β mRNA expression was observed, with the highest density of cytokine-expressing cells seen in the posterior pituitary. The cell types expressing the mRNA's of IL-1α, IL-1β and IL-1ra were identified as monocytes in the circumventricular organs and the pituitary gland, and as microglia in the brain parenchyma. In conclusion, the present findings revealed that cytokine production in response to a peripheral endotoxin challenge mainly occurs in peripherally derived monocytes in the circumventricular organs and the pituitary gland. IL-1β is the predominant form expressed, whereas the expression of IL-1α mRNA and IL-1ra mRNA is lower. Our observations support the view that peripherally derived IL-1 may play a role in the induction of centrally mediated illness symptoms.

Human cystathionine γ-lyase: developmental and in vitro expression of two isoforms

Cystathionine gamma-lyase (CGL) is the last enzyme of the trans-sulphuration pathway, which converts methionine into cysteine. To study the possible differences in enzymic activity of the two human cystathionine gamma-lyase isoforms characterized earlier, these were separately expressed in human kidney embryonic 293T cells. Furthermore, developmental changes in the expression of the two mRNA forms as well as the enzymic activity in human liver were studied, as it has been postulated that a change in the relative expression of CGL isoforms causes the postnatal increase in CGL activity. Transfection with the longer isoform increased the CGL activity 1.5-fold, while the activity of the cells transfected with the shorter form did not differ from the basal activity. In human liver samples, CGL activity was only detected in adult tissue (68+/-9 nmol of cysteine/h per mg of protein), whereas activity in fetal, premature and full-term neonatal liver tissue was undetectable. In contrast, strong mRNA expression of both mRNA isoforms was detected from the 19th gestational week onwards and the longer form of CGL appeared to be predominant. The expression of the two mRNA forms varied in parallel. In conclusion, we have shown that only cells overexpressing the longer form of CGL have increased activity, and CGL appears to be regulated at the post-transcriptional level during development.

Interleukin-1 beta, tumor necrosis factor-alpha and lipopolysaccharide induce expression of monocyte chemoattractant protein-1 in calf aortic smooth muscle cells.

To investigate whether interleukin-1 beta(IL-1 beta), tumor necrosis factor-alpha (TNF-alpha) and lipopolysaccharide (LPS) induce expression of monocyte chemoattractant protein-1 (MCP-1) mRNA and protein in calf aortic smooth muscle cells(SMCs), calf aortic SMCs were cultured by a substrate-attached explant method. The cultured SMCs were used between the third to the fifth passage. After the cells became confluent, the SMCs were exposed to 2 ng/ml IL-1 beta, 20 ng/ml TNF-1 alpha and 100 ng/ml LPS respectively, and the total RNA of SMCs which were incubated for 4 h at 37 degrees C were extracted from the cells by using guanidinium isothiocyanate method. The expression of MCP-1 mRNA in SMCs was detected by using dot blotting analysis using a probe of gamma-32P-end-labelled 35-mer oligonucleotide. After a 24-h incubation, the media conditioned by the cultured SMCs were collected. The MCP-1 protein content in the conditioned media was determined by using sandwich ELISA. The results were as follows: Dot blotting analysis showed that the cultured SMCs could express MCP-1 mRNA. After a 4-h exposure to IL-1 beta, TNF-alpha and LPS, the MCP-1 mRNA expression in SMCs was increased (3.6-fold, 2.3-fold and 1.6-fold, respectively). ELISA showed that the levels of MCP-1 protein in the conditioned media were also increased (2.9-fold, 1.7-fold and 1.1-fold, respectively). The results suggest that calf aortic SMCs could express MCP-1 mRNA and protein. IL-1 beta and TNF-alpha can induce strong expression of MCP-1 mRNA and protein, and the former is more effective than the latter.

Vomeroglandin/CRP-Ductin Is Strongly Expressed in the Glands Associated with the Mouse Vomeronasal Organ: Identification and Characterization of Mouse Vomeroglandin

Vomeroglandin, a subform of mouse CRP-ductin, is a protein strongly expressed in the glands of mouse vomeronasal system. Both the proteins contain several of scavenger receptor cysteine-rich and CUB domains and one ZP domain. This domain arrangement is similar to those of rat Ebnerin, human DMBT1, and rabbit hensin. In situ hybridization analysis shows strong expression of vomeroglandin mRNA in the glands of vomeronasal system. Immunological analyses detect both membrane-bound and secreted forms of vomeroglandin. The secreted protein seems to be localized in the lumen of the vomeronasal organ, playing a certain role in the pheromone perception.

Decay-Accelerating Factor in Guinea Pig Stomachs Following Ischemia Reperfusion Stress

A complement regulatory protein, decay-accelerating factor (DAF, CD55), is known to protect host tissues from autologous complement activation. DAF is present on the apical side of human gastric epithelial cells, and its expression increases during gastritis. To develop an animal model for analysis of DAF expression on gastric cells, a mAb to guinea pig DAF was successfully used. Although DAF expression in the mucosal epithelium of the stomach is weak, as judged by immunohistochemical staining with the mAb, it was temporarily up-regulated at 12 and 24 h, and at 3 days after ischemia reperfusion (I/R) (p < 0.05). The DAF mRNA level in gastric tissues was determined by Northern blot analysis and found to be highest at 6 h after I/R, returning to the baseline at 24 h. Strong DAF mRNA expression was observed in the cytoplasm of cells beneath the eroded tissues 6 h after I/R. In guinea pigs, alternative splicing of DAF mRNA generates both GPI-anchored types and transmembrane types of DAF. RT-PCR analysis revealed that mRNAs of the transmembrane types had become significantly dominant by 6 h after I/R, whereas levels for the GPI-anchored types remained unchanged. In guinea pigs depleted of complement by cobra venom factor treatment, the area of erosion and the up-regulation of DAF expression in gastric epithelial cells after I/R were significantly limited compared with the normocomplementemic group, indicating that DAF may be up-regulated by an inflammatory stress.

Direct Ovarian Effects of a GnRH Agonist in Hypophysectomized Immature Rats: Inhibition of Theca-Interstitial Luteinizing Hormone Receptor mRNA Expression and Induction of Interstitial Cell Differentiation

The effect of a gonadotropin-releasing hormone (GnRH) agonist on luteinizing hormone (LH) receptor mRNA expression was examined histologically in the ovaries of immature hypophysectomized (HPX) rats by in situ hybridization. In the ovaries of HPX rats treated with diethylstilbestrol (DES) and pregnant mare serum gonadotropin (PMSG), LH receptor mRNA was expressed in the granulosa cells of mature follicles as well as the theca-interstitial cells. In DES-primed ovaries of rats treated with both GnRH agonist plus PMSG, many follicles were luteinized without ovulation, and the signal of LH receptor mRNA disappeared completely in the theca-interstitial cells as well as the luteinized cells, but remained in the granulosa cells of unaffected mature follicles. The complete suppression of the theca-interstitial LH receptor expression by GnRH agonist was also observed in HPX rats that received no other treatment. On the other hand, the coadministration of a GnRH antagonist with PMSG resulted in the hyperstimulation of follicular growth, accompanied by very strong expression of LH receptor mRNA in the granulosa cells as well as the thecainterstitial cells. In addition, morphological changes in the ovarian interstitial cells were also induced by the administration of GnRH agonist in HPX rats: loose connective tissue decreased and the interstitial cell mass markedly increased. The increase of the interstitial cells became more prominent when rats were treated with GnRH agonist and testosterone simultaneously. These results suggest that GnRH may be an important factor for modulating the interstitial cell function and differentiation in the rat ovary.

Expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in the human kidney.

The secosteroid hormone 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) plays a vital role in calcium metabolism, tissue differentiation, and normal bone growth. Biosynthesis of 1,25(OH)2D3 is catalyzed by the mitochondrial cytochrome P450 enzyme 25-hydroxyvitamin D3 1alpha-hydroxylase (1alpha-hydroxylase). Although activity of this enzyme has been described in several tissues, the kidneys are recognized to be the principal site of 1,25(OH)2D3 production. To date, enzyme activity studies using vitamin D-deficient animals have suggested that 1alpha-hydroxylase is expressed exclusively in proximal convoluted tubules. With the recent cloning of 1alpha-hydroxylase, specific cRNA probes and in-house polyclonal antiserum have been used to determine the distribution of 1alpha-hydroxylase along the human nephron. Immunohistochemistry and in situ hybridization studies indicated strong expression of 1alpha-hydroxylase protein and mRNA in the distal convoluted tubule, the cortical and medullary part of the collecting ducts, and the papillary epithelia. Lower expression was observed along the thick ascending limb of the loop of Henle and Bowman's capsule. Weaker and more variable expression of 1alpha-hydroxylase protein and mRNA was seen in proximal convoluted tubules, and no expression was observed in glomeruli or vascular structures. These data show for the first time the distribution of alpha1-hydroxylase expression in normal human kidney. In contrast to earlier enzyme activity studies conducted in vitamin D-deficient animals, our data indicate that the distal nephron is the predominant site of 1alpha-hydroxylase expression under conditions of vitamin D sufficiency.

Growth factor-regulated expression of enzymes involved in nucleotide biosynthesis: a novel mechanism of growth factor action.

Keratinocyte growth factor (KGF) is a potent and specific mitogen for epithelial cells, including the keratinocytes of the skin. We investigated the mechanisms of action of KGF by searching for genes which are regulated by this growth factor in cultured human keratinocytes. Using the differential display RT-PCR technology we identified the gene encoding adenylosuccinate lyase [EC 4.3.2.2] as a novel KGF-regulated gene. Adenylosuccinate lyase plays an important role in purine de novo synthesis. To gain further insight into the potential role of nucleotide biosynthesis in the mitogenic effect of KGF, we cloned cDNA fragments of the key regulatory enzymes involved in purine and pyrimidine metabolism (adenylosuccinate synthetase [EC 6.3.4.4], phosphoribosyl pyrophosphate synthetase [EC 2.7.6.1], amidophosphoribosyl transferase [EC 2.4.2.14], hypoxanthine guanine phosphoribosyl transferase [EC 2.4.2.8] and the multifunctional protein CAD which includes the enzymatic activities of carbamoyl-phosphate synthetase II [EC 6.3.5.59], aspartate transcarbamylase [EC 2.1.3.2] and dihydroorotase [EC 3.5.2.3]). Expression of all of these enzymes was upregulated after treatment with KGF and also with epidermal growth factor (EGF), indicating that these mitogens stimulate nucleotide production by induction of these enzymes. To determine a possible in vivo correlation between the expression of KGF, EGF and the enzymes mentioned above, we analysed the expression of the enzymes during cutaneous wound repair, where high levels of these mitogens are present. Indeed, we found a strong mRNA expression of all of these enzymes in the EGF- and KGF-responsive keratinocytes of the hyperproliferative epithelium at the wound edge, indicating that their expression might also be regulated by growth factors during wound healing.

Expression of the Arylhydrocarbon Receptor and the Arylhydrocarbon Receptor Nuclear Translocator during Early Gestation in the Rabbit Uterus

The arylhydrocarbon receptor (AhR) and the arylhydrocarbon receptor nuclear translocator (ARNT) are members of the PAS gene family mediating toxic effects of xenobiotics such as dioxin and polychlorinated biphenyls. We have analyzed the expression and cellular distribution of rabbit AhR and ARNT mRNA and protein level in the nonpregnant uterus and the pregnant and pseudopregnant uterus at Days 6 to 12 of gestation. In the preimplantation uterus at Day 6 of gestation and in the interimplantation and pseudopregnant uterus at Days 7, 8, 9, and 12 of gestation, low levels of AhR transcripts were detected in the glandular uterine epithelium. Upon attachment of the blastocyst at Day 7 of gestation, a strong expression of AhR and ARNT mRNA was observed in the luminal and glandular epithelium of the antimesometrial uterine compartment. In contrast, AhR and ARNT expression was low in the luminal epithelium of the paraplacental and the mesometrial placental fold. AhR mRNA was also detected in the trophoblast cells. During early placentation at Day 9 of gestation, expression of AhR and ARNT was first observed in the perivascular decidualized stromal cells and, at Day 12, extended to the decidualized stromal cells of the placental bed. Within the placenta, the syncytiotrophoblast expressed only low levels of AhR and ARNT mRNA and no protein. The specific expression patterns of AhR and ARNT during early gestation suggest functional roles for both transcription factors during feto-maternal interactions in the rabbit.

Antenatal dexamethasone suppresses tumor necrosis factor-alpha expression in hypoplastic lung in nitrofen-induced diaphragmatic hernia in rats.

The hypoplastic lung in congenital diaphragmatic hernia (CDH) has both a quantitative and qualitative reduction in surfactant. Tumor necrosis factor-alpha (TNF-alpha) drastically decreases surfactant phospholipids synthesis by isolated human type II pneumocytes. Recently, it was shown that TNF-alpha mRNA expression is increased in human hypoplastic CDH lung. Antenatal glucocorticoid therapy demonstrates improved surfactant biochemical immaturity in an animal CDH model. The aim of this study was to investigate the effect of antenatal dexamethasone (Dex) on TNF-alpha protein and gene expression in nitrofen-induced CDH hypoplastic lung in rats. A CDH model was induced in pregnant rats after the administration of nitrofen on d 9.5 of gestation. Dex was given intraperitoneally on d 18.5 and 19.5. Cesarean section was performed on d 21. In situ hybridization was performed with a rat TNF-alpha-specific and digoxigenin-labeled oligonucleotide probe. TNF-alpha level was measured in solubilized lung tissue extracts by ELISA. In control lung, TNF-alpha mRNA expression was weak or absent. In contrast, strong TNF-alpha mRNA expression was demonstrated in type II pneumocytes and bronchiolar epithelium in CDH lung. In Dex-treated CDH lung, TNF-alpha mRNA expression was weak in both type II pneumocytes and the bronchiolar epithelium. The level of TNF-alpha was elevated significantly in CDH lung compared with levels in control lung extracts (p < 0.01). In Dex-treated CDH lung, TNF-alpha protein was significantly decreased compared with CDH lung (p < 0.05). Our findings suggest that the reduction in the local production of TNF-alpha may be one contributing mechanism by which antenatal glucocorticoid therapy improves pulmonary parenchymal immaturity, including surfactant.

Molecular Cloning of a Human MafF Homologue, Which Specifically Binds to the Oxytocin Receptor Gene in Term Myometrium

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

HERV-F (XA34) is a full-length human endogenous retrovirus expressed in placental and fetal tissues.

The complete sequence of XA34 was identified from a 107 kb genomic clone originating from the human chromosome 7q31.1-q31.3. The 7.1 kb human endogenous retrovirus (HERV) contains LTR's, gag, pol and env, and a pol sequence which is identical to the 2.3 kb XA34 cDNA clone which we previously isolated from a human glioma cDNA library (Widegren et al., 1996). The HERV is located in a reversed orientation within an intron-sequence of a gene similar to mouse adseverin(D5). The gag and protease regions are intact. However, the pol and env regions are truncated by a deletion which removes the C-terminal end of the integrase and the complete surface protein. The HERV sequence is bordered by a five base-pair direct repeat and has the TG...CA structure. Over the complete HERV genome, XA34 is very similar to members of the HERV-F family and shares the same primer binding site which is homologous to phenylalanine (F) tRNA. Therefore, XA34 is termed HERV-F(XA34). HERV-F(XA34) has an open reading frame (ORF) of 1000 bp in the gag region which starts with Met-Gly in a favorable context and stops in the capsid protein. A strong mRNA expression of HERV-F(XA34) is demonstrated in placental tissue, mainly residing in two transcripts of approximately 7.5 and 8.5-9 kb respectively. Analyses of expressed sequence tags (ESTs) have identified the expression of HERV-F(XA34) sequences in placental tissue, fetal liver/spleen, olfactory epithelium and in an epithelial skin tumor. EST analysis has also identified splice variants of HERV-F(XA34), in which the gag, pol and most of the env regions are spliced out. These splice variants contain a short ORF encoded in the region from the C-terminal portion of env to the 3'-LTR. In addition, ESTs identical to HERV-Fb have been identified in retinal, fetal liver/spleen and brain tissue as well as Jurkat cells. The analyses indicate that the 5'-LTR of HERV-Fb may function as an alternative poly A site of a Krüppel related zinc finger gene (ZNF195).