Integration Strategy Research Articles

Renewable Energy Technologies: Advances and Challenges

The transition from fossil fuels to renewable energy sources is imperative to combat climate change and promote sustainability. This paper explores the recent advancements in renewable energy technologies, focusing on solar, wind, hydro, and bioenergy. It also identifies the challenges these technologies face in terms of economic viability, technological integration, and policy support. Through a comprehensive analysis, this paper underscores the need for coordinated efforts among stakeholders to enhance the adoption of renewable energy. The urgent need to mitigate climate change and adopt sustainable energy practices has propelled the advancement of renewable energy technologies. This paper delves into the recent strides made in solar, wind, hydro, and bioenergy, analysing their potential to revolutionize the global energy landscape. It explores the technical innovations, such as increased photovoltaic cell efficiency and larger, more efficient wind turbines, that have significantly enhanced the performance and cost-effectiveness of these technologies. However, challenges persist in achieving widespread adoption. These include the intermittent nature of renewable energy sources, requiring robust energy storage solutions and grid integration strategies. Additionally, economic factors like initial investment costs and fluctuating energy prices pose hurdles to the financial viability of renewable energy projects. Furthermore, the environmental and social impacts of renewable energy development, such as land use and wildlife habitat disruption, must be carefully considered and mitigated. This includes substantial investments in research and development to further improve renewable energy technologies, supportive government policies and incentives to stimulate market growth, and collaborative efforts among policymakers, industry stakeholders, and researchers to foster innovation and knowledge sharing. By addressing these key issues, we can accelerate the transition to a sustainable energy future powered by renewable resources.

Integration of National Chemical Hazards Monitoring, Total Diet Study, and Human Biomonitoring Programmes for Food Safety Exposure Assessment in Singapore

Food safety and food security can impact the quality of human life, and these two aspects are interrelated alongside many influencing external factors. Global stressors such as climate change, recent pandemic, and geopolitical tensions have demonstrated tangible impacts on food security and safety. Food and food system innovation is a key strategy towards feeding the world in a more sustainable and climate-resilient manner. This paper highlights the use of a science-based risk assessment and management in Singapore’s food safety system, specifically in the integration of exposure assessment approaches to support evidence-based food safety risk analysis and decision-making. The use of complementary top-down and bottom-up exposure assessment approaches through the market monitoring programme, total diet study and human biomonitoring forms a comprehensive integrated exposure assessment strategy which can ultimately inform policy and measures in ensuring and securing a supply of safe food. The discussion on such application for chemical food safety in Singapore offers additional insights into the synergistic inter-relationships contributing to the exposure assessment associated with chemicals in food.

Effective Control of Neofusicoccum parvum in Grapevines: Combining Trichoderma spp. with Chemical Fungicides

Vitis vinifera is highly susceptible to grapevine trunk diseases, with Neofusicoccum parvum recognized as a highly destructive pathogen. This study investigates the biocontrol potential of five Trichoderma species (T. harzianum, T. viride, T. asperellum, and T. virens) against N. parvum, evaluating multiple biocontrol mechanisms (mycoparasitism, competition for nutrients, production of volatile organic compounds (VOCs), and antibiosis) as well as their compatibility with the fungicides copper oxychloride and sulfur. Results demonstrated that (1) Trichoderma harzianum effectively suppressed N. parvum through VOC production, mycoparasitism, and nutrient competition, significantly reducing pathogen growth in planta while showing compatibility with both fungicides, highlighting its suitability for integrated disease management; (2) Trichoderma viride showed high inhibition of N. parvum in vitro, but its phytotoxicity in planta limits its field application. These findings support T. harzianum as a promising agent within integrated disease management strategies, offering a sustainable alternative to reduce chemical fungicide reliance in controlling grapevine trunk pathogens.

Floater Assembly and Turbine Integration Strategy for Floating Offshore Wind Energy: Considerations and Recommendations

Floater Assembly and Turbine Integration Strategy for Floating Offshore Wind Energy: Considerations and Recommendations

Proportional, Integral and Derivative Control Strategy of Triethylene Glycol Recovery Regenerator for Optimum Natural Gas Dehydration Process

Proportional, Integral and Derivative Control Strategy of Triethylene Glycol Recovery Regenerator for Optimum Natural Gas Dehydration Process

First report of natural infection by cowpea mild mottle virus on Sesbania cannabina and Physalis angulata in China.

Vigna unguiculata (L.) Walp. (cowpea) is an important economic vegetable in Sanya, Hainan Province, China. But it is easily infected by various viral diseases, especially cowpea mild mottle virus (CPMMV), bean common mosaic virus (BCMV) and cowpea polevirus 2 (CPPV2), causing symptoms such as yellowing, dwarfism and mosaic of leaves, affecting photosynthesis of cowpea. Weeds are perfect intermediate hosts for crop viruses. In the cowpea fields of Sanya, there are a large number of weeds growing nearby, including Sesbania cannabina (Retz.) Poir. and Physalis angulata (L.). S. cannabina, a species of legume, has high nutritional value as the one of the most admired green-manuring plants widely used in crop field for gaining yield and decreasing the quantity of chemical fertilizer (Tiwari et al. 2004). P. angulata, commonly known as husk tomato, is an annual Solanaceaea vegetable crop grown for its fruits (Ramakrishna Pillai et al. 2022). In July 2022, S. cannabina and P. angulata surrounding one hectare of cowpea fields of Sanya with chlorotic and asymptomatic (Figure S1) were collected, and then their total RNAs were individually extracted by the TRIzol Reagent (Life, USA), and two cDNA libraries (one including the RNA samples of S. cannabina, another including the RNA sample of P. angulata) were subsequently constructed using VAHTS Universal V8 RNA-seq Library Prep Kit (Vazyme, China). High-throughput sequencing was performed on a DNBSEQ-T7 platform (BGI, China) with the 150 bp paired-end method. A total of 40,134,299 and 149,473,308 clean reads were de novo assembled by SPAdes 3.15.5 to generate contigs, followed by BLAST-x/n search in viral genomes in GenBank. From the RNA-seq library of S. cannabina, we identified one contig (6255 nt) that exhibited 96.45% nucleotide identity to the CPMMV isolate CPMMV-JS (MT366555), covering 6033 bp out of 6255 bp (6033/6255) of the contig. Additionally, we found seven contigs (ranging in length from 1870 nt to 8336 nt) in the RNA-seq library of P. angulata that showed 78.92% to 84.15% nucleotide identity to the CPMMV isolate Brunt (OK558693), with specific alignment lengths varying from 669/795 to 4244/5337. CPMMV was verified by reverse transcription - polymerase chain reaction (RT-PCR) detection using specific primer (F: 5'-CTGGCCAAGTGGTTTGTTTT-3', R: 5'- AACCGGGTTTACAATCCACA -3') (Wei et al. 2020). PCR products were extracted from an agarose gel, cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon Biotech, Shanghai). Two clones for each PCR product were sequenced by Sanger sequencing. The amplified 1865 bp fragments of S. cannabina (PP790744) and P. angulata (PP790743) had 98.07% identity (1727 bp out to 1761 bp) and 97.92% sequence identity (1739 bp out to 1776 bp) to CPMMV-JS (MT366555). Afterwards, we collected S. cannabina and P. angulata with similar symptoms around two cowpea fields (each field covers an area of about one hectare) in three districts of Sanya, namely Yazhou, Tianya, and Haitang, and conducted CPMMV detection. We found that CPMMV was detected in all six samples. CPMMV, including genus Carlavirus and family Betaflexiviridae, was first identified on cowpea in Ghana in the 1970s. Since then, it has been shown to have a very extensive geographical distribution and a wide natural host range. CPMMV principally infects Fabaceae, it is also able to infect hosts from Solanaceaea, Nyctaginaceae, Cleomaceae, Asteraceae and Lamiaceae (Celli et al. 2016; Lamas et al. 2017; Zanardo and Carvalho 2017). To our knowledge, this is the first report of natural infection of the S. cannabina and P. angulata by CPMMV, which may represent additional reservoirs of this virus in the region. Meanwhile, investigating CPMMV in S. cannabina and P. angulata is crucial for developing integrated strategies to prevent its transmission to economically important plants such as cowpea.

Making waves: Public health risks from arsenic in Mexico's water extraction practices

In response to water scarcity in Mexico´s urban areas, authorities have implemented significant measures to increase water access, primarily by overexploiting groundwater resources. However, this approach has unintentionally worsened human exposure to groundwater arsenic consumption, which is part of a broader phenomenon known as environmental problem shifting. This paper examines the public health implications of arsenic contamination in Mexico's groundwater. We particularly focus our analysis on urban areas to demonstrate the policy gap that leaves the issue of arsenic contamination caused by over-pumping, and its associated widespread health risks, largely unaddressed. We draw on evidence from Mexico, but also Bangladesh, to define and describe the issue of such problem-shifting and how it underlies the urgent need to develop integrative water management strategies that balance the demands of water access with the necessity of maintaining water quality. By analysing water data from Mexico, the paper calls for a reconsideration of water policies to prevent further health crises.

TCKAN: a novel integrated network model for predicting mortality risk in sepsis patients.

Sepsis poses a major global health threat, accounting for millions of deaths annually and significant economic costs. Accurately predicting the risk of mortality in sepsis patients enables early identification, promotes the efficient allocation of medical resources, and facilitates timely interventions, thereby improving patient outcomes. Current methods typically utilize only one type of data-either constant, temporal, or ICD codes. This study introduces a novel approach, the Time-Constant Kolmogorov-Arnold Network (TCKAN), which uniquely integrates temporal data, constant data, and ICD codes within a single predictive model. Unlike existing methods that typically rely on one type of data, TCKAN leverages a multi-modal data integration strategy, resulting in superior predictive accuracy and robustness in identifying high-risk sepsis patients. Validated against the MIMIC-III and MIMIC-IV datasets, TCKAN surpasses existing machine learning and deep learning methods in accuracy, sensitivity, and specificity. Notably, TCKAN achieved AUCs of 87.76% and 88.07%, demonstrating superior capability in identifying high-risk patients. Additionally, TCKAN effectively combats the prevalent issue of data imbalance in clinical settings, improving the detection of patients at elevated risk of mortality and facilitating timely interventions. These results confirm the model's effectiveness and its potential to transform patient management and treatment optimization in clinical practice. Although the TCKAN model has already incorporated temporal, constant, and ICD code data, future research could include more diverse medical data types, such as imaging and laboratory test results, to achieve a more comprehensive data integration and further improve predictive accuracy.

Merger and Acquisition of Indian Banks and Their Impact on its Financial Performance & Shareholder Wealth

This study investigates the financial performance and shareholder value outcomes of mergers and acquisitions (M&A) in the Indian banking sector. Through the analysis of three major bank mergers—State Bank of India and its associates, Bank of Baroda with Vijaya and Dena Banks, and Punjab National Bank with Oriental Bank of Commerce and United Bank—the research evaluates operational performance, profitability, and shareholder returns pre- and post-merger. Using financial ratios and t-tests, the study identifies significant changes in financial metrics and shareholder wealth. The findings suggest that while M&A can enhance operational efficiency and shareholder value, the results vary based on individual merger circumstances and integration strategies.

Early Bug Detection through Shift Left Testing

Shift-Left Testing is a preventive approach in the SW development process of identifying and handling defects where testing is performed before the flow proceeds to the subsequent phases of SDLC. In most situations, testing is done after development, and this means that any defects get discovered later contributing to high costs and more time to complete the project. Essentially, Shift-Left Testing implies that testing should be conducted during the design or the coding stage and is beneficial due to the fact that in those stages of development, it is considerably less expensive to rectify problems that are detected. It uses integrated strategies including continuous integration, static code analysis and automated testing, in which the development and the test team work together from the start. Consequently, the approach results in enhanced quality of the software, their development time, and minimization of the post-release faults. Although Shift-Left Testing is changing many ways in software development for the better, it has some problems, for instance, changing organizational culture and has high demands to test automation frameworks.

Investigating disturbances of the core material system in the lung-gut axis of COPD based on the transcriptomics-metabolomics-microbiomics integration strategy

BackgroundAlthough still the significance of the lung-gut axis for COPD is increasingly highlighted, it’s urgent to ulteriorly comprehend the sophisticated disturbance of the core material system along the lung-gut axis, which is of great importance for the accurate precaution and prognosis of COPD efficiently. Aim of the studyThe purpose of this study was to analyze the information connections of the lung-gut axis, thus supporting the effective treatment of COPD. Materials and methodsAn integrated multi-omics approach was applied to explore the lung-gut axis in COPD rats. Firstly, based on transcriptomics, the ssGSEA algorithm was used to evaluate changes in pulmonary inflammatory cells. Then, the disturbances of metabolic pathways in lung and feces were revealed by the Lilikoi algorithm using LC-MS and 1H NMR metabolomics. Next, the composition and function of microbial communities in lung and feces were analyzed by 16 s rRNA sequencing. Finally, the association analysis was employed to explore the possible crosstalk between the lung and gut. Furthermore, the core material system in the lung-gut axis was described based on network topology analysis. ResultFirstly, 1652 differential expression genes (involving in immune response-regulating signaling pathway, etc.) and 15 types of inflammatory cells (including neutrophil, etc.) were identified related to COPD. 135 pulmonary differential metabolites (involving in arachidonic acid metabolism, etc.) and 105 fecal differential metabolites (involving in alanine metabolism, etc.) were revealed by metabolomics. The f_Pasteurellaceae, etc. and g_Ruminococcus_2, etc. were identified associated with COPD in lung and gut. Finally, disturbances of the core material system, composed of macrophage, neutrophil, activated dendritic cell, myeloid derived suppressor cell, arachidonic acid metabolism, alpha linolenic acid & linoleic acid metabolism, g_Psychrobacter in lung and bile secretion, p_Proteobacteria in gut, were obtained to analyze the possible information flow of the lung-gut axis. ConclusionThe core material system for the lung-gut axis have been revealed, which might contribute to the illustration of the pathogenesis of COPD. In the future, more researches are required on the impact of the core material system in the lung-gut axis on the onset and recovery process of COPD, suggesting more precise identifying effective treatments for the disease.

Sustainable desalination through hybrid photovoltaic/thermal membrane distillation: Development of an off-grid prototype

Global freshwater scarcity is a critical challenge, particularly severe in remote Australian communities where seawater intrusion and aquifer salinisation exacerbate the need for alternative water resources. Conventional desalination technologies are energy-intensive and unsuitable for rural areas. This study introduces a novel, off-grid, sustainable desalination solution utilising solar-integrated membrane distillation (MD) technology. An innovative, stand-alone prototype combining a hybrid photovoltaic/thermal (PV/T) system with direct contact MD (DCMD) has been designed and developed. This fully integrated PV/T collector efficiently supplies the thermal and electrical energy required for the MD process. The photovoltaic panel generates the necessary electrical energy, while the heat from the PV panel warms the MD system’s feed solution, enhancing overall efficiency through the solar cell cooling effect. In addition, an innovative fan-cooled radiator equipped with two DC fans with a low power consumption rating was designed and customized to be applied as MD system cooling medium within the outdoor setting. The concept development and feasibility of the system are explored in detail through a comprehensive experimental investigation employing an innovative and practical approach to design and examine the integrated hybrid solar MD unit. This unique system was designed, constructed, and tested under dynamic outdoor conditions, during the summer season in Melbourne, to assess the integration strategy and evaluate its long-term operational performance. The performance of the integrated PV/T-MD system was evaluated using two commercial hydrophobic membranes with different pore sizes under various outdoor conditions and PV/T fluid flow rates. Key performance metrics analysed include solar irradiance intensity, temperature profiles of the PV/T panel and MD module, power, current and voltage profiles of the unit components, permeate flux, specific water productivity (SWP) and the thermal (ηthermPV/T) and electrical (ηelecPV/T) efficiencies, along with the gained output ratio (GOR). Comprehensive experimental assessments in indoor and outdoor settings were undertaken to confirm the technical viability of the system. The study demonstrates the feasibility of such systems through real-world trials and addresses key challenges in energy efficiency and internal heat recovery. The experimental trials demonstrated permeate flux values ranging between 8–16 kg/m2h outdoors, compared to 22–30 kg/m2h indoors, reflecting the impact of fluctuating environmental conditions. The system’s power consumption was measured 130–140 W, about one-third of the PV/T power rating. The maximum power generation reached 280 W in battery charging mode. achieving a maximum ηthermPV/T of 20 % and an ηelecPV/T of 18 %. Additionally, the cooling effect of the PV/T panel resulted in a 1.5–2 °C temperature reduction, improving electrical power output by 0.8–1.2 %. The findings highlight the significant potential of the system in providing reliable and efficient freshwater production in remote, off-grid communities, offering a scalable solution to address global water scarcity challenges.

Feasibility of a 40kWp Grid-Connected Solar Power Plant in Tiaret, Algeria:

This study evaluates the technical and economic feasibility of a 40kWp grid-connected solar power plant in Tiaret, Algeria. Utilizing comprehensive solar irradiance data and advanced PV system software, we designed and simulated the plant's performance under local conditions. Our analysis incorporates smart grid integration strategies and economic modeling. Results indicate an annual electricity generation of approximately 68,000 kWh, with a levelized cost of energy (LCOE) of 0.12 USD/kWh and an estimated payback period of 5 years. The plant demonstrates a performance ratio of 0.759, reflecting its efficiency under real-world conditions. These findings suggest that grid-connected solar power plants are not only technically viable but also economically attractive in Algeria. The study provides critical insights for policymakers, investors, and engineers, offering a replicable model for assessing and implementing solar projects in similar emerging markets across North Africa and beyond.

Information Technology Integration Strategy in Public Library Services

This study aims to identify the integration strategy of information technology in public library services in Bone Regency. Using a qualitative method with a case study approach, this research explores how information technology is applied in library management and its impact on service quality. A purposive sampling technique was used to select 15 informants consisting of 5 librarians, 5 library users, and 5 relevant stakeholders. The results show that the use of information technology, such as online catalogue systems and digital services, can improve the accessibility and efficiency of library services. Librarians in Bone Regency stated that technology helps them manage collections and serve users more quickly and accurately. Library users revealed that technology-based services make it easier for them to search for information and access reading materials remotely. However, some challenges, such as limited infrastructure and technical knowledge, still need to be overcome. This research highlights the importance of training and capacity building for librarians as well as increased investment in technology to maximise its benefits for public libraries in Bone Regency.

The Reform and Practice of College English Writing Teaching Mode by Integrating Information Technology

The integration of information technology (IT) into college English writing instruction has emerged as a transformational strategy in response to the limitations of traditional teaching methods. This paper explores the modifications and applications of a pedagogical approach that uses ICT to improve the effectiveness of college English writing instruction. Traditional approaches to teaching English writing often suffer from limitations such as lack of individual feedback, monolithic teaching methods, and inadequate engagement with digital tools that define modern communication. The study examines how the integration of ICTs into the curriculum can lead to a variety of instructional strategies, including digital tools, collaborative methods, and multimedia materials, that address different learning styles. The main focus areas are the challenges associated with traditional teaching methods, the specific benefits of ICT in teaching English writing, and practical strategies for better integration The paper builds on case studies and data-supported outcomes to demonstrate the success of ICT-enabled learning practices for improving students’ writing skills, critical thinking skills and engagement. The findings suggest that ICT not only modernizes English education but also integrates the demands of a digitally connected world. This integration opens up a more sustainable, inclusive, and competency-oriented approach to English writing education in colleges.

Hybrid package integration strategy for silicon ICs operating beyond 200 GHz

Abstract This paper proposes an innovative hybrid package integration strategy compatible with silicon-based technologies. It is evaluated beyond 200 GHz by the integration of a WR3 back-to-back waveguide-to-suspended stripline transition designed in BiCMOS technology, relying on metallic split-block package and organic laminate substrate. Simulated insertion loss below 3 dB is observed in the 220–320 GHz frequency band, competing with reported traditional solutions using III–V substrates. The achieved performances lead to promising perspectives for low-cost silicon packaging solutions beyond 200 GHz.

Assessment of Transitional Orbits from a High Eccentricity LEO to a Circumlunar Orbit

This study presents an evaluation of the achievability and execution of transitional orbits for spacecraft transitioning from a high eccentricity Low Earth Orbit (LEO) to a circumlunar orbit, with the point of distinguishing the foremost proficient and ideal trajectory while considering variables such as velocity and required fuel. Transitional orbits have a role in space exploration, and optimizing their characteristics can enormously advantage mission planning and spacecraft design. A numerical simulation model was developed to attain this objective, A gravity perturbations effect is included in the calculation of the transition. The model utilized progressed numerical integration strategies for exact trajectory analysis. Three cases were examined to investigate the impacts of varying eccentricity and the argument of perigee on the ideal transition, In the first case, eccentricity values of [0.001, 0.01, 0.1] were inspected, whereas the argument of perigee was fixed at 80 degrees. Within the second case, the argument of perigee values of [80, 170, 260] was considered, with the eccentricity fixed at 0.1. The third case included at the same time varying the eccentricity and argument of perigee values. The results showed that the three cases agreed the most favorable transition occurred when eccentricity was set to 0.001 and the argument of perigee was set to 260 degrees. This produced a velocity increase of 2.195694 km/s, which is the lowest increase in ΔV, a metric used to measure fuel efficiency and power required. This finding also demonstrated the lowest change in eccentricity, the lowest change in inclination, and the lowest change in the ascending node, all of which are indicative of increased orbit stability.

Acknowledging the role of loss in facilitating employee transition in a partial business acquisition

PurposeThe purpose of this paper is to explore the experience of a cohort of staff who transferred from a medium-sized Irish pharmaceutical company to a US multinational, while remaining in the same building as their original employers and colleagues. It highlights the role of acknowledging loss when facilitating employee transition and the co-development of a communication and integration strategy in transitioning to a new organisation.Design/methodology/approachAn exploratory qualitative case study captures the experiences of the senior manager responsible for the business unit transition and a cohort of 32 employees who moved to the US multinational. Conversations between the senior manager (author three) and his academic peers (authors one and two) trace the experience of this team as they transitioned to the new organisation.FindingsInsights are offered through the transition journey – from the unofficial partial-acquisition offer through to the due diligence period and onto the subsequent implementation of the communication and integration strategy. Findings exhibit a co-developed a communication and integration strategy, revealing a largely successful initial integration of the team into the new organisation.Originality/valueThe paper offers a first-hand account of the steps taken in a successful employee transition to a new organisation following a partial acquisition. It describes how acknowledging loss is a valuable first step in the transition process, enabled by the design and adoption of a co-created communication and integration strategy.

Efficient Zero-Knowledge Proofs for Set Membership in Blockchain-Based Sensor Networks: A Novel OR-Aggregation Approach

Blockchain-based sensor networks offer promising solutions for secure and transparent data management in IoT ecosystems. However, efficient set membership proofs remain a critical challenge, particularly in resource-constrained environments. This paper introduces a novel OR-aggregation approach (where “OR” refers to proving that an element equals at least one member of a set without revealing which one) for zero-knowledge set membership proofs, tailored specifically for blockchain-based sensor networks. We provide a comprehensive theoretical foundation, detailed protocol specification, and rigorous security analysis. Our implementation incorporates optimization techniques for resource-constrained devices and strategies for integration with prominent blockchain platforms. Extensive experimental evaluation demonstrates the superiority of our approach over existing methods, particularly for large-scale deployments. Results show significant improvements in proof size, generation time, and verification efficiency. The proposed OR-aggregation technique offers a scalable and privacy-preserving solution for set membership verification in blockchain-based IoT applications, addressing key limitations of current approaches. Our work contributes to the advancement of efficient and secure data management in large-scale sensor networks, paving the way for wider adoption of blockchain technology in IoT ecosystems.

The Reduced Barrier for the Photogenerated Charge Migration on Covalent Triazine‐Based Frameworks for Boosting Photocatalytic CO2 Reduction Into Syngas

AbstractPhotocatalytic CO2 reduction together with hydrogen generation is a promising approach to generate syngas, the photogenerated electron migration from photosensitizers to the catalytic active sites is the rate‐determining step. Herein, an integrative strategy is presented by covalently grafting metal complexes into donor–acceptor covalent triazine‐based frameworks. The catalytic active sites are integrated with the photosensitizer units by covalent linkages to form an extended π‐conjugated framework, which significantly reduces the energy barrier for the migration of the photogenerated charge carriers, resulting in high activity and durability in photocatalytic CO2 reduction into syngas under visible light irradiation. The CO and H2 evolution amounts in 1.5 h are 1086 and 1042 µmol g−1, respectively, which greatly surpass those in the host‐guest counterparts. Furthermore, selective adsorption for CO2 over N2 renders this photocatalytic system to be effective for syngas production from the simulated flue gas. This study provides new approaches to construct the integrative photocatalytic systems for solar‐to‐chemical energy conversion.