Stimulated Prostaglandin E2 Research Articles

Abstract 3698: Epigenetic modification induced reprogramming of PUFAs-associated metabolism during trastuzumab resistance formation of HER2-positive breast cancer

Abstract Background: Secondary trastuzumab resistance seriously affects the treatment of HER2-positive breast cancer. Although studies have demonstrated several potential reasons that cause trastuzumab resistance, we still have poor knowledge about the changes in cell itself as well as its interaction with tumor microenvironment (TME) components during resistance formation. Here we suggested that altered histone modification reprograms polyunsaturated fatty acids (PUFAs) metabolism, which reduces cellular PUFAs and stimulates prostaglandin E2 (PGE2) production. Excessive PGE2 may further affect both cancer cells as well as immune cells in TME. Materials and Methods: Secondary trastuzumab-resistant cell line SKBR3_HR was generated from sensitive SKBR3 cells by raising trastuzumab concentration gently from 1ug/ml to 20ug/ml in 30 weeks. Cell viabilities were measured by CCK8 test. CUT&Tag with anti-H3K4me3 and anti-H3K27me3 antibodies were applied to make sequencing libraries. Total RNA and protein were collected for transcriptome and proteome analysis. Activity scores of metabolism processes were defined and calculated as the relative gene expression value averaged over all genes in this pathway in certain cell types. Oxidized PUFAs and PGE2 were assessed by flow cytometry with BODIPY-C11 and ELISA, respectively. Results: SKBR3_HR cells showed similar viability as primary resistant JIMT1 cells and were significantly higher than original SKBR3 cells. Pathway analysis indicated reduced PUFAs synthesis and activated arachidonic acid metabolism. As a consequence, oxidized PUFAs decreased while PGE2 accumulated heavily in SKBR3_HR cells, which may promote tumor and vascular endothelial cell proliferation but interrupt immune cell activity in TME. Transcriptional activity of two critical PUFAs synthesis-related genes, FASN and SCD, were reduced in resistant cells, while two key genes in arachidonic acid metabolism, PTGS1 and PTGES, were activated. H3K4me3 and H3K27me3 play opposite but critical rules in transcriptional regulation. During resistance formation, changes happened on 3256 H3K27me3 peaks as well as 316 H3K4me3 peaks. In detail, although little H3K27me3 changes were found at the promoter regions of four genes (FASN, SCD, PTGS1 and PTGES), reduced H3K4me3 levels may inhibit FASN and SCD expression while raised levels could stimulate PTGS1 and PTGES transcription. Conclusions: Combining the transcriptome and histone modification data, we have a deeper understanding of the cellular adaptions to trastuzumab. Altered trimethylation of H3K4 but not H3K27 remodels the expressions of FASN, SCD, PTGS1 and PTGES, drives the reprogramming of PUFAs-associated metabolism, and finally reduces cellular PUFAs while stimulates PGE2 production. High PGE2 level may affect the activities of tumor and TME-related cells. Citation Format: Yongmei Yin, Ningjun Duan, Yijia Hua, Shuang Hu. Epigenetic modification induced reprogramming of PUFAs-associated metabolism during trastuzumab resistance formation of HER2-positive breast cancer. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 3698.

Interaction between epidermal growth factor receptor and C-C motif chemokine receptor 2 in the ovulatory cascade.

The epidermal growth factor receptor (EGFR) signaling pathway is one of the main pathways responsible for propagating the luteinizing hormone (LH) signal throughout the cumulus cells and the oocyte. Recently, we have proposed the C-C motif chemokine receptor 2 (CCR2) and its main ligand (monocyte chemoattractant protein-1, MCP1) as novel mediators of the ovulatory cascade. Our previous results demonstrate that the gonadotropins (GNT), amphiregulin (AREG), and prostaglandin E2 (PGE2) stimulation of periovulatory gene mRNA levels occurs, at least in part, through the CCR2/MCP1 pathway, proposing the CCR2 receptor as a novel mediator of the ovulatory cascade in a feline model. For that purpose, feline cumulus-oocyte complexes (COCs) were cultured in the presence or absence of an EGFR inhibitor, recombinant chemokine MCP1, and gonadotropins [as an inducer of cumulus-oocyte expansion (C-OE), and oocyte maturation] to further assess the mRNA expression of periovulatory key genes, C-OE, oocyte nuclear maturation, and steroid hormone production. We observed that MCP1 was able to revert the inhibition of AREG mRNA expression by an EGFR inhibitor within the feline COC. In accordance, the confocal analysis showed that the GNT-stimulated hyaluronic acid (HA) synthesis, blocked by the EGFR inhibitor, was recovered by the addition of recombinant MCP1 in the C-OE culture media. Also, MCP1 was able to revert the inhibition of progesterone (P4) production by EGFR inhibitor in the C-OE culture media. Regarding oocyte nuclear maturation, recombinant MCP1 could also revert the inhibition triggered by the EGFR inhibitor, leading to a recovery in the percentage of metaphase II (MII)-stage oocytes. In conclusion, our results confirm the chemokine receptor CCR2 as a novel intermediate in the ovulatory cascade and demonstrate that the EGFR/AREG and the CCR2/MCP1 signaling pathways play critical roles in regulating feline C-OE and oocyte nuclear maturation, with CCR2/MCP1 signaling pathway being downstream EGFR/AREG pathway within the ovulatory cascade.

IL-13–associated epithelial remodeling correlates with clinical severity in nasal polyposis

Epithelial remodeling is a histopathologic feature of chronic inflammatory airway diseases including chronic rhinosinusitis (CRS). Cell-type shifts and their relationship to CRS endotypes and severity are incompletely described. We sought to understand the relationship of epithelial cell remodeling to inflammatory endotypes and disease outcomes in CRS. Using cell-type transcriptional signatures derived from epithelial single-cell sequencing, we analyzed bulk RNA-sequencing data from sinus epithelial brushings obtained from patients with CRS with and without nasal polyps in comparison to healthy controls. The airway epithelium in nasal polyposis displayed increased tuft cell transcripts and decreased ciliated cell transcripts along with an IL-13 activation signature. In contrast, CRS without polyps showed an IL-17 activation signature. IL-13 activation scores were associated with increased tuft cell, goblet cell, and mast cell scores and decreased ciliated cell scores. Furthermore, the IL-13 score was strongly associated with a previously reported activated ("polyp") tuft cell score and a prostaglandin E2 activation signature. The Lund-Mackay score, a computed tomographic metric of sinus opacification, correlated positively with activated tuft cell, mast cell, prostaglandin E2, and IL-13 signatures and negatively with ciliated cell transcriptional signatures. These results demonstrate that cell-type alterations and prostaglandin E2 stimulation are key components of IL-13-induced epithelial remodeling in nasal polyposis, whereas IL-17 signaling is more prominent in CRS without polyps, and that clinical severity correlates with the degree of IL-13-driven epithelial remodeling.

MicroRNA miR-125b can suppress ovarian granulosa cell functions: Interrelationships with FSH.

This study aimed to evaluate the involvement of miR-125b and its interrelationship with follicle-stimulating hormone (FSH)in the control of basic ovarian granulosa cell functions. The effect of miR-125b mimics on basic functions of porcine ovarian granulosa cells cultured with and without FSH, and the effect of FSH on the expression of endogenous miR-125b was examined. Expression levels of miR-125b, viability, proliferation (accumulation of PCNA and cyclin B1), apoptosis (accumulation of bax and caspase 3), the accumulation of FSH receptors (FSHR), steroid hormones, insulin-like growth factor I (IGF-I), oxytocin, and prostaglandin E2 release were analysed by reverse transcription-quantitative polymerase chain reaction, Trypan blue exclusion test, quantitative immunocytochemistry, and ELISA. Transfection of cells with miR-125b mimics inhibited cell viability, proliferation, apoptosis, the occurrence of FSHR, progesterone, testosterone, estradiol, and oxytocin release but stimulated prostaglandin E2 output. FSH promoted cell viability, proliferation, steroid hormones, IGF-I, oxytocin, and prostaglandin E2 output and reduced the expression of miR-125b and apoptosis. Furthermore, miR-125b mimics supported the effect of FSH on the release of estradiol, IGF-I, and prostaglandin E2, and inverted FSH influence on cell viability, proliferation, apoptosis, progesterone, and testosterone output. FSH supported both inhibitory and stimulatory action of miR-125b on ovarian cell functions. Present observations indicate that: miR-125b can be involved in the control of basic ovarian functions and that miR-125b and FSH are antagonists in their actions on ovarian cell functions. The ability of FSH to reduce miR-125b expression and the ability of miR-125b mimics to decrease the occurrence of FSHR and to modify FSH effects indicate the existence of the self-inhibiting FSH-miR-125b axis and that miR-125b can mediate the actions of FSH on ovarian cells.

Single-cell analysis of prostaglandin E2-induced human decidual cell in vitro differentiation: a minimal ancestral deciduogenic signal†.

The decidua is a hallmark of reproduction in many placental mammals. Differentiation of decidual stromal cells is known to be induced by progesterone and the cyclic AMP/protein kinase A (cAMP/PKA) pathway. Several candidates have been identified as the physiological stimulus for adenylyl cyclase activation, but their relative importance remains unclear. To bypass this uncertainty, the standard approach for in vitro experiments uses membrane-permeable cAMP and progestin. We phylogenetically infer that prostaglandin E2 (PGE2) likely was the signal that ancestrally induced decidualization in conjunction with progesterone. This suggests that PGE2 and progestin should be able to activate the core gene regulatory network of decidual cells. To test this prediction, we performed a genome-wide study of gene expression in human endometrial fibroblasts decidualized with PGE2 and progestin. Comparison to a cAMP-based protocol revealed shared activation of core decidual genes and decreased induction of senescence-associated genes. Single-cell transcriptomics of PGE2-mediated decidualization revealed a distinct, early-activated state transitioning to a differentiated decidual state. PGE2-mediated decidualization was found to depend upon progestin-dependent induction of PGE2 receptor 2 (PTGER2) which in turn leads to PKA activation upon PGE2 stimulation. Progesterone-dependent induction of PTGER2 is absent in opossum, an outgroup taxon of placental mammals which is incapable of decidualization. Together, these findings suggest that the origin of decidualization involved the evolution of progesterone-dependent activation of the PGE2/PTGER2/PKA axis, facilitating entry into a PKA-dominant rather than AKT-dominant cellular state. We propose the use of PGE2 for in vitro decidualization as an alternative to 8-Br-cAMP.

Chemical Constituents of the Leaves of Campanula takesimana (Korean Bellflower) and Their Inhibitory Effects on LPS-induced PGE2 Production.

Campanula takesimana Nakai (Campanulaceae; Korean bellflower) is one of the endemic herbs of Korea. The plant has been used as traditional medicines for treating asthma, tonsillitis, and sore throat in Korea. A hot water extract of the leaves of C. takesimana exhibited a significant inhibitory effect on lipopolysaccharide (LPS)-stimulated prostaglandin E2 (PGE2) production. Repetitive chromatographic separation of the hot water extract led to the isolation of three new neolignan glucosides, campanulalignans A–C (1–3), with 15 known compounds (4–18). The structures of new compounds 1–3 were elucidated by analyzing nuclear magnetic resonance (NMR) spectroscopic data, along with high resolution quadrupole time of flight mass (HR-Q-TOF-MS) spectrometric data. Among the isolates, simplidin (7), 5-hydroxyconiferaldehyde (11), icariside F2 (12), benzyl-α-l-arabinopyranosyl-(1″→6′)-β-d-glucopyranoside (13), and kaempferol 3-O-β-d-apiosyl (1→2)-β-d-glucopyranoside (15) were isolated from the Campanulaceae family for the first time. The isolates (1, 2, and 4–18) were assessed for their anti-inflammatory effects on LPS-stimulated PGE2 production on RAW 264.7 cells. 7R,8S-Dihydrodehydrodiconiferyl alcohol (5), 3′,4-O-dimethylcedrusin 9-O-β-glucopyranoside (6), pinoresinol di-O-β-d-glucoside (8), ferulic acid (10), 5-hydroxyconiferaldehyde (11), and quercetin (18) showed significant inhibitory effects on LPS-stimulated PGE2 production.

Edition of Prostaglandin E2 Receptors EP2 and EP4 by CRISPR/Cas9 Technology in Equine Adipose Mesenchymal Stem Cells.

Simple SummaryProstaglandin E2 plays a regulatory role in MSC self-renewal, and PGE2 receptor-mediated signalling is involved in cell proliferation and migration. The aim of this work was to establish a genetically modified equine cellular model in which receptor genes EP2 and EP4 were edited by the CRISPR/Cas9 system. We successfully targeted EP2 and EP4 receptors in horse adipose MSCs using the CRISPR/Cas9 system. This targeting did not affect the surface marker phenotype of the adipose MSCs generated. Gene edition significantly lowered the expression of each of the targeted receptors and affected the early migration ability of the edited MSCs. This opens the possibility of using these mutant cell lines as a model system to elucidate the role of EP2 and EP4 in MSCs and, particularly, as therapeutic tools in equine regenerative medicine.In mesenchymal stem cells (MSCs), it has been reported that prostaglandin E2 (PGE2) stimulation of EP2 and EP4 receptors triggers processes such as migration, self-renewal, survival, and proliferation, and their activation is involved in homing. The aim of this work was to establish a genetically modified adipose (aMSC) model in which receptor genes EP2 and EP4 were edited separately using the CRISPR/Cas9 system. After edition, the genes were evaluated as to if the expression of MSC surface markers was affected, as well as the migration capacity in vitro of the generated cells. Adipose MSCs were obtained from Chilean breed horses and cultured in DMEM High Glucose with 10% fetal bovine serum (FBS). sgRNA were cloned into a linearized LentiCRISPRv2GFP vector and transfected into HEK293FT cells for producing viral particles that were used to transduce aMSCs. GFP-expressing cells were separated by sorting to obtain individual clones. Genomic DNA was amplified, and the site-directed mutation frequency was assessed by T7E1, followed by Sanger sequencing. We selected 11 clones of EP2 and 10 clones of EP4, and by Sanger sequencing we confirmed 1 clone knock-out to aMSC/EP2 and one heterozygous mutant clone of aMSC/EP4. Both edited cells had decreased expression of EP2 and EP4 receptors when compared to the wild type, and the edition of EP2 and EP4 did not affect the expression of MSC surface markers, showing the same pattern in filling the scratch. We can conclude that the edition of these receptors in aMSCs does not affect their surface marker phenotype and migration ability when compared to wild-type cells.

Concerted EP2 and EP4 Receptor Signaling Stimulates Autocrine Prostaglandin E2 Activation in Human Podocytes.

Glomerular hyperfiltration is an important mechanism in the development of albuminuria. During hyperfiltration, podocytes are exposed to increased fluid flow shear stress (FFSS) in Bowman’s space. Elevated Prostaglandin E2 (PGE2) synthesis and upregulated cyclooxygenase 2 (Cox2) are associated with podocyte injury by FFSS. We aimed to elucidate a PGE2 autocrine/paracrine pathway in human podocytes (hPC). We developed a modified liquid chromatography tandem mass spectrometry (LC/ESI-MS/MS) protocol to quantify cellular PGE2, 15-keto-PGE2, and 13,14-dihydro-15-keto-PGE2 levels. hPC were treated with PGE2 with or without separate or combined blockade of prostaglandin E receptors (EP), EP2, and EP4. Furthermore, the effect of FFSS on COX2, PTGER2, and PTGER4 expression in hPC was quantified. In hPC, stimulation with PGE2 led to an EP2- and EP4-dependent increase in cyclic adenosine monophosphate (cAMP) and COX2, and induced cellular PGE2. PTGER4 was downregulated after PGE2 stimulation in hPC. In the corresponding LC/ESI-MS/MS in vivo analysis at the tissue level, increased PGE2 and 15-keto-PGE2 levels were observed in isolated glomeruli obtained from a well-established rat model with glomerular hyperfiltration, the Munich Wistar Frömter rat. COX2 and PTGER2 were upregulated by FFSS. Our data thus support an autocrine/paracrine COX2/PGE2 pathway in hPC linked to concerted EP2 and EP4 signaling.

Inhibition of viral and bacterial trigger-stimulated prostaglandin E2 by a throat lozenge containing flurbiprofen: An in vitro study using a human respiratory epithelial cell line.

Objectives:Symptoms of sore throat result from oropharyngeal inflammation, for which prostaglandin E2 is a key mediator. Flurbiprofen is a non-steroidal anti-inflammatory that provides sore throat relief. The preliminary objective of this study was to develop an in vitro model for assessing prostaglandin E2 stimulation by viral and bacterial triggers. The primary objective was to investigate the effect of diluted flurbiprofen-containing lozenges on prostaglandin E2 concentrations in stimulated cells.Methods:Prostaglandin E2 production was stimulated in three epithelial cell lines (A549, HEp2, and clonetics bronchial/tracheal epithelial) with influenza A virus (4.5 log10 tissue culture infectious dose50/mL), or bacterial lipopolysaccharide (10µ g/mL) and peptidoglycan (3µ g/mL) and incubated overnight. Prostaglandin E2 levels were assessed by enzyme-linked immunosorbent assay up to 24 h after stimulation. The effect of flurbiprofen 8.75 mg lozenges (diluted to 0.44 mg/mL) on PGE2 production in stimulated cells was assessed in parallel; prior to viral/LPS/PEP stimulation of cells, 300 μL of test product or control was added and incubated for 30 s, 2 and 5 min (and 10 min for bacterial trigger). Prostaglandin E2 levels were measured following stimulation.Results:Viral and lipopolysaccharide/peptidoglycan infection did not consistently stimulate HEp2 cells and bronchial/tracheal epithelial cells to produce prostaglandin E2. Influenza virus, and lipopolysaccharide/peptidoglycan stimulated high prostaglandin E2 concentrations in A549: mean prostaglandin E2 concentration 106.48 pg/mL with viral stimulation vs 33.82 pg/mL for uninfected cells; 83.84 pg/mL with lipopolysaccharide/peptidoglycan vs 71.96 pg/mL for uninfected cells. Flurbiprofen produced significant reductions in virus-stimulated prostaglandin E2 vs stimulated untreated cells at 2 min (p = 0.03). Flurbiprofen produced significant reductions in lipopolysaccharide/peptidoglycan-stimulated prostaglandin E2 concentrations from 30 s (p = 0.02), and at 2, 5 and 10 min (all p < 0.005) vs stimulated untreated cells.Conclusions:A549 cells provide a suitable model for assessment of prostaglandin E2 stimulation by viral and bacterial triggers. Diluted flurbiprofen-containing lozenges demonstrated rapid anti-inflammatory activity in viral- and lipopolysaccharide/peptidoglycan-stimulated A549 cells.

207 Editing of prostaglandin E2 gene receptors EP2 and EP4 by CRISPR/Cas9 technology in equine adipose mesenchymal stem cells

Prostaglandin E2 (PGE2) is an important mediator of cellular responses, playing a key role in limiting inflammation. PGE2 acts distinctly through one of four EP receptors. In MSCs, it PGE2 stimulation of EP2 and EP4 receptors triggers processes such as migration, self-renewal, survival, and proliferation, and their activation is involved in homing. PGE2 has been proposed as a key factor of MSC immunomodulation. The CRISPR-Cas9 system has been adapted successfully to edit the genome of animals. Loss of EP2 and EP4 receptors in equine adipose mesenchymal stem cells (eAT-MSC) could help us understand their role in cell migration, homing, and self-renewal capacities. Here, we aimed to edit these receptors in eAT-MSC to test their function. The eAT-MSC were obtained from three Chilean breed horses and cultured in Dulbecco's modified Eagle's medium-high glucose with 10% fetal bovine serum. Guide RNAs (sgRNA) for CRISPR-Cas 9 editing were designed based on EP2 and EP4 DNA sequences. The sgRNA and PAM sequence targeting exon 1 of the equine genes (EP2-sgRNA: TGGTGCTGGCTTCGTACGCG; PAM:CGG and EP4-sgRNA: GGAGACGACCTTCTACACGT;PAM:TGG) were cloned into linearized LentiCRISPRv2GFP vector (#82416; Addgene). The lentiviral vector plus helping packaging plasmids was co-transfected into HEK293FT cells. The produced viral particles were harvested and transduced into eAT-MSC. After 48h, cells were sorted and green fluorescent protein (GFP)-positive cells were expanded to obtain individual clones. Genomic DNA was extracted for PCR amplification, and the frequency of site directed-mutation was assessed by T7 endonuclease assay. Because of the high background (e.g. excessive banding) produced by the T7E1 assay, the PCR products were cloned into a pUC57 vector, and sequenced. Quantitative PCR and immunocytochemistry staining examined expression of EP2 and EP4. The statistical analyses were performed using GraphPad Prism 6 (GraphPad Inc.) with unpaired t-test; P-values&amp;lt;0.05 were considered statistically significant. Transduction efficiency of eAT-MSC/EP2ko and eAT-MSC/EP4ko was 31 and 38%, respectively. A total of 15 clones for each lineage obtained from a single cell culture were subjected to T7EI assay to identify the frequency of mutation. Eight eAT-MSC/EP2ko and 7 eAT-MSC/EP4ko clones showed mutations; DNA sequencing confirmed mutations in 3 eAT-MSC/EP2ko clones and 3 eAT-MSC/EP4ko clones. Immunostaining with specific anti-EP2 and anti-EP4 antibodies showed diminished expression of the particular receptors in the knockout cells. Decreased expression was quantitatively confirmed by quantitative PCR analysis, showing downregulation of PTGER2 (4.3-fold) and PTGER4 (2.7-fold) in the edited clones compared with eAT-MSC naïve cells (P&amp;lt;0.05). This CRISPR/Cas9 design allows the possibility of using these mutant cell lines as a model system to elucidate the role of EP2 and EP4 in cell migration, homing, and self-renewal. Research was supported by FONDECYT 3170390 to ACFM, Ministry of Education, Chile.

Mesenchymal stem cells cultured under hypoxic conditions had a greater therapeutic effect on mice with liver cirrhosis compared to those cultured under normal oxygen conditions.

BackgroundMesenchymal stem cells (MSCs) can be easily expanded. They can be acquired from medical waste such as adipose and umbilical cord tissues, are influenced by culturing conditions, and exert anti-inflammatory, antioxidant, anti-fibrotic, and angiogenic effects. We analyzed the multi-directional effects of MSCs cultured under hypoxic conditions and their underlying mechanisms in the treatment of liver cirrhosis in a mouse model.MethodsHuman bone marrow-derived MSCs cultured under hypoxic (5% O2; hypoMSCs) and normoxic (21% O2; norMSCs) conditions were compared by cap analysis of gene expression (CAGE) with or without serum from liver cirrhosis patients. The therapeutic effects of MSCs, including serum liver enzyme induction, fibrosis regression, and hepatic oxidative stress, were evaluated by injecting 1 × 106, 2 × 105, or 4 × 104 MSCs/mouse into the tail veins of mice with carbon tetrachloride (CCl4)-induced liver cirrhosis. Intravital imaging was performed with a two-photon excitation microscope to confirm the various MSC migration paths to the liver.ResultsCAGE analysis revealed that the RNA expression levels of prostaglandin E synthase (Ptges) and miR210 were significantly higher in hypoMSCs than in norMSCs. In vivo analysis revealed that both hypoMSCs and norMSCs reduced serum alanine aminotransferase, oxidative stress, and fibrosis compared to that in control mice in a dose-dependent manner. However, hypoMSCs had stronger therapeutic effects than norMSCs. We confirmed this observation by an in vitro study in which hypoMSCs changed macrophage polarity to an anti-inflammatory phenotype via prostaglandin E2 (PGE2) stimulation. In addition, miR210 reduced the rate of hepatocyte apoptosis. Intravital imaging after MSC administration showed that both cell types were primarily trapped in the lungs. Relatively a few hypoMSCs and norMSCs migrated to the liver. There were no significant differences in their distributions.ConclusionThe therapeutic effect of hypoMSCs was mediated by PGE2 and miR210 production and was greater than that of norMSCs. Therefore, MSCs can be manipulated to improve their therapeutic efficacy in the treatment of liver cirrhosis and could potentially serve in effective cell therapy. MSCs produce several factors with multidirectional effects and function as “conducting cells” in liver cirrhosis.

Regulatory Control of Microglial Phagocytosis by Estradiol and Prostaglandin E2 in the Developing Rat Cerebellum.

Microglia are essential to sculpting the developing brain, and they achieve this in part through the process of phagocytosis which is regulated by microenvironmental signals associated with cell death and synaptic connectivity. In the rat cerebellum, microglial phagocytosis reaches its highest activity during the third postnatal week of development but the factors regulating this activity are unknown. A signaling pathway, involving prostaglandin E2 (PGE2) stimulation of the estrogen synthetic enzyme aromatase, peaks during the 2nd postnatal week and is a critical regulator of Purkinje cell maturation. We explored the relationship between the PGE2-estradiol pathway and microglia in the maturing cerebellum. Toward that end, we treated developing rat pups with pharmacological inhibitors of estradiol and PGE2 synthesis and then stained microglia with the universal marker Iba1 and quantified microglia engaged in phagocytosis as well as phagocytic cups in the vermis and cerebellar hemispheres. Inhibition of aromatase reduced the number of phagocytic cups in the vermis, but not in the cerebellar hemisphere at postnatal day 17. Similar results were found after treatment with nimesulide and indomethacin, inhibitors of the PGE2-producing enzymes cyclooxygenase 1 and 2. In contrast, treatment with estradiol or PGE2 had little effect on microglial phagocytosis in the developing cerebellum. Thus, endogenous estrogens and prostaglandins upregulate the phagocytic activity of microglia during a select window of postnatal cerebellar development, but exogenous treatment with these same signaling molecules does not further increase the already high levels of phagocytosis. This may be due to an upper threshold or evidence of resistance to exogenous perturbation.

HMGB1 promotes hair growth via the modulation of prostaglandin metabolism

Unexpected hair growth can occur after tissue injury. The pathogenic mechanism for this phenomenon is unknown but is likely related to inflammatory mediators. One such mediator is high-mobility group box 1 (HMGB1), a ubiquitous nuclear protein that is released from cell nuclei after tissue damage. To elucidate the effect of HMGB1 on hair growth and understand its mechanism of action, we evaluated the effect of HMGB1 treatment on hair shaft elongation and on mRNA and protein expression in cultured human dermal papilla cells (hDPCs). HMGB1 enhanced hair shaft elongation in an ex vivo hair organ culture. In hDPCs, HMGB1 treatment significantly increased mRNA and protein expression levels of prostagladin E synthases. HMGB1 also stimulated prostaglandin E2 (PGE2) secretion from hDPCs. Finally, blocking the receptor for advanced glycation end-products, a canonical HMGB1 receptor, inhibited HMGB1-induced PGE2 production and hair shaft elongation. Our results suggest that HMGB1 promotes hair growth via PGE2 secretion from hDPCs. This mechanism can explain the paradoxical phenomenon of trauma-induced hair growth. Thus, HGMB1 can be a viable therapeutic target for the treatment of alopecia.

Activation of prostaglandin EP4 receptor attenuates the induction of cyclooxygenase-2 expression by EP2 receptor activation in human amnion fibroblasts: implications for parturition.

Human amnion fibroblasts produce abundant prostaglandin E2 (PGE2), which plays a crucial role in parturition by stimulating not only myometrial contraction and cervical ripening but also the expression of the rate-limiting enzyme in PGE2 synthesis-namely, cyclooxygenase-2 (COX-2). This feed-forward induction of COX-2 expression by PGE2 is mediated via its receptors coupled with the cAMP and PKA pathway and subsequent phosphorylation of the transcription factors cAMP-response element binding protein (CREB) and signal transducer and activator of transcription 3 (STAT3). Although prostaglandin E receptor (EP)-2 and EP4 for PGE2 are coupled with activation of the cAMP and PKA pathway, the exact roles of these 2 receptors in the regulation of COX-2 expression in amnion fibroblasts remain to be determined. Here, we clarify this issue by employing human amnion tissue and fibroblasts with the long-term objective of specific targeting of prostaglandin synthesis in prevention of preterm birth. We find that an EP2 agonist caused long-lasting increases in CREB phosphorylation and COX-2 expression, whereas an EP4 agonist induced only transient increases in CREB phosphorylation and COX-2 expression in amnion fibroblasts. Moreover, only EP2 stimulation increased STAT3 phosphorylation, whereas only EP4 stimulation increased PI3K activity. EP4 antagonist or inhibition of PI3K enhanced the induction of CREB and STAT3 phosphorylation and COX-2 expression by PGE2 or EP2 stimulation, which was attenuated by EP4 overexpression. Of interest, PGE2 and cortisol, both well-demonstrated stimulants of COX-2 expression in amnion fibroblasts, increased EP2 but decreased EP4 receptor expression. Furthermore, increased EP2 but decreased EP4 abundance were observed in amnion tissue at parturition. We conclude that EP2 and EP4 receptors play different roles in the regulation of COX-2 expression in human amnion fibroblasts. EP2 is the dominant PGE2 receptor mediating the induction of COX-2 at parturition, which can be attenuated by simultaneous activation of PI3K coupled to the EP4 receptor.-Lu, J.-W., Wang, W.-S., Zhou, Q., Gan, X.-W., Myatt, L., Sun, K. Activation of prostaglandin EP4 receptor attenuates the induction of cyclooxygenase-2 expression by EP2 receptor activation in human amnion fibroblasts: implications for parturition.

IL-1β mediates NGF and COX-2 expression through transforming growth factor-activating kinase 1 in subacromial bursa cells derived from rotator cuff tear patients

BackgroundIncreased interleukin (IL)-1β expression in the subacromial bursa (SAB) is associated with severe pain in rotator cuff tears (RCTs). Additionally, transforming growth factor (TGF)-β-activated kinase 1 (TAK1) is essential for cytokine-mediated cascades. TAK1 also regulates the expression of pain-associated molecules such as cycloxygenase-2 (COX-2) and nerve growth factor (NGF) in synovial fibroblasts; however, this regulation in the SAB is not fully understood. MethodsSAB samples were harvested from 18 subjects with RCTs. The expression and localization of NGF and COX-2 was determined using polymerase chain reaction (PCR) analysis and immunohistochemistry. Regulation of COX-2 and NGF by IL-1β in subacromial bursa cells (SABCs) was investigated by culturing and stimulating SABCs with vehicle control (culture medium), 50 ng/ml recombinant human IL-1β (rhIL1-β), 50 ng/ml rhIL-1β and 10 μM celecoxib (COX-2 inhibitor), or 10 μM prostaglandin E2 (PGE2) for 24 h. The effects of TAK1 inhibition on rhIL-1β stimulation were determined by culturing and treating SABCs with control, 50 ng/ml rhIL-1β, or 50 ng/ml rhIL-1β and 10 μM (5Z)-7-oxozeaenol (TAK1 inhibitor) for 24 h. NGF and COX-2 mRNA expression was monitored using quantitative PCR. ResultsCOX-2 and NGF mRNA expression was observed in all SAB specimens. Immunohistochemical analysis showed that COX-2-positive cells were in the lining and sublining layers. NGF-positive cells were observed in the sublining layer. rhIL-1β treatment significantly increased NGF and COX-2 mRNA levels compared with control cells. The COX-2 inhibitor did not suppress rhIL-1β-induced NGF expression, and PGE2 stimulation did not alter NGF mRNA expression. In contrast, the TAK1 inhibitor significantly reduced rhIL-1β-stimulated COX-2 and NGF mRNA expression. ConclusionIL-1β regulates the expression of NGF and COX-2, pain-related molecules in the SAB, through TAK1. Therefore, TAK1 may be one potential therapeutic target for reducing pain in patients with RCTs.

Inhibition of secretory phospholipase A2 IIa attenuates prostaglandin E2-induced invasiveness in lung adenocarcinoma.

Secretory phospholipase A2 IIa (sPLA2 IIa) catalyzes the production of multiple inflammatory mediators that influence the development of lung and other cancers. The most potent of these carcinogenic mediators is prostaglandin E2 (PGE2). We hypothesize that sPLA2 IIa inhibition modulates the production of PGE2, and sPLA2 IIa inhibition exerts its antineoplastic effects via downregulation of PGE2 production. We aim to evaluate these relationships via analysis of PGE2-mediated growth regulation pathways. A549 and H1650 lung adenocarcinoma cells were assayed for PGE2 production in the presence of sPLA2 IIa inhibitor. A549 and H1650 cells were treated with PGE2 and immune blotting was performed to assess ICAM-1 expression and STAT-3 activity. PGE2-induced ICAM-1 expression was measured via immunofluorescence. A549 and H1650 cells were treated with PGE2 in the presence of STAT3 inhibitor and assayed for ICAM-1 expression. A549 cells were treated with PGE2 in the presence ICAM-1 blocking antibody and assayed for invasion. PGE2 stimulation significantly increased the invasiveness and proliferation of lung adenocarcinoma (invasion p < 0.05, proliferation p < 0.05 A549 cells, p < 0.005 H1650 cells). sPLA2 IIa inhibition reduced PGE2 secretion (p < 0.05). PGE2 stimulation significantly upregulated the expression of cell adhesion molecule ICAM-1 and the phosphorylation of anti-apoptotic transcription factor STAT3 (p < 0.05). STAT3 inhibition attenuated ICAM-1 expression demonstrating the dependence of ICAM-1 on the STAT3 pathway (p < 0.05). ICAM-1 blockade attenuated the pro-invasive effects of PGE2 (p < 0.05). sPLA2 IIa inhibition attenuates the potent effects of PGE2-induced invasiveness. This is mediated by decreasing pro-inflammatory and invasion-promoting ICAM-1via the STAT-3 pathway. These data further describe how sPLA2 IIa inhibition mechanistically exerts its anticancer effects and support its use as an antineoplastic agent.

Redox-Mediated Mechanisms Fuel Monocyte Responses to CXCL12/HMGB1 in Active Rheumatoid Arthritis.

Chemokine synergy-inducing molecules are emerging as regulating factors in cell migration. The alarmin HMGB1, in its reduced form, can complex with CXCL12 enhancing its activity on monocytes via the chemokine receptor CXCR4, while the form containing a disulfide bond, by binding to TLR2 or TLR4, initiates a cascade of events leading to production of cytokines and chemokines. So far, the possibility that the CXCL12/HMGB1 heterocomplex could be maintained in chronic inflammation was debated, due to the release of reactive oxygen species. Therefore, we have assessed if the heterocomplex could remain active in Rheumatoid Arthritis (RA) and its relevance in the disease assessment. Monocytes from RA patients with active disease require a low concentration of HMGB1 to enhance CXCL12-induced migration, in comparison to monocytes from patients in clinical remission or healthy donors. The activity of the heterocomplex depends on disease activity, on the COX2 and JAK/STAT pathways, and is determined by the redox potential of the microenvironment. In RA, the presence of an active thioredoxin system correlates with the enhanced cell migration, and with the presence of the heterocomplex in the synovial fluid. The present study highlights how, in an unbalanced microenvironment, the activity of the thioredoxin system plays a crucial role in sustaining inflammation. Prostaglandin E2 stimulation of monocytes from healthy donors is sufficient to recapitulate the response observed in patients with active RA. The activation of mechanisms counteracting the oxidative stress in the extracellular compartment preserves HMGB1 in its reduced form, and contributes to fuel the influx of inflammatory cells. Targeting the heterocomplex formation and its activity could thus be an additional tool for dampening the inflammation sustained by cell recruitment, for those patients with chronic inflammatory conditions who poorly respond to current therapies.

Regulation of calcitonin gene-related peptide expression through the COX-2/mPGES-1/PGE2 pathway in the infrapatellar fat pad in knee osteoarthritis

BackgroundThe infrapatellar fat pad (IFP) is implicated in knee osteoarthritis (KOA). Calcitonin gene-related peptide (CGRP), a vasoactive neuropeptide expressed in joint tissues and synovial tissues (ST), was recently found to be associated with KOA progression and pain. CGRP is expressed in the IFPs of human KOA patients; however, its regulation has not been elucidated.MethodsIFPs and STs were harvested from 138 KOA patients during total knee replacement (TKR) and analyzed for CGRP, cycloxygenase-2 (COX-2), and microsomal prostaglandin E synthase-1 (mPGES-1) expression using real-time polymerase chain reaction (PCR). To investigate CGRP regulation by prostaglandin E2 (PGE2), adipocytes (Ad) and the stromal vascular fraction (SVF) were harvested from IFPs using collagenase. Synovial cells (SYC) were also harvested from ST and stimulated with vehicle (serum-free culture medium), PGE2, or CGRP.ResultsCGRP, COX-2, and mPGES-1 expression levels were significantly higher in IFPs than STs. PGE2 stimulation increased CGRP expression in Ad, the SVF, and SYC; however, CGRP expression was significantly higher in PGE2-stimulated SVF than PGE2-stimulated SYC. CGRP stimulation had no effect on COX-2 or mPGES-1 expression.ConclusionsCGRP expression in the IFP of KOA patients is regulated by the COX-2/mPGES-1/PGE2 pathway.

CCN3 secreted by prostaglandin E2 inhibits intimal cushion formation in the rat ductus arteriosus

The ductus arteriosus (DA), an essential fetal shunt between the pulmonary trunk and the descending aorta, changes its structure during development. Our previous studies have demonstrated that prostaglandin E2 (PGE2)-EP4 signaling promotes intimal cushion formation (ICF) by activating the migration of DA smooth muscle cells via the secretion of hyaluronan. We hypothesized that, in addition to hyaluronan, PGE2 may secrete other proteins that also regulate vascular remodeling in the DA. In order to detect PGE2 stimulation-secreted proteins, we found that CCN3 protein was increased in the culture supernatant in the presence of PGE2 in a dose-dependent manner by nano-flow liquid chromatography coupled with tandem mass spectrometry analysis and enzyme-linked immunosorbent assay. Quantitative RT-PCR analysis revealed that PGE2 stimulation tended to increase the expression levels of CCN3 mRNA in DA smooth muscle cells. Immunohistochemical analysis revealed that CCN3 was highly localized in the entire smooth muscle layers and the endothelium of the DA. Furthermore, exogenous CCN3 inhibited PGE2-induced ICF in the ex vivo DA tissues. These results suggest that CCN3 is a secreted protein of the DA smooth muscle cells induced by PGE2 to suppress ICF of the DA. The present study indicates that CCN3 could be a novel negative regulator of ICF in the DA to fine-tune the PGE2-mediated DA remodeling.

A luciferase complementation assay system using transferable mouse artificial chromosomes to monitor protein\u2013protein interactions mediated by G protein-coupled receptors

G protein-coupled receptors (GPCRs) are seven-transmembrane domain receptors that interact with the β-arrestin family, particularly β-arrestin 1 (ARRB1). GPCRs interact with 33% of small molecule drugs. Ligand screening is promising for drug discovery concerning GPCR-related diseases. Luciferase complementation assay (LCA) enables detection of protein–protein complementation via bioluminescence following complementation of N- and C-terminal luciferase fragments (NEluc and CEluc) fused to target proteins, but it is necessary to co-express the two genes. Here, we developed LCAs with mouse artificial chromosomes (MACs) that have unique characteristics such as stable maintenance and a substantial insert-carrying capacity. First, an NEluc-ARRB1 was inserted into MAC4 by Cre-loxP recombination in CHO cells, named ARRB1-MAC4. Second, a parathyroid hormone receptor 2 (PTHR2)-CEluc or prostaglandin EP4 receptor (hEP4)-CEluc were inserted into ARRB1-MAC4, named ARRB1-PTHR2-MAC4 and ARRB1-hEP4-MAC4, respectively, via the sequential integration of multiple vectors (SIM) system. Each MAC was transferred into HEK293 cells by microcell-mediated chromosome transfer (MMCT). LCAs using the established HEK293 cell lines resulted in 35,000 photon counts upon somatostatin stimulation for ARRB1-MAC4 with transient transfection of the somatostatin receptor 2 (SSTR2) expression vector, 1800 photon counts upon parathyroid hormone stimulation for ARRB1-PTHR2-MAC4, and 35,000 photon counts upon prostaglandin E2 stimulation for ARRB1-hEP4-MAC4. These MACs were maintained independently from host chromosomes in CHO and HEK293 cells. HEK293 cells containing ARRB1-PTHR2-MAC4 showed a stable reaction for long-term. Thus, the combination of gene loading by the SIM system into a MAC and an LCA targeting GPCRs provides a novel and useful platform to discover drugs for GPCR-related diseases.