Sterile Tissue Research Articles

Evaluation of a Novel Mechanical Device for the Production of Microfragmented Adipose Tissue for Veterinary Regenerative Medicine: A Proof-of-Concept

Therapies based on mesenchymal stromal cells (MSCs) have become one of the most significant advancements in veterinary regenerative medicine. The isolation of MSCs is usually performed by enzymatic digestion and requires variable times for cell expansion. In addition, these procedures need to be performed in specialized laboratory facilities. An alternative approach to in vitro-expanded MSC therapy is the use of \microfragmented adipose tissue (microfat), which is a rich source of cells and growth factors from the stromal vascular fraction. Recent clinical studies support its safety and efficacy in the treatment of musculoskeletal disorders and wound healing. The aim of the present work was to characterize the microfragmented adipose tissue obtained by a new mechanical device, which provides sterile tissue that is ready for use in the clinic by the veterinarian, avoiding the need for specialized laboratory facilities. Microfat-derived MSCs were compared with enzymatically isolated MSCs in terms of their phenotypic characterization, growth rate and differentiation potential. Conditioned medium derived from microfat culture was evaluated for its ability to promote MSC vitality. No differences were observed between MSCs obtained through mechanical fragmentation and those derived from collagenase digestion of adipose tissue, suggesting that the device could serve as a practical source of microfragmented adipose tissue for use in veterinary clinics.

Multiple ASC-dependent inflammasomes drive differential pro-inflammatory cytokine production in a mouse model of tendinopathy.

Inflammasomes are multiprotein complexes that regulate the bioactive production of IL-1b and IL-18, being implicated in the inflammatory response of different diseases. The inflammasome formed by the cytosolic sensor NLRP3 is highly promiscuous, as it could be activated by different pathogen- and sterile-signals. However, few models have studied the implication of NLRP3 in tissue damage-induced inflammation, particularly the implication of NLRP3 in tendinopathies. Here we aimed to investigate the implication of NLRP3 in a mouse model of tendinopathy by collagenase degradation of the extracellular matrix in the Achilles' mice tendon. We found that NLRP3 was involved in the production of IL-1b and IL-6, but another ASC-dependent inflammasome was required to produce IL-18 during sterile tissue damage. Our study suggests that in the immune response to extracellular matrix degradation different inflammasomes, probably expressed in different cell compartments, were able to differentially control IL-1b and IL-18 production in vivo. These results suggest the potential use of therapies targeting ASC as beneficial in the treatment of tendinopathies.

First Report of Exserohilum pedicellatum Causing Root Rot of Wheat (Triticum aestivum L.) in Uzbekistan.

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

12231 PAPP-A As A Potential Target In Thyroid Eye Disease

Abstract Disclosure: C.A. Conover: None. L.K. Bale: None. D. Hamadi: None. M. Stan: ; Tourmaline, Genentech, Third Rock Ventures, ArgenX, Septerna, OrthoDi. ; Horizon, Immunovant, Lassen, Sling. Background: Proptosis in Thyroid Eye Disease (TED) can result in facial disfigurement and visual dysfunction. Studies revealed an interaction between thyroid-stimulating hormone receptor (TSHR) and insulin-like growth factor-I receptor (IGF-IR) that is essential in promoting TED pathogenesis. Treatment with Insulin-like growth factor I receptor (IGF-IR) inhibitors has been shown to be effective in reducing proptosis but with side effects. PAPP-A is metalloprotease that can increase pericellular IGF bioavailability through specific cleavage of inhibitory IGF binding proteins, in particular IGFBP-4. We propose that inhibition of IGF-IR indirectly and more selectively with PAPP-A inhibitory antibodies attenuates IGF-IR signaling in TED with fewer side effects. Methods: Informed consent was obtained from TED patients undergoing surgery in Mayo Clinic operating suites in Rochester, MN. Retro-orbital tissue was collected from 19 TED patients and 2 control subjects for fibroblast isolation and culture and was performed in a sterile tissue culture facility. TED and control fibroblasts were treated with pro-inflammatory cytokines, and flow separation of CD34- and CD34+ orbital fibroblasts was done, the latter representing infiltrating fibrocytes into the orbit in TED. Main outcome measured were PAPP-A expression and proteolytic activity, IGF-I stimulation of phosphatidylinositol 3 kinase/Akt pathway and inhibition by immuno-neutralizing antibodies against PAPP-A, CD34+ status and associated PAPP-A and IGF-IR expression. Results: Primary cultured cells showed that PAPP-A is expressed in orbital fibroblasts from TED patients but not in control subject fibroblasts and were markedly increased by pro-inflammatory cytokines stimulation. IGF-IR expression was not affected by cytokine treatment. Inhibition of PAPP-A’s proteolytic activity suppressed IGF-IR activation in orbital fibroblasts from TED patients. CD34+ orbital fibroblasts represent 80% of cells in culture from TED patients, and approximately 70% of these cells were accountable for PAPP-A and IGF-IR expression. Conclusion: These results support a role for PAPP-A in TED pathogenesis and indicate the potential for novel therapeutic targeting of the IGF axis. Presentation: 6/2/2024

First report of wheat leaf spot disease caused by Curvularia inaequalis in China.

Wheat (Triticum aestivum) is an economically important crop widely cultivated in China. In August 2022, brown oval leaf spots with yellow halos were observed on approximately 10% wheat seedlings over an area of about 1 hectare in Xining City, Qinghai Province, which adversely affected wheat growth and production. Six diseased leaves were collected from the field in Huangyuan county (101°69' E, 37°04' N). The 0.5 cm × 0.5 cm pieces were cut from the border between healthy and diseased regions of the sampled leaves, surface sterilized for 10 s in 75% ethanol, followed by a 1% NaClO for 90 s, and rinsed three times with distilled sterile water. The pieces of leaf tissue were dried with sterile tissue, and plated on potato dextrose agar (PDA) amended with streptomycin (0.02 g/L) and ampicillin sulfate (0.05 g/L) to eliminate bacterial contamination. The dishes were placed in an incubator at 25°C for 72 h in dark. Three isolates, WGC201, WGC202 and WGC203, were obtained by a single-spore culture method. Fungal colonies on PDA media were dark green (Fig. 1A and 1B). Conidiophores were septate and geniculate terminals, while conidia exhibited straight or slightly curved forms with four transverse septa, the central cell being notably longer and wider than the others. The size of such conidia were 27.34 µm to 40.62 µm× 11.61 µm to 15.97 µm (number = 50) (av. 32.71 µm× 13.11 µm) (Fig. 1C and 1D) (Moubasher et al. 2010). The internal transcribed spacer (ITS) region of nuclear ribosomal DNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified and sequenced using universal primers ITS1/ITS4 and GPDF/GPDR (White et al. 1990; Berbee et al. 1999). DNA sequences were deposited into the NCBI database (ITS, PP789629, PP801333, and PP801574; GAPDH, PP849124, PP849125, and PP849126). Phylogenetic analysis with a neighbor-joining method based on the concatenated sequences of ITS and GAPDH genes showed that the three isolates clustered within a C. inaequalis branch (Fig. 2). Based on morphological and molecular identification, the fungal isolates were identified as C. inaequalis. The pathogenicity test was conducted in a greenhouse at 25°C using a spore suspension method and three isolates were used. Conidia were produced on PDA media (25℃) for 14 days. Plates were washed with sterilized distilled water and filtered with cheese cloth. Conidial suspension was adjusted to a concentration of 1×107 conidia/mL. Fifteen healthy seedlings of a wheat cultivar Xiaoyan-6 at a 3-4 leaf stage were inoculated by evenly spraying a 100mL spore suspension. Plants inoculated with sterile water served as a control. All plants were covered with plastic bags for 3 days. At 7 days after inoculation, all pathogen-inoculated plants showed similar symptoms (brown leaf oval spots with yellow halos) with those observed in the field, while all plants inoculated with sterile water showed no symptoms (Fig. 1E and 1F). The pathogen was reisolated from the symptomatic leaves and proved to be C. inaequalis. Morphological, molecular and pathogenic results indicated that C. inaequalis is the pathogen causing wheat leaf disease in China. The results are consistent with a previous report in Azerbaijan (Özer et al. 2020). To our knowledge, this is the first report of C. inaequalis causing spot disease on wheat in China. The occurrence, spread and economic importance to different wheat cultivars of the emerging disease in China will be further investigated and evaluated.

Molecular evidence of sterile tissue damage during pathogenesis of the pododermatitis aseptica hemorrhagica circumscripta is associated with disturbed epidermal-dermal homeostasis

Podermatitis aseptica hemorrhagica circumscripta is associated with metalloproteinase 2 weakening of distal phalangeal suspensory structures and sinkage of the distal phalanx in the claw capsule. Pressure from the tuberculum flexorium on the sole epidermis and dermis produces hemorrhagic tissue injury and defective horn production appearing as yellow-red, softened claw horn in region 4 of the sole. A model of the MAPK/ERK signal cascade orchestrating epidermal-dermal homeostasis was employed to determine if sterile inflammatory responses are linked to disturbed signal transduction for epidermal homeostasis in sole epidermis and dermis. The objective was to assess shifts in target genes of inflammation, up- and downstream MAPK/ERK signal elements, and targeted genes supporting epidermal proliferation and differentiation. Sole epidermis and dermis was removed from lateral claws bearing lesions of podermatitis aseptica hemorrhagica circumscripta, medial claws from the same limb and lateral claws from completely normal limbs of multiparous, lactating Holstein cows. The abundance levels of targeted transcripts were evaluated by real-time QPCR. Lesion effects were assessed by ANOVA, and mean comparisons were performed with t-tests to assess variations between mean expression in ulcer-bearing or medial claw dermis and epidermis and completely normal lateral claw dermis and epidermis or between ulcer-bearing dermis and epidermis and medial claw dermis and epidermis. The lesions were sterile and showed losses across multiple growth factors, their receptors, several downstream AP1 transcription components, CMYC, multiple cell cycle and terminal differentiation elements conducted by MAPK/ERK signals and β 4, α 6 and collagen 17A hemidesmosome components. These losses coincided with increased cytokeratin 6, β 1 integrin, proinflammatory metalloproteinases 2 and 9, IL1B and physiologic inhibitors of IL1B, the decoy receptor and receptor antagonist. Medial claw epidermis and dermis from limbs with lateral claws bearing podermatitis aseptica hemorrhagica circumscripta showed reductions in upstream MAPK/ERK signal elements and downstream targets that paralleled those in hemorrhagic lesions. Inhibitors of IL1B increased in the absence of real increases in inflammatory targets in the medial claw dermis and epidermis. Losses across multiple signal path elements and downstream targets were associated with negative effects on targeted transcripts supporting claw horn production and wound repair across lesion-bearing lateral claws and lesion-free medial claw dermis and epidermis. It was unclear if the sterile inflammation was causative or a consequence of these perturbations.

PAPP-A as a Potential Target in Thyroid Eye Disease.

Proptosis in Thyroid Eye Disease (TED) can result in facial disfigurement and visual dysfunction. Treatment with Insulin-like growth factor I receptor (IGF-IR) inhibitors has been shown to be effective in reducing proptosis but with side effects. To test the hypothesis that inhibition of IGF-IR indirectly and more selectively with PAPP-A inhibitors attenuates IGF-IR signaling in TED. Informed consent was obtained from TED patients undergoing surgery, and retro-orbital tissue collected for fibroblast isolation and culture. Surgeries were performed in Mayo Clinic operating suites. Cell culture was performed in a sterile tissue culture facility. Retro-orbital tissue was collected from 19 TED patients. Treatment of TED fibroblasts with pro-inflammatory cytokines. Flow separation of CD34- and CD34+ orbital fibroblasts, the latter representing infiltrating fibrocytes into the orbit in TED. PAPP-A expression and proteolytic activity, IGF-I stimulation of phosphatidylinositol 3 kinase/Akt pathway and inhibition by immuno-neutralizing antibodies against PAPP-A, CD34+ status and associated PAPP-A and IGF-IR expression. Pro-inflammatory cytokines markedly increased PAPP-A expression in TED fibroblasts. IGF-IR expression was not affected by cytokine treatment. Inhibition of PAPP-A's proteolytic activity suppressed IGF-IR activation in orbital fibroblasts from TED patients. TED fibroblasts that were CD34+ represented ∼80% of the cells in culture and accounted for ∼70% of PAPP-A and IGF-IR expressing cells. These results support a role for PAPP-A in TED pathogenesis and indicate the potential for novel therapeutic targeting of the IGF axis.

Outbreak of Septoria leaf spot caused by Sphaerulina musiva on Populus × euramericana in China.

In June 2023, severe leaf spots were noted in Populus × euramericana cv 'Nanlin95' plantations located in the Nanjing Baguazhou Wetland Park (32°09'16.97″N, 118°48'16.74″E) of Jiangsu Province and Populus × canadensis cv 'Sacrau 79' and Populus × canadensis cv 'Guariento' in the Liyuan Village in Nanyang City (32°53'43.70″N, 112°17'29.12″E) of Henan Province, respectively. The disease incidence in both locations could reach 97.9% (556 out of 568 trees) and 98.9% (2409 out of 2436 trees), respectively. The initial symptoms appear as numerous small and circular spots (1.59 to 3.18 mm in diameter) with gray or tan centers and dark-brown margins on the leaves. As the spots age, they sometimes enlarge, often coalesce, and may extend down the petioles. Diseased leaves and petioles were both surface sterilized with 75% ethanol for 30 seconds. With the aid of a hand lens, pycnidia (brown to black, spherical in profile, 90 to 250 µm diam) were easily picked out in the center of the spots and subsequently transferred into 1 mL sterilized water for preparing the spore suspension plated on KV8 medium amended with 100 mg/liter streptomycin sulfate and 50 mg/liter chloramphenicol. After 12 days of incubation, 86 single-spore isolates were obtained and identified as typical Septoria-like fungi according to morphological features, including slow-growing, gray or black colonies with pink mucilaginous matrix and hyaline, straight or curved conidia (size = 25 to 59 × 3.5 to 4 μm; septa = 1 to 6). Species identification was further validated by PCR amplification and sequencing of the internal transcribed spacer (ITS) region with ITS1/ITS4 primer pairs. Multiple sequence alignments with ClustalW revealed that the obtained ITS sequences of 86 isolates were 100% identical to each other. A BLAST search in GenBank indicated that the selfsame sequences of two representative isolates (isolate BGZ11 of Jiangsu Province, accession no. OR660379; isolate KZB22 of Henan Province, accession no. OR711499) shared 99.8% identity (494 of 495 bp) and 100% identity (504 of 504 bp) with related sequences of Sphaerulina musiva (Peck) Quaedvlieg, Verkley, and Crous (syn. = Septoria musiva Peck) in GenBank (MN275187; KF251619), respectively. Furthermore, we used a S. musiva-specific PCR assay (Abraham et al. 2018) on symptomatic leaf samples collected from the plantation. Each sample consisted of 20 cut-out leaf spots per leaf. Eight of the 10 samples were positive for S. musiva DNA. To confirm pathogenicity, six sterile tissue culture of poplar plants (Populus trichocarpa and Populus × euramericana cv 'Nanlin895') were respectively transplanted into pots and grown in a greenhouse for a week and for a month with an 18-h photoperiod augmented with sodium lamps and a 20°C (day)/16°C (night) temperature regime. Inoculations were conducted by spraying the plants with conidia suspension (106 conidia/mL) (LeBoldus et al. 2010). Control plants were sprayed with distilled water. Leaf spots were developed on the inoculated P. trichocarpa leaves at one week and P. × euramericana cv 'Nanlin895' leaves at 10 days after inoculation while no symptoms were observed on the control plants. The fungus S. musiva was successfully reisolated from all symptomatic leaves fulfilling Koch's postulates. Sphaerulina musiva only causes an endemic leaf spot disease on its natural North American host Populus. deltoides (Feau et al. 2010; Ostry 1987). However, on susceptible Populus species (e.g., P. balsamifera, P. trichocarpa, P. maximowiczii) and hybrids, S. musiva causes not only leaf spots but also severely damaging stem and branch cankers (Jeger et al. 2018; LeBoldus et al. 2009; Sondreli et al. 2020). To our knowledge, this is the first report of S. musiva causing leaf spots on poplar in China. Large-scale timber imports (e.g., cut branches, isolated bark, wood with and without bark) potentially lead to anthropogenic-facilitated transport of this pathogen. This outbreak of Septoria leaf spot underscores the potential threat of this pathogen to P. × euramericana in China, where it is widely planted as a keystone forestry species.

Tissue-resident macrophages exacerbate lung injury after remote sterile damage.

Remote organ injury, which is a common secondary complication of sterile tissue damage, is a major cause of poor prognosis and is difficult to manage. Here, we report the critical role of tissue-resident macrophages in lung injury after trauma or stroke through the inflammatory response. We found that depleting tissue-resident macrophages rather than disrupting the recruitment of monocyte-derived macrophages attenuated lung injury after trauma or stroke. Our findings revealed that the release of circulating alarmins from sites of distant sterile tissue damage triggered an inflammatory response in lung-resident macrophages by binding to receptor for advanced glycation end products (RAGE) on the membrane, which activated epidermal growth factor receptor (EGFR). Mechanistically, ligand-activated RAGE triggered EGFR activation through an interaction, leading to Rab5-mediated RAGE internalization and EGFR phosphorylation, which subsequently recruited and activated P38; this, in turn, promoted RAGE translation and trafficking to the plasma membrane to increase the cellular response to RAGE ligands, consequently exacerbating inflammation. Our study also showed that the loss of RAGE or EGFR expression by adoptive transfer of macrophages, blocking the function of RAGE with a neutralizing antibody, or pharmacological inhibition of EGFR activation in macrophages could protect against trauma- or stroke-induced remote lung injury. Therefore, our study revealed that targeting the RAGE-EGFR signaling pathway in tissue-resident macrophages is a potential therapeutic approach for treating secondary complications of sterile damage.

The role of human extracellular matrix proteins in defining Staphylococcus aureus biofilm infections.

Twenty to forty one percent of the world's population is either transiently or permanently colonized by the Gram-positive bacterium, Staphylococcus aureus. In 2017, the CDC designated methicillin-resistant S. aureus (MRSA) as a serious threat, reporting ∼300 000 cases of MRSA-associated hospitalizations annually, resulting in over 19 000 deaths, surpassing that of HIV in the USA. S. aureus is a proficient biofilm-forming organism that rapidly acquires resistance to antibiotics, most commonly methicillin (MRSA). This review focuses on a large group of (>30) S. aureus adhesins, either surface-associated or secreted that are designed to specifically bind to 15 or more of the proteins that form key components of the human extracellular matrix (hECM). Importantly, this includes hECM proteins that are pivotal to the homeostasis of almost every tissue environment [collagen (skin), proteoglycans (lung), hemoglobin (blood), elastin, laminin, fibrinogen, fibronectin, and fibrin (multiple organs)]. These adhesins offer S. aureus the potential to establish an infection in every sterile tissue niche. These infections often endure repeated immune onslaught, developing into chronic, biofilm-associated conditions that are tolerant to ∼1000 times the clinically prescribed dose of antibiotics. Depending on the infection and the immune response, this allows S. aureus to seamlessly transition from colonizer to pathogen by subtly manipulating the host against itself while providing the time and stealth that it requires to establish and persist as a biofilm. This is a comprehensive discussion of the interaction between S. aureus biofilms and the hECM. We provide particular focus on the role of these interactions in pathogenesis and, consequently, the clinical implications for the prevention and treatment of S. aureus biofilm infections.

Sterile donor tomography for improvement of refractive results after keratoplasty

Purpose: Any corneal microsurgeon may have inadvertently transplanted a donor corneal tissue with (subclinical) keratoconus or prior keratorefractive surgery, which typically leads to postoperative refractive surprises and cannot always be detected in the eye bank with only slit lamp. Given the increased number of keratorefractive procedures performed in the last decades, eye banks will soon have to face this problem more intensively. Thus, the efficiency and reliability of anterior segment optical coherence tomography (AS‐OCT) as a non‐invasive and sterile screening method in the eye bank to detect corneal grafts with curvature and/or thickness abnormalities was assessed.Methods: 1315 donor corneal tissues mounted in sterile tissue cultivation flasks were imaged using an AS‐OCT. The corneal tissues were preserved in organ culture medium I and transferred into organ culture medium II (containing dextran T‐500 6%) for deswelling at least 24 h prior to measurement and keratoplasty. Depth raster scans were performed through the posterior surface of the corneal tissues within a 7 mm central zone to create 3D volume data. The volume data set was preprocessed to eliminate flask reflections artefacts and to define the region of interest (ROI). Subsequently, the adaptation of a sphero‐cylindrical surface model was carried out with raytracing. Thus, the radii of curvature for the front and back surfaces can be determined and a corneal thickness map is generated.Results: The mean steep/flat front surface radius was 7.46 ± 0.29 (5.07–9.29)/7.69 ± 0.24 (6.70–9.50) mm, the corresponding values for the back surface being 6.47 ± 0.32 (5.00–8.00)/6.80 ± 0.31 (5.81–8.00) mm and the mean central thickness was 610 ± 84 (379–1457) μm. Abnormalities (beyond ±2 or ± 3 SD) were found in 140 or 34 corneas (10.6% or 2.6%) for anterior surface curvature, 120 or 38 corneas (9.1% or 2.9%) for the posterior surface, and 55 or 16 corneas (4.2% or 1.2%) for thickness.Conclusions: The AS‐OCT provides an objective, sterile and semi‐automated screening method to identify corneal morphological and refractive alterations (e.g. keratoconus, status post PRK/LASIK) and further optimize corneal donor selection in the eye bank. Corneal donors with curvature or thickness abnormalities ±3 SD do not have to be discarded but can be used for posterior lamellar keratoplasty or tectonic keratoplasty.

2716. Epidemiology of invasive fungal infection in pediatric liver transplant recipients: A retrospective, single-center study, 2012-2022

Abstract Background Studies on liver transplant (LT) recipients have reported an incidence of invasive fungal infection (IFI) ranging from 2.5 to 5%; however, antifungal prophylaxis has not yet been approved by the Ministry of Food and Drug Safety in Korea. We investigated the incidence of early-onset IFI and its characteristics in pediatric LT recipients in Korea, and also explored the risk factors for IFIs. Methods This is a retrospective, single-center study on children (< 19 years of age) who have undergone LT from 2012 to 2022 at Severance Hospital, Korea. IFI was defined as the detection of fungus in sterile fluid, tissue, and/or blood with symptoms of a fungal infection. Superficial fungal infection and colonization on the skin or urine were excluded. The primary outcome is the occurrence of IFI within 90 days of LT. The logistic regression method was used to analyze the risk factors for IFI. Results A total of 104 LT children were included, among whom 6 received multiple transplantations, resulting in 111 LT cases. 42% (n = 44) were male, and the median age at LT was 4.0 years of age (IQR 1.0–11.0). Two thirds of the patients received LT due to biliary atresia (n = 69, 66%), and the remaining were diagnosed with acute liver failure (n = 17, 16%), miscellaneous causes (n = 11, 11%), and so on (n = 7, 7%). Antifungal prophylaxis, except nystatin gargle, was done in 12.8% of recipients. IFI was identified in 19 patients (18%), and due to five multiple IFI events per patient, a total of 23 IFI events were noted at a median time of 16.5 days after LT (IQR 10-38). 87% of the pathogens detected were Candida species (C. albicans 40%, C. parapsilosis 35%, C. auris 15%), and Aspergillus fumigatus (13%). Antifungal susceptibility patterns are described in Table 1. The risk of IFI was significantly increased in those who underwent acute re-transplantation, postoperative intervention, or surgery due to bleeding, vascular, and bile duct complications (OR = 4.6; 95% CI, 1.5–13.6; P = 0.006) 8) and renal replacement therapy (OR=3.2; 95% CI, 1.1-8.8; P=0.028).Table.Antifungal susceptibility patterns of identified pathogens according to Clinical and Laboratory Standards Institute (CLSI). a Number of cases identified with the fungal pathogen b Antifungal susceptibility testing has to be additionally requested, so it was not performed in all cases. c 1 case had a fluconazole-resistant C.parapsilosis strain with intermediate resistance to other antifungal agents (MIC: fluconazole 32, micafungin 2, caspofungin 2, voriconazole 0.12, amphotericin B 0.5). d CLSI does not provide a tentative MIC breakpoint for voriconazole and other second generation azoles, but that of fluconazole may be considered as a surrogate. Conclusion The incidence of early IFI after LT in Korean children is considerable; therefore, universal antifungal prophylaxis is necessary. High-risk IFI patients, such as those undergoing reoperation, intervention, or renal replacement therapy, require attention and close monitoring. Disclosures All Authors: No reported disclosures

Granulomatous panniculitis in the setting of histoplasmosis in a patient with dermatomyositis on immunosuppressants

This report describes a case of panniculitis in the setting of infection with histoplasma capsulatum in a patient with active dermatomyositis on immunosuppressive medications. The appearance of panniculitis on the patient’s lower extremity was interpreted as possible necrotizing cellulitis in the setting of the patient’s immunosuppressive therapy or worsening of her dermatomyositis rash. The patient was placed on multiple trials of empiric antibiotic therapy for over a month with no improvement of her plaques. The patient did not exhibit the typical clinical manifestations of histoplasmosis nevertheless, through further workup, including, histological studies and sterile tissue culture, the patient was ultimately found to be infected with H. capsulatum and initiated on antifungal therapy. The case emphasizes the importance of placing other uncommon infectious etiologies like histoplasmosis on the differential in myositis patients on immunosuppression therapy with atypical presentations. Timely consideration of such possibilities ensures that appropriate therapies are initiated without delay.

MAIT cells in immune-mediated tissue injury and repair.

Mucosal-associated invariant T (MAIT) cells are T cells that express a semi-invariant αβ T-cell receptor (TCR), recognizing non-peptide antigens, such as microbial-derived vitamin B2 metabolites, presented by the nonpolymorphic MHC class I related-1 molecule. Like NKT cells and γδT cells, MAIT cells belong to the group of innate-like T cells that combine properties of the innate and adaptive immune systems. They account for up to 10% of the blood T-cell population in humans and are particularly abundant at mucosal sites. Beyond the emerging role of MAIT cells in antibacterial and antiviral defenses, increasing evidence suggests additional functions in noninfectious settings, including immune-mediated inflammatory diseases and tissue repair. Here, we discuss recent advances in the understanding of MAIT cell functions in sterile tissue inflammation, with a particular focus on autoimmunity, chronic inflammatory diseases, and tissue repair.

Identification of HDAC inhibitors as neutrophil recruitment modulators in zebrafish using a chemical library screen.

Tissue injury-induced neutrophil recruitment is a prerequisite for the initiation and amplification of inflammatory responses. Although multiple proteases and post-translational modification (PTM) enzymes regulate leukocyte recruitment, an unbiased functional screen of those enzymes regulating inflammatory leukocyte recruitment has yet to be undertaken. Here, using a zebrafish tail fin amputation (TFA) model to screen a chemical library consisting of 295 compounds that target proteases and PTM enzymes, we identified multiple histone deacetylase (HDAC) inhibitors that modulate inflammatory neutrophil recruitment. AR-42, a pan-HDAC inhibitor, was shown to inhibit neutrophil recruitment in three different zebrafish sterile tissue injury models: TFA, copper-induced neuromasts damage (CIND), and mechanical otic vesicle injury (MOVI), and a sterile murine peritonitis model. RNA sequencing analysis of AR-42-treated fish embryos revealed downregulation of neutrophil-associated cytokines/chemokines, and exogenous supplementation with recombinant human IL-1β and CXCL8 partially restored the defective neutrophil recruitment in AR-42-treated MOVI model fish embryos. We thus demonstrate that AR-42 non-cell autonomously modulates neutrophil recruitment by suppressing transcriptional expression of cytokines/chemokines, thereby identifying AR-42 as a promising anti-inflammatory drug for treating sterile tissue injury-associated diseases.

Neuroinflammation and the immune system in hypoxic ischaemic brain injury pathophysiology after cardiac arrest.

Hypoxic ischaemic brain injury after resuscitation from cardiac arrest is associated with dismal clinical outcomes. To date, most clinical interventions have been geared towards the restoration of cerebral oxygen delivery after resuscitation; however, outcomes in clinical trials are disappointing. Therefore, alternative disease mechanism(s) are likely to be at play, of which the response of the innate immune system to sterile injured tissue in vivo after reperfusion has garnered significant interest. The innate immune system is composed of three pillars: (i) cytokines and signalling molecules; (ii) leucocyte migration and activation; and (iii) the complement cascade. In animal models of hypoxic ischaemic brain injury, pro-inflammatory cytokines are central to propagation of the response of the innate immune system to cerebral ischaemia-reperfusion. In particular, interleukin-1 beta and downstream signalling can result in direct neural injury that culminates in cell death, termed pyroptosis. Leucocyte chemotaxis and activation are central to the in vivo response to cerebral ischaemia-reperfusion. Both parenchymal microglial activation and possible infiltration of peripherally circulating monocytes might account for exacerbation of an immunopathological response in humans. Finally, activation of the complement cascade intersects with multiple aspects of the innate immune response by facilitating leucocyte activation, further cytokine release and endothelial activation. To date, large studies of immunomodulatory therapies have not been conducted; however, lessons learned from historical studies using therapeutic hypothermia in humans suggest that quelling an immunopathological response might be efficacious. Future work should delineate the precise pathways involved in vivo in humans to target specific signalling molecules.

Intrathoracic eosinophilic sclerosing fibroplasia with intralesional bacteria in a cat

Case summary A 9-year-old neutered female domestic shorthair cat was presented for investigation of a cranial mediastinal mass. Moderate peripheral eosinophilia and mild-to-moderate polyclonal gammopathy were identified. A thoracoabdominal CT scan documented a cranial mediastinal mass encircling the trachea. Ultrasound-guided fine-needle aspiration and core-needle biopsy were performed, but cytology and histopathology were inconclusive. Surgical debulking was performed. Further histological samples identified severe pyogranulomatous and eosinophilic fibrosing mediastinitis, consistent with feline eosinophilic sclerosing fibroplasia. Gram staining and fluorescence in situ hybridisation (FISH) identified numerous Gram-positive coccoid bacteria. Eosinophilia and hyperglobulinaemia resolved after surgery and combined antimicrobial and immunosuppressive therapy. The cat died 3 months later after developing acute haemorrhagic diarrhoea and dyspnoea. Relevance and novel information Eosinophilic sclerosing fibroplasia is reportedly mainly confined to the gastrointestinal tract in cats. Less commonly, extragastrointestinal cases have been described. Lesions in the mediastinal or sternal lymph nodes have been reported, all in association with evident gastrointestinal involvement. The presence of pleural effusion was variable in these cases. To the authors’ knowledge, this is the first report of eosinophilic sclerosing fibroplasia presenting due to lower respiratory signs in a cat. Intralesional bacteria were identified using Gram staining and FISH examination. The presence of intralesional bacteria in the normally sterile mediastinal tissue may support the involvement of penetrating injuries in the pathogenesis of the disease. Eosinophilic sclerosing fibroplasia should be suspected in any cat with abdominal and/or thoracic masses, particularly if associated with peripheral eosinophilia and polyclonal gammopathy.

A pH-responsive magnetic resonance tuning probe for precise imaging of bacterial infection in vivo.

Accurate and sensitive detection of bacteria is essential for treating bacterial infections. Herein, a pH-responsive magnetic resonance tuning (MRET) probe, whose T1-weighted signal is activated in the bacteria-infected acid microenvironment, is developed for in situ accurately magnetic resonance imaging (MRI) of bacterial infection in vivo. The MRET probe (MDVG-1) is an assembly of paramagnetic enhancer (gadolinium-modified i-motif DNA3, abbreviated as Gd-DNA3-Gd) and the precursor of superparamagnetic quencher (DNA and vancomycin-modified magnetic nanoparticle, abbreviated as MDV). The T1-weighted signal of Gd-DNA3-Gd is quenched once the formation of MDVG-1 (MRET ON). Interestingly, the MDVG-1 probe was disassembled into the monomers of Gd-DNA3-Gd and MDV under the bacteria-infected acid microenvironment, resulting significantly enhanced T1-weighted signal at the infected site (MRET OFF). The pH-responsive MRET probe-based enhanced MRI signal and bacteria targeting significantly improve the distinction between bacterial infectious tissues and sterile inflamed tissues, which provides a promising approach for accurately detecting bacterial infection in vivo. STATEMENT OF SIGNIFICANCE: : Detecting pathogenic bacteria in vivo based on magnetic resonance imaging (MRI) strategy has been exploring recently. Although various bacterial-targeted MRI probes have been developed to image bacteria in vivo, the MRI signal of these MRI probes is always "on", which inevitably generates nonspecific background MRI signals, affecting the accuracy of MRI to a certain extent. In the current study, based on the magnetic resonance tuning (MRET) phenomenon, we present a pH-responsive MRET probe (MDVG-1) with T2-weighted imaging to T1-weighted imaging switchable properties to achieve in situ precise imaging of bacterial infection in vivo.

Methylation age and inflammation in prodromal Alzheimer’s disease

AbstractBackgroundThe most relevant risk factor in Alzheimer’s disease (AD) is age. Aging is a complex process involving several biological changes which lead to chronic cellular stress and to a sterile tissue inflammation. During aging cells become senescent which is seen as morphological changes and secretion of immune signaling mediators associated with systemic low‐grade inflammation. Interestingly, during neurodegenerative processes such AD, microglia, astrocytes, and vascular unit cells become senescent. To explore the potential connection between immune signaling mediators, ageing, and biomarkers of AD, we have quantified in CSF several immune related molecules link to AD and analyzed their connection with known biological clocks.MethodBiological age was obtained by deriving the epigenetic clock in DNA derived from peripheral blood. To this end, DNA methylation data was generated using the EPIC array from Illumina in two cohorts including 348 individuals (cognitively normal, subjective cognitive decline and mild cognitive impairment) from DELCODE study and 267 individuals (mild cognitive impairment). Data was prepared and normalized using standard quality controls. Horvath’s and Hannum epiClocks were computed for all individuals in both cohorts. AD biomarkers including Amyloid‐ß, phosphor‐tau and total tau along with a panel of inflammation markers were measured in CSF samples.ResultBoth epiClocks showed a significant strong correlation with chronological age in both cohorts. Methylation age and chronological age showed both a significant association with classical AD biomarkers, as well as a subsets of inflammation markers. The meta‐analysis confirmed the association of the Epiclocks and the chronological age with all AD biomarkers as well as with YKL40, sTREM2, C‐1 and MIF. Based on the difference between the calculated epiClock and the chronological age, we derived an index reporting on increase in biological aging rate (age‐acceleration). This index, however, did not show significant association with any of the AD biomarkers and inflammation markers.ConclusionOur study shows a link between inflammatory markers and methylation age in both healthy aging and pre‐dementia stages of AD. However, biological clocks derived from peripheral tissue seem to be independent of potential AD pathology and inflammation occurring in the aging brain. Thus, these biomarkers are not increasing the odds for methylation age‐acceleration.

Differential Binding of NLRP3 to non-oxidized and Ox-mtDNA mediates NLRP3 Inflammasome Activation

The NLRP3 inflammasome is a key mediator of the innate immune response to sterile tissue injury and is involved in many chronic and acute diseases. Physically and chemically diverse agents activate the NLRP3 inflammasome. Here, we show that NLRP3 binds non-oxidized and Ox-mtDNA differentially, with a half maximum inhibitory concentration (IC50) for non-oxidized and Ox-mtDNA of 4 nM and 247.2 nM, respectively. The NLRP3 Neonatal-Onset Multisystem Inflammatory Disease (NOMID) gain of function mutant could bind non-oxidized mtDNA but had higher affinity for Ox-mtDNA compared to WT with an IC50 of 8.1 nM. NLRP3 lacking the pyrin domain can bind both oxidized and non-oxidized mtDNA. Isolated pyrin domain prefers Ox-mtDNA. The NLRP3 pyrin domain shares a protein fold with DNA glycosylases and generate a model for DNA binding based on the structure and sequence alignment to Clostridium acetobutylicum and human OGG1, an inhibitor of Ox-mtDNA generation, 8-oxoguanine DNA glycosylases. We provide a new model for how NLRP3 interacts with Ox-mtDNA supported by DNA binding in the presence of a monoclonal antibody against the pyrin domain. These results give new insights into the mechanism of inflammasome assembly, and into the function of reactive oxygen species in establishing a robust immune response.