Sterile Containers Research Articles

Delivery mode and maternal gestational diabetes are important factors in shaping the neonatal initial gut microbiota.

The infant gut microbiome's establishment is pivotal for health and immune development. Understanding it unveils insights into growth, development, and maternal microbial interactions. Research often emphasizes gut bacteria, neglecting the phageome. To investigate the influence of geographic or maternal factors (mode of delivery, mode of breastfeeding, gestational diabetes mellitus) on the gut microbiota and phages of newborns, we collected fecal samples from 34 pairs of mothers and their infants within 24 hours of delivery from three regions (9 pairs from Enshi, 7 pairs from Hohhot, and 18 pairs from Hulunbuir) using sterile containers. Gut microbiota analysis by Shotgun sequencing was subsequently performed. Our results showed that geographic location affects maternal gut microbiology (P < 0.05), while the effect on infant gut microbiology was not significant (P = 0.184). Among the maternal factors, mode of delivery had a significant (P < 0.05) effect on the newborn. Specific bacteria (e.g., Bacteroides, Escherichia spp., Phocaeicola vulgatus, Escherichia coli, Staphylococcus hominis, Veillonella spp.), predicted active metabolites, and bacteriophage vOTUs varied with delivery mode. Phocaeicola vulgatus significantly correlated with some metabolites and bacteriophages in the early infant gut (P < 0.05). In the GD group, a strong negative correlation of phage diversity between mother and infants was observed (R = -0.58, P=0.04). In conclusion, neonatal early gut microbiome (including bacteria and bacteriophages) colonization is profoundly affected by the mode of delivery, and maternal gestational diabetes mellitus. The key bacteria may interact with bacteriophages to influence the levels of specific metabolites. Our study provides new evidence for the study of the infant microbiome, fills a gap in the analysis of the infant gut microbiota regarding the virome, and emphasizes the importance of maternal health for the infant initial gut virome.

A Prospective Study to Identify Asymptomatic Bacteriuria: The Causative Organisms, Antibiotic Sensitivity and its Safety in Pregnant Females

Introduction: The common procedure of urinary catheterization during childbirth may introduce bacteria that can cause urinary tract infections. Immune function is relatively compromised during pregnancy. The current study was aimed to identify antenatal patients with bacteriuria, the causative organism and its antibiotic sensitivity in patients with bacteriuria. Materials and Methods: The current prospective crosssectional study involved antenatal patients who were being admitted to the delivery room. A clean catch midstream urine sample was collected in a sterile container of which 5 to 10 mL of the sample was obtained in a separate sterile vial (container 1) for screening tests for leucocyte esterase and nitrite, and the remaining sample (container 2) was taken for routine microscopy, culture, and sensitivity. The reports were collected and tabulated, and bacteriuria was confirmed and statistically analyzed. Results: A total of 200 patients were evaluated, and 40 of them had asymptomatic bacteriuria. In this study positive leukocyte esterase test and nitrite test results were considerably higher in the cases than the controls (p &lt; 0.05) at 10.0 and 47.5%, respectively. Escherichia coli was found to be the most prevalent bacteria in this study, followed by, Pseudomonas, Enterococcus faecalis, Candida albicans, and coagulasenegative Streptococcus and Klebsiella. Most of the E. coli isolates (100.0%) were sensitive to amikacin, a category D drug. The majority of Pseudomonas isolates (100.0%) were sensitive to colistin, a category C drug. Amongst category A drugs, Pseudomonas was sensitive to – cefoperazone-sulbactam, meropenem and piperacillin-tazobactam. Conclusion: It is a standard practice to send urine routine and microscopy test in antenatal patients. As most patients are asymptomatic, investigations are required for early diagnosis of significant bacteria like leucocyte esterase, nitrite and culture and sensitivity. This will help us to institute appropriate treatment and improve maternal and fetal outcomes.

Antimicrobial Effects of Sansevieria Zeylanica Extracts on Urinary Tract Infection Associated Pathogens Isolated from Students Attending a Tertiary Institution

Urinary tract infections usually develop in the lower urinary tract and if not properly treated, they ascend to the upper urinary tract, causing severe damage to the kidneys. Sansevieria zeylenica is a plant known to be rich in phenolic compounds, which may be responsible for its antibacterial activities against Uropathogens.The study was aimed to investigate the antimicrobial effect of Sansevieria zeylenica extracts against isolate of UTI among students attending tertiary institution. A total of two hundred (200) urine samples were randomly collected from the students attending University of Benin into sterile universal containers and analyzed for the detection of Uropathogens using standard microbiological procedure while the leaf and root of Sansevieria zeylenica extraction was carried out with methanol using the Soxhlet apparatus. The antimicrobial activity against the isolates was determined using Agar well diffusion and the minimum inhibitory concentration (MIC) of the extracts against the isolates was determined using the microdilution method. Of the 200 participants studied, 23 (11.5%) had growth of four bacteria species associated with urinary tract infection; Escherichia coli, Proteus vulgaris, Pseudomonas aeruginosa, and Staphylococcus aureus. The activity of both leaf and root extracts was greater at 200mg/ml against E. coli and P. vulgaris isolates, but at 400mg/ml against S. aureus with Minimum Inhibitory Concentrations of the leaf extract as 8mg/ml, 4mg/ml, 8mg/ml, and &gt;16mg/ml against E. coli, S. aureus, P. vulgaris, and P. aeruginosa, respectively. The association of leaf extract and Ampicillin increases the activity of Ampicillin, producing a greater zone of inhibition (26mm) against P. vulgaris compared to Ampicillin alone (21mm) and leaf extract alone (16mm) giving rise to a synergistic effect. Sansevieria zeylanica extracts in this study can control Urinary Tract Infection and may be combined with conventional antibiotics as a treatment for Uropathogens. Though, further investigation would be requiring for the molecular mechanism behind its antibacterial activity.

Bacterial Uropathogens causing Urinary Tract Infection at Hetauda Hospital

Introduction: Urinary tract infection is the infection of the uroepithelium that mainly affects kidney, ureter, urinary bladder and urethra. The causative agents of urinary tract infections are bacteria and fungi. Among these, bacteria are the most causative uropathogens of urinary tract infections. Objectives: The objective of this study is to isolate, identify, characterized and perform antibiotic sensitivity test from the bacterial isolates. Methods: A descriptive cross-sectional study was conducted from March 2023 to May 2023. Ethical approval was obtained from Institutional Review Committee (IRC), Madan Bhandari Academy of Health Sciences, IRC-32-079. Total of 1120 urine samples were collected during this study. Convenient sampling technique was used for this study. Clean catch or mid-stream urine was collected in a sterile container. All urine samples were submitted to Department of Microbiology for culture. A set of biochemical tests were done for bacterial identification. Antibiotic sensitivity test was performed by Kirby-Bauer disk diffusion method. Results: Total of 1120 urine samples were collected from patients suspected to Urinary Tract Infections. Total urine culture positive was 340 (30.36%). Of these bacterial isolates, Escherichia coli (248, 73%) was the most common species, followed by Klebsiella species (26, 7.6%), Staphylococcus saprophyticus (23, 6.76%) and Enterococcus fecalis (18, 5.3%). Conclusion: As prevalence of bacteria causing urinary tract infections is increasing day by day; so its proper isolation, identification, characterization with their antibiotic profile is necessary as it forms the base line for the clinicians to choose appropriate antimicrobial agents for empirical as well as rational treatment for UTIs.

Lowering Cranioplasty Infection Incidence with Novel Bone Flap Storage Protocol: A Retrospective Cohort Study

IntroductionAfter craniectomy, autologous bone flaps may be stored using wet or dry cryopreservation. After brain edema subsides, they are replaced during an operation termed “cranioplasty.” Cranioplasty is associated with 15% infection incidence. MethodsWe conducted a retrospective comparison of infection outcomes between “wet” and “dry” cryopreservation of cranioplasty bone flaps. Historically, bone flaps were stored utilizing “wet” cryopreservation – bone flap storage in 1 L of Lactated Ringer’s solution containing 80mg gentamicin and 2g nafcillin in a sterile plastic container secured in an unsterile plastic bag. Our newer dry cryopreservation protocol involved storage in gauze soaked in 80mg gentamicin and 2g nafcillin within a 3-layer sterile bag system. Results119 autologous bone flaps were included with median follow-up of 3.9 months from cranioplasty. Overall, 10.9% became infected requiring subsequent surgery. 18.4% of 49 bone flaps stored using wet cryopreservation became infected compared to only 5.7% of 70 dry cryopreservation bone flaps (p 0.038; Relative risk 0.311; Absolute risk reduction 12.7%). Tobacco use (p 0.076; RR 3.17) was not associated with increased infection risk. Infection incidence was similar for traumatic craniectomy indications compared to the other indications (12.0% trauma versus 10.1% other; p 0.750). On average, infected cranioplasty patients spent 8.5 more days hospitalized and faced increased risk of additional complications. ConclusionDry cryopreservation significantly decreases infection after cranioplasty when compared with wet cryopreservation, which mitigates additional morbidity, mortality, and costs attributable to cranioplasty infection. Other nonmodifiable risk factors for cranioplasty infection were identified.

STORAGE AND QUALITY CONTROL OF ALCOHOLIC BEVERAGES

For the modern food industry, the key issues are quality control and product safety, as well as maintaining high quality products during storage. Dessert liqueurs are multicomponent liquids consisting of natural ingredients of various types – carbohydrates, proteins, phenolic compounds, contain minerals, tannins and pectins, organic acids, tannins, polysaccharides. These natural components are susceptible to oxidation, precipitation, and can lead to cloudiness in liqueurs. The problems associated with the storage of dessert liqueurs in Ukraine in order to study the most influential factors on the quality indicators of alcoholic beverages are analysed. The composition of dessert liqueurs plays a critical role in the formation of the finished drink. It is noted how various components influence the sensory characteristics and quality of the product, allowing the formation of an unsurpassed flavor profile of the liqueur. It is equally important to comply with all technological conditions in the production of liqueurs: production of semi-finished products, water preparation, compliance with temperature conditions, sterile containers. The factors influencing the stability of liqueurs are analysed. Thus, an increase in the content of extractive substances and the strength of drinks has a positive effect on the stability of liqueurs, including protection against cloudiness. The process of aging liqueurs is another criterion for obtaining the desired characteristics. It is noted that the duration and conditions of aging are of key importance for the formation of the unique taste and aroma of the drink. The formation of turbidity and sediment during storage of liqueurs was studied. The optimal temperature for storing liqueurs is above 12 ºС, but should not exceed (22–25 ºС); at lower temperatures there is a gradual deterioration in taste and aroma. It is considered that long-term storage of liqueurs is associated with the loss of bioactive substances, primarily antioxidants. The changes that occur in the finished drink during long-term storage are investigated, including the formation of biogenic amines and their impact on the quality of the product. The main factors influencing the quality and shelf life of drinks have been identified to formulate further ways to solve this problem.

Role of liquid biopsy in non small cell lung cancer

Lung cancer is the leading cause of morbidity and mortality worldwide. It is usually diagnosed in advance stage. miRNA present in serum and pleural fluid can be studied for early diagnosis of lung cancer. Present study was carried out to evaluate whether miRNA can be used as biomarkers in diagnosis of non small cell lung cancer. The study was intended to find the non-invasive tumour biomarkers for presence of lung malignancy with the intent of instituting early diagnosis to reduce lung cancer related mortality. The aim of the study was to evaluate circulating microRNA expression in adenocarcinoma and squamous cell carcinoma lung in comparison with age and sex matched healthy controls. The expression of these miRNA was correlated with histopathology and/or immunohistochemistry. The circulating miRNA expression in age and sex matched non-smoking healthy controls was also noted. It was a Prospective observational study in which 50 cases of non small cell lung cancer was included. 50 healthy non smoker volunteers (control group, well adjusted to the patients according to the age and sex) were also included in the study. About 5 ml of serum and wherever possible pleural fluid was collected in the sterile container. The sample was allowed to stand at room temperature for one hour, and then samples were centrifuged at 1300g for ten minutes at room temperature.RNA was extracted using miRNeasy mini kit (Cat no. 217004) and quantative PCR was done. The patients age, sex, histopathological results, clinical staging, immunohistochemistry, presence of pleural effusion. Expression of mi RNA (miRNA 21, miRNA 17-92 cluster, miRNA 221/222, miRNA Let- 7, miRNA 34 and miRNA 200) were studied. Out of 50 patients of suspected lung cancer 17 were females (34%) and 33 (66%) were males. Mean age of presentation was 63.26 years. 37 patients gave history of smoking (74%) while 13 patients were non Smokers (26%). 29 patients (58%) showed histomorphological features suggestive of adenocarcinoma whereas 21 patients (42%) showed histomorphological features of squamous cell carcinoma. EGFR mutation was seen in 10 patients (34%). Pleural effusion was present in 20 cases.Statistically significant correlation was found between the expression of miRNA in healthy controls and in lung cancer patients. All the tested miRNAs were significantly correlated with the corresponding expression in the healthy control. As compared to healthy controls that let-7, miR-34 and miR-200 were downregulated in lung cancer patients whereas miRNA-221, miRNA 17-92, miRNA-21 were upregulated in lung cancer patients. miR 34, miR 200 and let 7 was detected in healthy controls also. No statically significant correlation of miRNA with age, sex, smoking, histopathological type, grade of tumor, stage of disease, EGFR mutation and IHC was found. Stastically significant correlation was found between miRNA 200 and pleural effusion patients. Present study concludes that miRNA can be a potential biomarker for diagnosing lung cancer. To date, there is convincing evidence supporting the potential role of miRNAs as biomarkers for lung cancer diagnosis and prognosis. However, further research is required in this aspect.

The Bacteriological Quality of Raw Cow Milk Obtained from Herdsmen in Okigwe, Imo State, Nigeria

This study was conducted to examine the bacteriological quality of cow’s raw milk obtained from herdsmen at Okigwe, Imo States. Standard microbiological procedure was used to carry out this research. A total number of five samples were gotten from different streets in Okigwe metropolis in sterile specimen containers. Ten fold serial dilution was carried with each of the sample with the 4th tube to 6th tube being inoculated on Nutrient agar, Salmonella- Shigella agar and MacConkey agar by spread plate method and incubated at 37oC for 24 hours. The microorganisms were identified were Staphylococcus aureus, Corynebacterium sp, Salmonella typhi, Streptococcus sp, E. coli, Lactobacillus sp and Salmonella typhi. The total viable count for raw cow milk ranged from 6.6 x105CFU/ml to 1.01 x 106CFU/ml while total coliform count was from 6.2x106 CFU/ml to 1.7x106 CFU/ml. They frequency of occurrence of Lactobacillus sp was highest with a value 85 and the lowest frequency was Salmonella typhi II with a value of 2. The raw cow milk was observed to harbor some pathogenic microorganisms which can cause infections when ingested.

Molecular Analysis of Some Virulence Genes of Escherichia Coli Isolates from Wound and Burn Samples in Kirkuk City

Background: Gram-negative infections caused by non-spore producing E. coli that are facultatively anaerobic have been recognized as serious infections linked to higher mortality and significant costs associated with medical care.&#x0D; Aim: The goal of this study was to determine whether or not a number of E. coli strains are capable of producing virulence genes by using a technique called real time PCR.&#x0D; Materials and Methods: 155 people with burns and wounds had their cultures obtained, and susceptibility testing using swabs, tissue biopsies, and needle aspirations were performed. When compared to other techniques of specimen collection, swab cultures yield precise results and are a practicable, widely utilized, non-invasive, and cost-effective method. The two most recommended techniques for obtaining specimens are tissue biopsy and needle aspiration. Swab cultures, on the other hand, are appropriate since they are useful, widely applied, non-invasive, and reasonably priced. Samples from patients were collected in the consultation rooms, including swabs from burns and wounds. The sufferers had these taken from them. Before being identified, smear samples were initially cultivated in the lab on several selective media. Transport media-filled sterile collection containers containing these samples were brought to the lab.&#x0D; Results: According to the study's findings, E. coli was found in 27.10% of the burns and wounds samples. According to the study's findings, the majority of patients with E. coli infections (71.43 percent) were females, while only 28.57 percent were males. According to the study's findings, 28.57 percent of patients diagnosed with E. coli infections were between the ages of 31 and 40. The investigation also indicated that all of the sputum samples containing E. coli isolates were from patients above the age of 40. Furthermore, 45 percent of urine samples were collected from patients aged 31 to 40, and 42.86 percent of patients had wound infections. When examined using the MTP technique, fifty percent of the E. coli isolates tested positive for being potent biofilm producers, according to the study's findings. The DNA of 12 distinct E. coli bacterial isolates was isolated and purified using a genomic DNA purification kit. The bacteria were cultured on chromogenic agar medium to produce these E. coli isolates. The results were detected using electrophoresis on agarose gel at a concentration of 1.5 percent. The gel was then exposed to ultraviolet light, which revealed the DNA as compact bands. The virulence gene was found in 95.24 percent of the E. coli isolates taken from burn and wound sites, according to the study's findings. The majority of E. coli isolates tested positive for amikacin, imipenem, and gentamycin, according to the study's findings. The majority of E. coli isolates, on the other hand, were resistant to the medications amoxicillin, levofloxacin, cefotaxime, ceftriaxone, pefloxacin, cefepime, and ampicillin.

Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.

Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility. The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria. This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria. The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old. Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation. Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles. Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer. The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A&gt;T /T&gt;A) 6 (6.6%), rs1382451565 (C&gt;T) 5 (5.4%), and rs935520555 (G&gt;C) 5 (5.4%), rs1479789045 (G/C&gt;A/ A&gt;G) 4 (4.3%), rs570570800 (C&gt;T/ G&gt;T) 3 (3.3%), rs1281533806 (C&gt;A) 3 (3.3%), rs1434703461 (C&gt;T/ G&gt;T) 3 (3.3%), rs2069881018 (G&gt;C) 3 (3.3%), rs549835830 (G&gt;C) 2 (2.2%), rs2069880888( C&gt;T ) 2 (2.2%), rs997110743 (G&gt;C/C&gt;G), rs1236501997 1 (1.1%), rs119399669 (C&gt;T) 1 (1.1%), and rs1052575569 (G&gt;A/C&gt;A) 1 (1.1%). In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.

Escherichia coli dominance and antimicrobial resistance in urinary tract infections among diabetic patients: Insights from Birnin Kebbi Metropolis, Nigeria

Background: The global rise in antibiotic-resistant urinary tract infections (UTIs) is a growing concern, particularly among diabetic patients. This study examines the antibiotic resistance patterns of bacterial uropathogens in diabetic patients at Sir Yahaya Memorial Hospital in Birnin Kebbi.&#x0D; Methods: A purposive sampling approach was used to collect 51 mid-stream urine samples in sterile containers. Cultural and biochemical methods were employed for the isolation and identification of uropathogenic bacteria. Antibiotic sensitivity testing was performed using the disc diffusion method, with results interpreted according to the Clinical Laboratory Standards Institute (CLSI) guidelines.&#x0D; Results: UTIs were prevalent in 23.5% (12/51) of the samples. Escherichia coli was the most prevalent uropathogen, accounting for 41.3% (7/17) of cases, followed by Klebsiella pneumoniae at 23.5% (4/17). Staphylococcus aureus and Proteus mirabilis each contributed to 17.6% (3/17) of cases. Notably, E. coli and K. pneumoniae exhibited 100% resistance to chloramphenicol and sparfloxacin, respectively.&#x0D; Conclusion: These findings underscore the need for further molecular research to characterize these uropathogens and identify the genes contributing to antibiotic resistance.

Isolation and Susceptibility of Microorganisms Responsible for Asymptomatic Antenatal Bacteriuria

Aim &amp; Objective: Determination of prevalence, bacterial profile and antibiotic sensitivity of microorganisms responsible for asymptomatic UTI during pregnancy.&#x0D; Methodology: The type of study is cross-sectional, Prospective type, was conducted at the PUMHS for Women Nawabshah (SBA) after approval from the Ethical Review Committee and the duration was 2 years from 1st Jan 2021-31st Dec 2022. Samples were collected by non-probability- convenient method from all pregnant women without any clinical complaints attending the Outpatient Department of Gynecology and Obstetrics PUMHS Hospital Nawabshah. The midstream urine collected by clean catch method in sterile containers was processed for DR of urine including physical, chemical, and microscopic examination. After the urine detailed report, the samples were sent for, culture by using the following media, blood, Macconkey’s, and CLED agar. Growth-positive samples were proceeding for gram staining, biochemical tests, and antibiotic sensitivity reports according to world standard methods for confirmation.&#x0D; Results: Out of 477 patients 96 (20%) were positive for ASB, with the mean age of the patient being 29.32±5.74 The most common microorganisms found in the study were E.coli 67 (69.7.%), followed by Klebisella in 4(4%), proteus 9(9%), pseudomonas 8(8.3%), staphylococcus aureus 2(2%), staphylococcus saprophyticus in 4(4%), streptococcus pyogen 2(2%).&#x0D; There was 100% sensitivity found for all isolated microorganisms following culture examination to following antibiotics: Ciprofloxacin, Cefuroxime, Imepenem, Ceftriaxone Amikacin, Meropenem, and Piperacillin-tazobactam; however, 52% and 45% sensitivity of E.coli and 100% sensitivity of streptococci were present for amoxicillin-clavulanic acid and ampicillin respectively.&#x0D; Conclusion: A rising number of silent antenatal bacteriuria was observed in younger age women with severe maternal and fetal complications in advanced stages of pregnancy and thereafter. It is therefore suggested to routinely perform urine cultures for every suspected pregnant lady during advanced antenatal visits to diagnose and properly treat the asymptomatic bacteriuria in terms of avoiding antibiotic resistance and materno-fetal complications in the near future.

Prevalence and risk factors of geohelminths in primary schools children aged 5 to 15 years in the city of Moundou, southwestern Chad

Geohelminthiases are endemic in Chad and constitute a serious public health problem. This study aimed at determing the prevalence and risk factors of intestinal geohelminthiasis in children aged 5–15 years in the city of Moundou, Chad. This was a cross-sectional and descriptive study carried out in the city of Moundou. A total of 333 pupils participated in this study and it included children aged from 5 to 15 years attending three public primary schools in Moundou. A questionnaire was administered to each student after obtaining Informed Consent from either parent. Stool samples were collected in a sterile container and, the formalin-ethyl ether concentration technique was used to identify parasite. Parasitic load was assessed using the Mc Master cell method. The collected data were analyzed using Excel; Word 2016 and SPSS 20 software. An overall prevalence of 16.52% was obtained, 9.3% for Trichuris trichiura, 6.9% for Ascaris lumbricoides, and 1.2% for Hookworms. Male participants were more infected (67.24%) than females (32.76%). The age group]9–13] was the most infected (53.44%), followed by the age group [5–9](44.83%) and finally the age group]13–15] (1.73%). The Ouhoud school was the most infected (55.17%) followed by the Adoum Dallah school (39.66%) and finally the Centre school (5.17%). However, no statistically significant difference between gender and geohelminthiasis infection was recorded (p > 0.05). Regarding risk factors, statistical analysis showed that age group]9–13] (OR = 1.997 at 95% CI at [1.085–3.677]), Central Public School (OR = 1.55 at 95% CI at [0.63–2.46]), tap water (OR = 29 at 95% CI at [20.89–38.70]), not maintaining latrines (OR = 2.37 at 95% CI at [0.62–3.78]), and maintenance of latrines by pupils (OR = 1.5 at 95% CI at [0.63–2.46]) were risk factors. This study shows a high prevalence of geohelmenthiasis among children of three primary schools in Moundou, Chad. Although males were more infected than female there was no significant difference between gender and geohelminth infections (p = 0.114). was no gender difference. Identified risk factors of geohelmenthiasis infections among the study population were: age between 9 and 13 years, school water consumption, the use of unmaintained latrines and latrines maintained by students. Surveillance of geohelminthiases and hygiene should be intensified to reduce the pathological risk related to these parasites in Chad.

Urinary Detection of COVID-19 Virus and its Implication in Urology Practice

Background: More than 25 crores of world population is affected by the pandemic corona virus SARS-CoV-2 since its first detection from Wuhan, china on December 2019. The widely accepted routes of human to human transmission for COVID-19 are through respiratory droplets and direct contact, however viral shedding in urine has been reported and infection transmission through infected urine remains a possibility. Objective of the study: To investigate the presence of COVID-19 virus in urine of infected patients and evaluate the probability of infection transmission through urine in different urological procedure. Methodology: After obtaining approval from institutional review board (IRB) of BSMMU this prospective cross-sectional observational study was conducted in the department of urology BSMMU from September 2020 to august 2021. Informed written consent was taken from the patients, the patients who are in ventilators legal guardian signed the consent form. After taking relevant history from the patients admitted in covid dedicated unit of BSMMU urine of the patients was collected in sterile container and with appropriate labeling and it was sent in virology department to detect the presence of SARS-COV-2 by quantitative real time polymerase chain reactions (RT-PCR). The date of covid 19 infection, date of urine sample collection, previous renal status, present renal function all were recorded. Results: Fifty patients were enrolled for investigation for detection of covid 19 virus in urine who were infected with SARS-COV-2. Thirty patients were male and Twenty were female. Male and female sex ratio was 3:2. We found the presence of SARS-COV-2 in urine of 2 patients, one male and one female. The rate of detection of SARS-COV-2 virus in urine of patients infected by covid 19 virus was 4%. Conclusion: Urinary detection of COVID-19 Virus was lower than oropharyngeal and rectal samples. Urological surgical intervention should be performed with caution considering the possibility of urine infection and possibility of COVID-19 transmission through this route. Sir Salimullah Med Coll J 2023; 31: 116-119

Frequency of Catheter-Related Bacterial Infection in End Stage Renal Disease Patients on Hemodialysis

Objective: To determine the frequency of catheter related bacterial infections among the patients on hemodialysis due to end stage renal disease.&#x0D; Study Design: Cross sectional study&#x0D; Place and Duration of Study: Department of Nephrology, Sharif Medical City Hospital, Lahore Pakistan, from 6 Months i.e.,Jun 2021 to Oct 2021.&#x0D; Methodology: After meeting the inclusion and exclusion criteria 171 patients were enrolled. Tips of the catheters were removed by the surgeon and transferred to laboratory in a sterile container, while at least two blood culture samples were taken before removing the catheter. Catheter related bacterial infections were noted.&#x0D; Results: In this study the most common catheter related bacterial infection in ESRD cases on hemodialysis was blood stream tunnel infection noted in 48.5% patients followed by, infective endocarditis noted in 28.1%, echo vegetation in 26.3% patients, tunnel infection in 25.1% and exit site infection in 23.4% patients.&#x0D; Conclusion: The most common catheter related bacterial infection in ESRD cases on hemodialysis was blood stream tunnel infection followed by, infective endocarditis, echo vegetation, tunnel infection and exit site infection patients.

Determining heavy metals in soil and water in a bioremediating area in Nkeleoken-Alode Eleme Community Rivers State.

The study aims at determining the concentration of heavy metals in soil and water undergoing bioremediation in the Nkeleoken-Alode community of Eleme Local Government Area, (p&lt;0.05) in the heavy metal concentrations Rivers State, carried out on both soil and aquatic between the test and control sites. The various sites undergoing bioremediation in the area. Soil and water samples were collected from three sites: unpolluted, polluted unremediated and polluted remediated sites. 50g of soil sample was collected using sterile aluminium foil, and water samples were collected in 250ml sterile containers. Samples were assayed using an Atomic Absorption Spectrophotometer which measures the concentrations of elements in a liquid sample. The absorption is proportional to the concentration of the elements present in the samples. Results showed a significant difference(p&lt;0.05) in the concentration of lead and chromium in soil samples from polluted remediated sites compared to soil samples from unpolluted sites and polluted unremediated sites. Arsenic, cadmium and nickel did not show a significant difference when soil samples from the polluted remediated site were compared to unpolluted and polluted unremediated sites(p&gt;0.05). Furthermore, there was a significant difference (p&lt;0.05) in the concentrations of cadmium, nickel and chromium in water samples, when water samples from the polluted and polluted unremediated sites. Lead and arsenic in water samples from polluted remediated sites did not show any significant difference (p&gt;0.05) when compared to unpolluted and polluted unremediated sites. The concentrations of heavy metals in the soil and water samples showed a significant increase (p&lt;0.05) in the heavy metal concentrations between the test and control sites. The various areas in the region that have been exposed to pollution pose a serious risk of heavy metal toxicity to occupants of the Niger Delta as a result of crude oil spillage. An immediate bioremediation strategy should be adopted in order the restore lost vegetation and aquatic life.

Study of the prevalence and antibiotics susceptibility patterns in clinically significant isolates among urine sample in a tertiary care centre

Urinary tract infections (UTIs) are prevalent bacterial infections. Gram-negative bacilli are frequently isolated as the causative pathogens in UTIs, and antibiotics are commonly used to treat them. However, the overuse of antibiotics has led to the development of resistance in some uropathogens. : To find the prevalence and antimicrobial susceptibility patterns in clinically significant isolates among urine sample in a tertiary care centre.: Fresh mid-stream urine samples were collected aseptically in sterile containers. The samples were inoculated on 5% sheep blood agar and MacConkey agar. The isolates were identified to the species level using biochemical tests/Vitek 2 compact.: A total of 5847 specimens were examined for significant bacteriuria, out of which 1160 showed bacterial growth in urine cultures. The most commonly isolated pathogens were (57.67%) and (18.63%). The antibiotics aminoglycosides (84%), carbapenems (79%), and nitrofurantoin (63%) displayed a high rate of sensitivity against these pathogens.: Due to the variability of drug sensitivity among bacterial pathogens over time, regular surveillance and monitoring are essential to provide physicians with updated information for the most effective empirical treatment of UTIs.

Poultry slaughterhouse wastewater as reservoirs for spreading extended-spectrum beta-lactamase-producing Escherichia coli in Abakaliki, Nigeria

Abstract. Ugbo EN, Jacob JI, Effendi MH, Witaningrum AM, Agumah BN, Ugbo AI, Moses BI. 2023. Poultry slaughterhouse wastewater as reservoirs for spreading extended-spectrum beta-lactamase-producing Escherichia coli in Abakaliki, Nigeria. Biodiversitas 24: 4960-4966. The emergence of antimicrobial and multi-resistance extended-spectrum beta-lactamase-producing organisms (ESBL) from the environment and hospitals is a serious global health concern. This research focused on the role of poultry slaughterhouse wastewater as a reservoir for spreading extended-spectrum beta-lactamase-producing Escherichia coli. Exactly 110 poultry slaughterhouses wastewater was collected using sterile universal containers from abattoirs in Abakaliki. The samples were analyzed microbiological for the presence of E. coli using standard techniques. The E. coli isolates found were subjected to a sensitivity test to antibiotics using the Kirby-Bauer disc diffusion method and further tested for ESBL-producing E. coli using a double disc synergy test and chromogenic media Brilliance ESBL agar. Of 110 wastewater samples analyzed, 55 (50.0%) were positive for E. coli contamination. The E. coli isolates showed antibiotic resistance ranging between 21.8% (amoxicillin clavulanic acid) to 69.1% (tetracycline), and good susceptibility was observed on cefepime (72.7%). Thus, among 55 E. coli isolates, 11(20.0%) were ESBL-producing E. coli with resistance patterns as follows: TET-STX-CAZ-CTX-FEP (four isolates); TET-STX-CAZ-CTX (four isolates); TET-STX-CAZ-CTX-FEP-CRO (three isolates), and average multidrug resistance index of 0.7. This study revealed that poultry slaughterhouse wastewater was a reservoir for multidrug resistance ESBL-producing E. coli. Therefore, properly treating wastewater from poultry production or farms before disposing into the drainage channel or water bodies is highly recommended to avoid spreading ESBL-producing organisms from animal waste products to humans and their environment.

Ultrastructural studies on implants failure with immediate or late loading

Objectives. The purpose of the present study was to evaluate by scanning electron microscope (SEM) and energy dispersive spectrophotometry (EDS), the degree of bone mineralization of the tissues on the surface of failure dental implants with immediate or late loading. Materials and method. In the study, 8 dental explants from 8 clinically healthy, non-smoking patients were taken. All implants were inserted by the same dental surgeon, 4 of them were immediate loaded and 4 were late prosthetically loaded by the same dentist. The ablation of the implants was performed as atraumatically as possible and they were collected in sterile containers and sent to the BIOMAT Research Center, where they were subjected to SEM and EDS analyses. The ratios between the chemical elements calcium and nitrogen (Ca/N), phosphorus and nitrogen (P/N), respectively calcium and phosphorus (Ca/P) were calculated for each of the 8 samples and were statistically analyzed. Results. If we compare the degree of coverage of the implants with bone tissue in different phases of mineralization, we find that the bone structures occupy a larger surface area of the implants in the cases with immediate loading compared to the cases with late loading. Thus, out of 4 immediately loaded implants, 2 were completely covered, one showed very little exposed areas, and the fourth showed alternating covered and uncovered areas. Regarding the late loaded implants, three showed alternation between covered and uncovered areas and only one was completely covered with bone. Conclusions. The degree of coverage of the explants with bone tissue was better represented for the immediate loading cases. The degree of mineralization of the bone tissue covering the explants was higher for cases with immediate loading. To confirm the obtained results, it is necessary to expand the study on larger batches of samples.

EVALUATION OF ANTIBACTERIAL POTENTIAL OF LICORICE AND XYLITOL CONTAINING SUCROSE FREE HARD CANDIES IN HIGH CARIES RISK PATIENTS

Objectives: To evaluate the effi cacy of sucrose-free hard candies containing xylitol and licorice for preventing dental caries in high-risk individuals. Materials and Methods: Total 80 participants were enrolled based on inclusion criteria. Participants were divided at random into four groups of twenty. Group A consumed stevia-sweetened hard candies including licorice extract, Group B consumed stevia-sweetened hard candies containing xylitol extract, Group C consumed stevia-sweetened hard candies, and Group D consumed sucrose-sweetened hard candies. For the fi rst ten days, participants were asked to eat 2 candies each day; saliva samples were collected at Day 0, after fourteen days following the baseline saliva collection, and after six months after the intervention. Each participant was asked to spit into a sterile plastic container until a suffi cient quantity (5ml) of un-stimulated saliva was collected. It took place between 9 and 10 a.m. For at least an hour before the saliva sample was taken, the individual was requested to abstain from all forms of oral care. The statistical analysis was done by SPSS version 20. Results: Eighty participants finish the experiment and follow the instructions. CFU and pH data for streptococcus mutans in saliva were done as experimental analysis. The mean percentage change in CFU of Streptococcus mutans (%) varied signifi cantly across hard candies over the course of each time period (baseline to fourteen days, P&lt;0.001; fourteen days to six months, P&lt;0.001; and baseline to six months, P&lt;0.001). There was a statistically signifi cant difference in mean salivary pH across various assessment periods within Base line to fourteen days (P&lt;0.001) and Fourteen days to six months (P=0.019) and Base line to six months (P&lt;0.001). The connection between bacterial count and salivary pH was found to be -0.142 (P=0.212) using Pearson's correlation coefficient. Conclusion: Licorice or xylitol extract are used to make sugar-free hard candies that are antibacterial, although the effect wears off with time. Hard candies without sugar have been proven to decrease cariogenic bacteria, while having an essentially neutral effect on pH.