SRSF2 Mutations Research Articles

Discovery of U2AF1 neoantigens in myeloid neoplasms

BackgroundMyelodysplastic syndromes (MDS) arise from somatic mutations acquired in hematopoietic stem and progenitor cells, causing cytopenias and predisposing to transformation into secondary acute myeloid leukemia (sAML). Recurrent mutations in spliceosome...

Nine-Gene Prognostic Signature for Myelodysplastic Syndrome

Abstract Introduction/Objective Myelodysplastic Syndrome (MDS) is a family of clonal hematopoietic malignancies found frequently in the seventh and eight decades, supporting that aging and acquired somatic mutations drive development of the disease. Without a cure, the prognosis is poor. Patient consideration for bone marrow transplantation remains low (<5%), and enrollment in clinical trials is slightly better (25%). Information regarding MDS-specific whole genome sequencing, a prognostic prediction system, and overall survival is limited and may be beneficial in developing curative therapies. Hence, we aimed to analyze the genomic profile, epidemiology, and overall survival of MDS. Methods/Case Report We utilized cBioPortal cancer genomics [The Cancer Genome Atlas (TCGA) PanCancer Atlas, TCGA Firehose Legacy, and TCGA Nature 2013] to study the mutations associated with MDS. Epidemiological characteristics and genetic profiles available on cBioportal were evaluated. Gene mutations with the most statistically significant, shortest overall survival and survival in days were used for the gene query, and survival rate with the common mutations was calculated. Logrank test and Kaplan–Meier estimators were used in analyzing the survival function. Patients with two or more overlapping mutations were excluded. Results (if a Case Study enter NA) We identified 7,554 patients with MDS out of which 2,852 had a primary MDS. There were 3,323 patients who had gender and age data available. 26.5% were male, and most patients (600) were between the ages of 70-75 years. 1573 (20.8%) were alive and 1600 (21.2%) were deceased. The common mutations associated with reduced survival were ASXL1, NPM1, FLT3, TET2, SF3B1, SRSF2, STAG2, RUNX1, TP53. Median survival of patients with these mutations was 32.02, 27.32, 25.97, 64.21, 80.94, 46.82, 44.28, 16.21, and 10.52 months respectively in comparison with the unaltered mutation group (68.68) (p < 0.0001). Survival was lowest amongst TP53 10.52 months and RUNX1 16.21 months. Leukemia free survival with ASXL1, NPM1, FLT3, TET2, SF3B1, SRSF2, STAG2, RUNX1, and TP53 mutations was 27.88, 13.02, 23.44, 56.52, 79.96, 37.32, 24.89, 14.86, and 9.44 months respectfully in comparison to the unaltered mutation group (68.68) (p < 0.0001). Conclusion Our study found that TP53 and RUNX1 genes were associated with the worst prognosis in MDS with median survival of 10.52 and 16.21 months, respectively. This study may provide insight for genetic predictors and targeted therapies for MDS, as well as provide better understanding of patient prognosis.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Molecular and Cytogenetic Evaluation in Systemic Mastocytosis

Systemic mastocytosis (SM) is a rare hematological neoplasm characterized by pleomorphic symptoms, related to mediators release from pathological mast cells. Tissue infiltration of liver, spleen, gastro-intestinal (GI) tract and osteolysis are present in aggressive disease. As KIT D816V mutation can be found in approximately 80% of patients, several additional somatic mutations of prognostic significance have been detected in a subset of patients. We report on clinical, cytogenetic and molecular characteristic of 160 patients with SM diagnosed in the last 15 years at our center. Fourteen (8.9%) patients had cutaneous mastocytosis, 85 (53.5%) had indolent SM (ISM), 12 (7.5%) had smoldering SM (SSM), 27 (17%) had aggressive SM (ASM), 17 (10.5%) had SM with an associated hematological neoplasm (AHN-SM) and 1 (0.6%) had mast cell leukemia. Symptoms were mostly related to mediators release: itching and blistering (69, 43%), anaphylaxis (49, 30%), diarrhea/bloating (19, 12%), osteoporosis/bone fracture (10, 6%), constitutional symptoms (8, 5%), bone pain and myalgia (16, 10%), anaphylaxis from Hymenoptera venom (24, 15%). While SM patients were mostly treated with antihistamines and membrane stabilizers, 29 patients needed a disease modifying therapy. Four patients with ISM were treated with Interferon (IFN) for bone lytic alterations, while 1 patient with ISM started midostaurin for uncontrolled symptoms. Other 11 patients with ASM were treated with midostaurin: 4 responded, while 7 needed multiple lines of therapy including allogeneic transplant in 4 cases. Eleven patients with ASM were treated with tyrosin kinase inhibitors (TKI) before midostaurin became available, while 2 elderly patients were treated with low dose cytarabine and TKI for concomitant acute leukemia. KIT D816V mutation was found in 111 of 131 (85%) evaluable patients with SM. Cytogenetics was normal in all but 2 patients with AHN-SM in which a chromosomal gain was reported. Among 6 patients with ISM, KIT mutation was found in only 2 cases. One patient had isolated KIT mutation and was treated with IFN for skin symptoms and bone fracture, and another patient had a DNMT3A associated mutation and was treated with imatinib. Moreover, 1 patient presented both DNMT3A and TET2 mutations and was treated with IFN for bone fracture. Among 12 ASM patients, 1 was negative for significant mutations: no disease control was achieved after target therapy, and bone marrow function slowly recovered after allogeneic transplant. The most frequently recorded mutations were SRSF2 and TET2: they were present in 4 patients each and recorded together in 3 cases. Two patients with SRSF2 and TET2 mutations died after multiple lines of therapy: 1 patient for infection and graft versus host disease after allogeneic transplant and 1 for progressive disease. Moreover, the latter had additional RUNX1 mutation. Two patients with concomitant SRSF2 and IDH1 mutations and TET2 mutation respectively responded to midostaurin, while 1 with DNMT3A mutation received multiple lines of therapy and died for pneumonia. One patient with ASXL1 mutation responded to chemotherapy after 2 previous lines of treatment. Among 4 patients with isolated KIT mutation, 2 responded to midostaurin, 1 obtained a partial control of symptoms after 4 lines of treatment and 1 suddenly died after achieving stable disease after 2 lines of therapy. Among 3 patients with SM associated to myelodyplastic syndrome, 1 was negative for KIT but positive for TP53 mutations and died for natural event after symptoms directed therapy and continuing recombinant erythropoietin. The other 2 KIT positive patients presented multiple concomitant mutations. Additional TET2 and SRSF2 mutations were recorded in a patient who died few weeks after diagnosis, while additional TET2, SRSF2, RUNX1 and KRAS mutations were recorded in a patient treated with midostaurine and 2CDA before successful allogeneic transplant. Molecular characterization of SM has uncovered a complex landscape of somatic mutations other than KIT D816V. Although the prognostic significance of some recurrent mutations has been reported, prospective correlation with clinical response may highlighted their role in the pathogenesis of disease and possibly elucidate mechanism of resistance to treatment. On the other hand, cytogenetics might no be considered mandatory except for AHN-SM

Pre-Transplant Somatic Co-Occurring Mutations (by next generation sequencing) in Acute Myeloid Leukemia: Frequency and Impact on Clinical Outcomes after Allogeneic Hematopoietic Cell Transplantation - a Large Study on Behalf of the EBMT Acute Leukemia Working Party

Background: Acute myeloid leukemia (AML) is a very heterogeneous hematological malignancy, which includes numerous genetically defined subsets. The genomic classification of AML with the identification of mutations in transcription factors, epigenetic modifiers, spliceosome, cohesin complex, and signaling pathways has led to a more accurate risk stratification model. The main genetic aberrations included in the European LeukemiaNet (ELN) 2022 classification are NPM1 (risk group according to karyotype and FLT3-ITD status), FLT3-ITD (intermediate risk), bZIP in-frame mutated CEBPA (favorable risk), and RUNX1, ASXL1, BCOR, EZH2, RUNX1, SF3B1, SRSF2, STAG2, U2AF1, ZRSR2 and TP53 mutations (all belonging to the adverse risk group). In the context of allogeneic hematopoietic stem cell transplantation (allo-HSCT), the frequency and prognostic value of different gene-gene interactions has not been studied and may differ from that of patients treated with chemotherapy alone. We aimed at evaluating, through the European Society for Blood and Marrow Transplantation (EBMT) database, the frequency and impact of different recurrent somatic mutations, either alone or in association, on prediction of relapse and survival in patients receiving allo-HSCT. Methods: This is a retrospective, registry-based, multicenter analysis from the EBMT with the approval of the EBMT Acute Leukemia Working Party. Adult patients aged more than 18 years with a diagnosis ofAML who received an allo-HSCT between 2013-2022, with an available genetic profile determined at diagnosis by next generation sequencing (NGS) were included. Results: We identified 836 allografted AML patients who had NGS performed at diagnosis. Most of these patients had de novo AML (88%), with a median age of 53 years (range: 18-78 years). Karyotype was favorable in 7%, intermediate in 69% and adverse in 24% of patients. At transplant, 74% of patients were in first remission (CR1) and 13% in CR2. The most frequent detectable mutations by frequency were DNMT3A (33%), FLT3 (29%), NPM1 (29%), TET2 (28%), NRAS (23%), RUNX1 (22%), WT1 (22%), BCOR (19%), ASXL1 (17%), IDH2 (17%), IDH1 (15%), SRSF2 (13%), STAG2 (12%), CEBPA (11%), TP53 (10%), KRAS (10%), and PTPN11 (10%) . By multiple correspondence analysis, two independent groups of co-occurring mutations were identified, the first group included DNMT3A, NPM1 and FLT3, the second group included ASXL1, SRSF2 and RUNX1. Outcome analysis was performed on the subset of 298 patients allografted in CR1 with available data for the aforementioned six genes ( DNMT3A, NPM1, FLT3, ASXL1, SRSF2 and RUNX1). Most of these patients had de novo AML (90%), with a median age of 53 years (range: 19-75 years). Patients received primarily reduced intensity conditioning (58%) and peripheral blood stem cells (93%) from matched sibling donors (35%), matched unrelated (28%), and haploidentical donors (21%). Seventy percent of these patients had intermediate-risk cytogenetics, while 27% were classified as adverse-risk. Median follow up calculated by the reverse Kaplan-Meier method was 2.5 years. Overall, the 2-year relapse incidence (RI), leukemia-free survival (LFS) and overall survival (OS) were 24%, 62% and 69%, respectively. When outcome analysis was performed according to the presence or absence of single mutations, none of the six mutations significantly affected RI or LFS. The 2-year OS was positively affected by the presence of NPM1 mutation (78% vs 66%; p=0.02) and FLT3 (79% vs 65%, p=0.01) but not significantly affected by the other 4 mutations. When mutations were investigated in groups, the 2-year RI, LFS and OS were 24%, 70% and 78%, respectively, for patients with NPM1 mutation regardless of other co-mutations, 35%, 56% and 69% for patients with FLT3-ITDand/or DNMT3A mutation, wild type NPM1, regardless of other co-mutations, 17%, 70% and 74% for patients with RUNX1 and/or ASXL1 and/or SRSF2 mutation without FLT3-ITD and with wild type NPM1 and wild type DNMT3A and 20%, 56% and 61% for patients with all six genes unmutated. Conclusion: NGS at diagnosis can be extremely useful in risk stratification of AML patients undergoing allo-HSCT, potentially allowing adequate post-transplant interventions. Notably, the 2-year LFS of 70% for patients harboring RUNX1 and/or ASXL1 and/or SRSF2 mutation indicates that allo-HSCT can overcome the adverse risk associated with these somatic mutations at diagnosis.

Predicting the Clinical Course of Treatment with Midostaurin in Patients with Advanced Systemic Mastocytosis

Introduction: Advanced systemic mastocytosis (AdvSM) is characterized by presence of the KIT D816V mutation and variably other somatic mutations in the mast cell but also non-mast cell lineages, e.g. monocytes or eosinophils, in ≥80-90% of patients. Midostaurin is an approved multikinase/KIT inhibitor for treatment of AdvSM. The intricate landscape in assessment of response, resistance or progression, the occurrence of adverse events with its impact on dose modification and the recent approval of the specific KIT D816V inhibitor avapritinib contribute to complex decision-making. We here sought to characterize the most valuable baseline and on-treatment parameters for prediction of response and survival in midostaurin-treated patients with AdvSM. Methods: On basis of the ´German Registry on Disorders of Eosinophils and Mast Cells' (GREM), this retrospective-prospective analysis included 79 patients with AdvSM. Treatment was initiated between 2009 and 2022 accumulating into a 239 patient-years overall follow-up period. In addition to common serological, morphological, and molecular response parameters, we specifically examined the recurrent observation of an early flare-up in alkaline phosphatase (AP) levels, which was defined as a ≥25% AP increase within three months after treatment initiation, followed by a subsequent decline below baseline within six months. Results: Midostaurin was used in first-line (1L) or second and further lines (2L+; median 1 prior treatment line, range 0-4) in 63 (80%) and 16 (20%) patients, respectively. In 1L/2L+, median overall survival (OS) was 2.6/2.4 years. At baseline, the presence of additional somatic mutations in SRSF2 (n=36, 46%, HR 2.0 [1.2-3.6], P=0.014), ASXL1 (n=15, 19%, HR 2.0 [1.0-3.9], P=0.043), and EZH2 (n=6, 8%, HR 4.3 [1.7-11.3], P=0.003) significantly stratified patients according to their hazard ratio-weighted risk (median OS, 5.8 vs. 2.9 vs. 1.0 years; P<0.001). In 25 evaluable patients, the variant allele frequency in 72 additional somatic mutations remained stable (mean change 8%, absolute change >5% in 16/72 (22%) mutations). New mutations were identified in 9/25 (36%) patients during follow-up (Figure). Durable responses (complete, partial, clinical improvement) according to modified Valent criteria, IWG-MRT-ECNM criteria or Pure Pathological Response (PPR) criteria over a median duration between 12 and 24 months were achieved in 60%, 29% and 13% of patients, respectively. Within the first 12 months, duration of response was associated with an OS benefit ( P<0.001). An AP flare-up was observed in 22/79 (28%) patients, was paralleled by contemporaneous decrease of serum tryptase (median -35%, range -82 - 191%) and resulted into improved OS (median 5.8 vs. 2.2 years, P=0.007). Multivariable analysis identified the AP flare-up ( P=0.029), a ≥25% reduction of bone marrow (BM) mast cell (MC) infiltration ( P=0.046) and a ≥25% reduction of the KIT D816V expressed allele burden (EAB; P=0.034) at any time within the first 6 months as independent markers for improved OS (Table). Dynamic risk assessment of the independent parameters during follow-up allowed to abrogate a negative baseline risk-categorization. The initial dose was 200 mg/d (100 mg BID, including patients with a prespecified rapid dose escalation), 150 mg/d or 100 mg/d in 63/79 (80%), 2/79 (3%) and 14/79 (18%) patients, respectively. In the combined 150 mg and 100 mg cohorts, a dose increase to 200 mg/day was achieved in 9/16 (56%) patients. The 200 mg could be maintained at month 3, 6, 12, 24, and 36 in 50/63 (79%), 30/48 (63%), 23/34 (68%), 15/22 (68%) and 9/9 (100%) patients, respectively. Overall, 96 adverse events (AE) led to dose-adjustment (including temporary or permanent discontinuation). Hematologic and nonhematologic toxicities accounted for 24 (25%) and 36 (38%) of AEs with neutropenia (n=8, 8%) and nausea/emesis (n=22, 22%) being the most common AEs leading to dose-adjustment. Of note, the various dose levels had no impact on response or survival. Conclusions: Baseline mutations in SRSF2, ASXL1 and EZH2 conferred resistance to midostaurin. The various dose levels had no impact on response or survival. The on-treatment parameters AP flare-up, and a ≥25% reduction of BM MC infiltration and of KIT D816V EAB abrogated a negative baseline risk-categorization. No new safety signals occurred.

Somatic Mutations and DNA Hypermethylation at Enhancers and Promoters Identify Distinct Subtypes within Lower-Risk Myelodysplastic Syndromes

Myelodysplastic syndromes (MDS) are a group of heterogeneous disorders caused by the accumulation of somatic mutations in the hematopoietic stem and progenitor compartment. Besides del(5q), SF3B1 or TP53 mutations, referred to as defining genetic abnormalities, mutation patterning hardly structured the classification of MDS. Mutations in epigenetic factors occur early in the development of clonal hematopoiesis leading to precocious alterations of DNA methylation implicated in oncogenesis. Convergent DNA methylation patterns related to both mutations and microenvironment imprinting may induce specific gene expression profiles and contribute to phenotypic variations. To refine a pathophysiological classification of lower-risk MDS, we combined genetic profiling to DNA methylation and transcriptome data. Methods: We enrolled 543 lower-risk treatment-naïve MDS patients at diagnosis and performed DNA-sequencing of 24 genes. DNA methylation and RNA-sequencing data were generated in a representative subset of 175 cases with available material (75 MDS-SLD/MLD, 40 MDS-EB1, 53 MDS-RS-SLD/MLD, 5 MDS del(5q), 2 MDS-U) and 7 age-matched healthy controls. IPSS-R was very low, low or intermediate in 87.4%. During a median follow-up of 2 years, 16% of MDS cases progressed to AML (MDSp). Infinium EPIC 850K array allowed after filtering the examination of methylation of 723,612 CpG sites with enrichment at enhancers and promoters. Differentially methylated regions with differentially methylated CpG sites (DMR-CpG) between cases and controls were defined with a minimum of 2 probes, a Benjamini-Hochberg-adjusted P-value cut-off of 0.05, a false discovery rate of 0.001 and a mean Δβ-value >20% at CpG sites. Consensus motifs for transcription factors were identified using Homer. Results: Unsupervised clustering on genetic profiling of 543 patients identified distinct subsets of lower-risk MDS with different clinical features: one cluster (group A) was enriched in del(5q), three clusters were characterized by SF3B1 mutations, either isolated (group B) or associated with DNMT3A (group E) or TET2 (group F), while the two remaining clusters were enriched in either complex pattern of mutations (group C) or SRSF2 mutations (group D). Genetic clusters showed significantly different clinical outcomes, clusters C, D and E having lower overall survival and higher risk of progression to high risk MDS or AML compared to other clusters. In the subset of 175 cases, a total of 2,953 unique DMR-CpGs allowed a robust repartition of patient samples in 4 groups using the k-means method. The 4 methylation groups were clinically distinct in terms of age, hemoglobin, neutrophils, monocytes, platelets, BM blasts, WHO classification, IPSS-R, and mutation pattern. A significant correlation was found between genetic and methylation groups ( P<0.001). Hypomethylated CpGs defined group 4 which was enriched in MDS-RSwith low blast count and few co-mutations, while groups 1 and 3 demonstrated hypermethylated profiles driven by TET2/ IDH1-2 mutations and TET2/ SRSF2 mutations, respectively. TET2-mutated cases exhibited an increased proportion of hypermethylated DMR-CpGs at enhancers (DME) significantly enriched in C/EBP and ETS family transcription factor motifs. In MDS without evidence of progression, we identified 1,418 DME and their gene targets of which those significantly deregulated in RNA-seq were involved in the control of translation and response to TGF-β. By contrast, in MDS with rapid progression to AML, DMR-CpGs were significantly enriched at CpG islands and promoters ( P<0.0001) and a set of 10-20 genes downstream of these promoters were specifically deregulated. Conclusion: Somatic mutations and DNA methylation at enhancers and promoters identify distinct subsets of lower-risk MDS with different clinical behavior. Hypermethylation at enhancers with C/EBP or ETS family motifs is a hallmark of MDS and may account for changes in transcription factor recruitment and cell fate. Hypermethylation of promoters with downstream effects on gene expression may indicate a propensity to rapid evolution to AML.

Poor Prognosis of SRSF2 Gene Mutations in Patients Treated with Venetoclax-Azacitidine (VEN-AZA) for Newly Diagnosed Acute Myeloid Leukemia. a Multicentric Real-Life Study of 117 Patients

Introduction Spliceosomes are complexes composed of small nuclear RNA that remove introns in protein-encoding genes. Spliceosome mutations ( SRSF2, SF3B1, U2AF1, ZRSR2), are encountered in ∼50% of secondary AML cases. Splicing mutations (splice-mut), in particular SRSF2, correlate with inferior outcomes to standard induction therapy. A recent report in a cohort of 119 patients, of whom 33 had splice mutations and 24 were SRSF2 mutated, reported the lack of impact of splice-mut on prognosis of AML patients treated upfront with Hypomethylating agents (HMA) + VEN in clinical trials (Lachowiez, C. A. et al Blood Adv. 2021). Aims We aimed to assess the impact of splice-mut in a population of patients with newly diagnosed acute myeloid leukemia (ND-AML), treated with VEN-AZA. Methods We performed a retrospective multicentric study including patients treated in three French centers in Marseille (Institut Paoli-Calmettes, CHU La Conception) and Nice (Hôpital L'Archet). Inclusion criterias were ND AML adult patients treated with VEN (7 to 28 days per cycle) and AZA at conventional doses. Next Generation Sequencing (NGS) was performed at diagnosis and was available for all patients. Data were collected from patients' electronic medical records. Statistical analyses were performed using GraphPad Prism v9.5.1 Results We included 117 ND-AML patients (median age = 75 yo; range, 32-89) treated with VEN-AZA between October 2019 and March 2023. The five most frequently mutated genes in the whole cohort were TET2, ASXL1, TP53 and RUNX1in thirty-seven (32%), 36 (31%), 32 (27%) and 31 (26%) patients, respectively. Thirty-four patients (29%) had a mutation in at least one of the spliceosome genes (=Splice-mut), including 20 (17%), 11 (9%), 4 (3%) and 1 (1%) mutations in SRSF2, U2AF1, SF3B1 and ZRSR2, respectively (Fig.1). Median variant allele frequency (VAF) was 42%, 43% and 26% for SRFS2, U2AF1 and SF3B1 respectively. Secondary AML was found in 18 (53%) of the splice-mut AML and 21 (25.3%) of the splice-wt AML groups of patients. Prior HMA was given in seven (20.6%) patients in the splice-mut versus 6 (7.2%) in the splice-wt cohort. Complex cytogenetics was identified in 7 (20.6%) patients in the splice-mut cohort and 28 (33.7%) in the splice-wt cohort. We found a TP53 mutation in 17.6% and 31.3% of splice-mut and wt cohorts, respectively. Best overall response rate (= CR, CRi and MLFS) was 72.6%; with CR, CRi and MLFS observed in 63 (54%), 16 (14%) and 6 (5%) patients, respectively. We did not find any difference in response rate between the splice-mut (=73.5%) and splice-wt (72.3%) AML. Prior treatment with hypomethylating agents and TET2 mutation were the only factors significantly associated with lower response rates (42% vs 82%, p=0.004, and 64% vs 85%, p=0.025, respectively), while IDH2 mutation was predictive of a better response (100%vs 75%, p=0.037, OR: 9.9 [CI 95% 0.57-173]). Median overall survival (OS) and leukemia-free survival (LFS) for the whole cohort was 10.8 and 7.1 months, respectively. In multivariate analysis taking into account TP53 and/or del17p, NRASmut and/or FLT3-ITD, IDH2mut, complex karyotype, and SRSF2, the only factors predicting OS and LFS were mutations in TP53 and SRSF2 genes. Patients mutated for SRSF2 had a 4.8 months OS and a 5 months LFS compared to 11.3 and 8 months, respectively (p=0.034 and p=0.037), comparable with TP53mut AML patients ( Fig.2). Conclusions SRSF2mut seems to be predictive of a worse survival in ND AML treated with VEN-AZA. This finding warrants further exploration in larger cohorts.

Efficacy of Demethylated Drug Combine with Low Dose Chemotherapy in Juvenile Myelomonocytic Leukemia

Objection：Juvenile myelomonocytic leukemia (JMML) is a rare pediatric leukemia with a median survival time of less than 2 years. Currently, hematopoietic stem cell transplantation (HSCT) is the only possible cure of JMML. Most of the newly diagnosed pediatric patients with JMML have high tumor burden, and rapid disease progression, and may not tolerate HSCT. In the present study, we aimed to explore the effection of Demethylated drug in combination with low-dose chemotherapy on JMML patients before HSCT. Methods：A retrospective analysis of 16 JMML patients was performed from Jul 2017 to Nov 2021. All patients were given Demethylated drug in combination with low-dose chemotherapy, 10 patients decitabine at a dose of 20 mg/m2 for 5 days, supplemented with cytarabine (50-100 mg/m2×3~5 days), and /or etoposide (50 mg/m2×3~5 days), 6 patients Azacytidine at a dose of 75mg/m2 for 7 days combined with homoharringtonine 2mg/m2 for 5-7 days. Each treatment interval was 4 weeks, bridging to HSCT after three~four courses of treatment. Results：The median age of onset of the 16 JMML patients was 36 months (range 6-51 months), the male to female ratio was 14:2, and the median volume of the spleen at diagnosis was 357cm3 (range: 175-588) by Three-dimensional ultrasound of spleen. The median white blood cell (WBC) count was 39 (range 2-128) × 109/L, the median hemoglobin 84 (range 47-110) g/l, and the median platelet 36 (range 16-75) × 109/L，the median monocyte count was 8 (range 2-26) × 109/L at diagnosis, the median RDW-CV was 19 (15-30)%, the median RDW-SD 56 (45-77) fl, the median HbF 37(1-76)%. Chromosome was performed, of which 13 cases had normal karyotype. 2 cases had tirsomy 8, 1 case had structural abnormality in chrosome 9. Next-generation sequencing results showed that 11(68.8%) cases carried PTPN11 mutations, 6 (37.5%) cases NF1 mutation, 5 (31.3%) KRAS mutation, 4 (25%) NRAS mutation, 1 case without one of the Ras pathway genes. 8 cases (50%) had more than two types of canonical JMML mutations, among them 6 cases (75%) had PTPN11 and NF1 co-mutation. 10 cases had secondary gene mutations, 3 (3/10) cases JAK3 mutation, 2 (2/10) SETBP1 mutation, 2 (2/10) SH2B3 mutation, 2(2/10) ASXL1 mutation, 2 (2/10) ARID1A mutation, 1 (1/10) SRSF2 mutation. The median treatment course was three cycles (range: 1-6), and the response rate was 68.8% (11/16) after one cycle and 81.8% (9/11) after three cycles. One case achieved complete remission (CR) after four courses of therapy. The WBC and monocyte counts were significantly decreased after treatment (P<0.001), and the spleen volume showed a decreasing tendency. Eleven patients received HSCT, 9 cases were implanted successfully and 2 cases failed, of which 1 case was relieved by secondary transplantation and 2 patients died of grade IV graft-versus-host disease (GVHD) after transplantation. The median follow-up time was 31 months. The 2-year progression-free survival rate was 75.0±10.8%. Conclusions：Demethylated drug in combination with low-dose chemotherapy could reduce JMML patients' tumor burden, improve the general condition, and obtain a clinical response rate of 81.8% after 3 cycles therapy. Therefore, such a combination regimen could be used as a therapeutic option for JMML before HSCT.

Cellular Interactions within Clonal Dendritic Cell Aggregates Drive Immune Tolerance in Chronic Myelomonocytic Leukemia Bone Marrow Microenvironment

Introduction: Clonal dendritic cell (DC) aggregates in chronic myelomonocytic leukemia (CMML) are seen in approximately 20-30% patients at diagnosis. Previously, these were thought to be comprised of CD123+ plasmacytoid DCs but our data has suggested that these are heterogenous and comprise of myeloid DCs, monocytes, and myeloid-derived suppressor cells. Furthermore, these aggregates uniformly express immune checkpoints such as indoleamine 2,3-dioxygenase-1 (IDO), associate with an IDO-specific systemic impact (increased trytophan catabolism), and expanded regulatory T cell population in CMML, suggesting a role in inducing immune tolerance. DC aggregates are also associated with increased risk of acute myeloid leukemia (AML) transformation and resistance to hypomethylating agents, highlighting that they are important for disease progression in CMML (Mangaonkar A et al. Blood Adv 2020). We performed this study to decipher the architecture of a CMML DC aggregate to understand the complex inter-cellular interactions, and assess their impact on the adaptive immune system. Methods: In this study, we used archival fresh-frozen paraffin-embedded (FFPE) bone marrow biopsy specimens obtained from CMML patients, and isolated monocytes (CD14+ magnetic bead sorting) and lymphocytes (CD14-ve fraction) from untreated CMML and age-matched normal control (NC) peripheral blood mononuclear cells (PBMCs). DCs were cultured from monocytes using a commercial protocol. Spatial architecture of the CMML BM microenvironment was interrogated through multiplex imaging of FFPE samples by co-detection by indexing (CODEX) using 30 markers (CCR6, CD107a, CD11c, CD20, CD21, CD31, CD3e, CD4, CD44, CD45, CD45RO CD56, CD68, CD8, E-Cadherin, FoxP3, HLA-DR, CD14, CD16, CD11b, CD33, CD15, CD66b, CD123, CD303, CD34, CD163 and IDO). Single-cell transcriptomic signatures were analyzed using the 10X single cell Fixed RNA profiling platform, and validated using bulk RNA seq (Illumina stranded mRNA prep) from isolated and cultured cells. Impact of DCs on lymphocytes was assessed via autologous mixed DC-T culture experiments. Results: BM FFPE samples from 5 CMML cases (3 with DC aggregates) were included for multiplex imaging via CODEX. Results confirm the significant interactions of CD8+ and CD4+ T cells with CD123+/HLA-DR+ DCs within a CMML DC aggregate (Fig. 1A). Upon quantitative assessment of cell-cell interactions, IDO+/CD8+T ( P=0.006), IDO+/MDSC ( P=0.005), and IDO+/macrophage ( P=0.001) interactions were significantly increased in CMML samples with versus without DC aggregates . Specific findings were validated using single-stain immunohistochemistry and multiplex immunoflourescence staining. Next, in order to assess transcriptomic signatures within BM at the single-cell level, we chose two cases; CMML (BM aspirate blast% 1, WBC 49.6 x 10 9/L, ASXL1/GATA2/SETBP1/SRSF2 mutations) and AML transformed from CMML (BM aspirate blast% 81, WBC 152 x 10 9/L, NPM1/DNMT3A/TET2 mutations). Approximately, 10,000 cells were obtained and analyzed with cell type annotation through human PBMC reference (Azimuth). Results show an expanded regulatory T cell population in AML compared to CMML (UMAP plot, Fig. 1B), suggestive of immune tolerance. In order to validate findings and perform functional experiments, we used sorted monocytes and cutured DCs from CMML and NC. DC phenotype was confirmed both through visual inspection and flow cytometry, and clonality was confirmed through Sanger sequencing (for previously identified mutations). Differential gene expression analysis through bulk RNAseq showed significant differences between CMML and NC lymphocytes with immunoinhibitory receptor, LILRB2 (log2fold change=7.05, adjusted P=0.0002) being one of the top five significantly upregulated genes, further confirming immune tolerance. Finally, mixed autologous DC-lymphocyte reaction (1:4 ratio) experiments demonstrated that DCs induce T cell tolerance in CMML (expansion of exhausted PD1/TIM3/LAG3+ CD8 T cells) when compared to NC. Conclusion: Clonal dendritic cell aggregates within the CMML bone marrow microenviroment interact with T cells and induce immune tolerance. This represents a novel mechanism of disease progression in CMML with potential therapeutic targets (IDO, LILRB2, and/or CD123).

Survival Outcomes Associated with Molecular and Cytogenetic Alterations in AML Patients Treated with Hypomethylating Agent and Venetoclax

Molecular profiling has improved prognostication and helped identify novel therapeutic targets in AML. Nonetheless, it has also created a complex web of molecular profiles and cytogenetic abnormalities and in many cases it remains unclear which specific alterations primarily drive leukemogenesis. We sought to review our patients (pts) treated with a hypomethylating agent (HMA) + Venetoclax (Ven), to evaluate molecular and cytogenetic profiles with their associated outcomes. We identified 142 pts with AML treated with HMA + Ven at Northwell Health between January 2019 and December 2023. Through retrospective chart review, we obtained patient and disease characteristics, treatment regimens, clinical outcomes as well as molecular and cytogenetic profiling (using commercial AML panels) prior to the initiation of HMA + Ven. Bone marrow biopsy pathology reports were reviewed to identify the subtype of AML and grouped into De novo AML, AML with MDS related changes (AML-MRC) and therapy-related AML (t-AML). Median relapse free survival (mRFS) and median overall survival (mOS) in months (m) as defined by ELN 2022 (Dohner et al, Blood 2022), were estimated with Kaplan-Meier curves and compared utilizing log-rank testing. T-test was used to evaluate significant differences between categorical data. Of the 142 pts identified, the median age was 77. The majority of patients had adverse (n = 99) or intermediate risk (n = 31) genetics as defined by the 2022 ELN genetic risk classification. The overall response rate (ORR) was 42% with mOS of 9.6m. AML-MRC patients (n=80) had mOS of 9.1m and mRFS of 11.6m with 61 pts receiving HMA + Ven as frontline treatment. 47 pts with De novo AML had mOS of 13.4m and mRFS of 16.1m with 36 pts receiving HMA + Ven as frontline therapy. Only 15 pts had t-AML with mRFS of 12.3m and mOS of 8.8m with 10 pts receiving HMA + Ven as frontline therapy. There was no significant difference in mRFS or mOS between these groups, although there was a trend favoring De novo AML. 47 different molecular alterations were identified among the 142 patients. Figure 1 illustrates outcomes associated with the 16 most prevalent molecular alterations found in our AML population. Mutational burden was similar between AML types (2.7 vs 3.0 vs 2.4 mutations per pt). De novo AML was associated with an increased mutation burden in signaling molecules (60%) and transcription factors (47%) compared to AML-MRC (29%, 31%). AML-MRC had a higher occurrence of mutations in epigenetic regulatory genes (79%) and splicing factors (31%) compared to De novo AML (55%, 19%). Mutations in splicing factors were associated with a significant increase in both mRFS and mOS(p = 0.01) compared to pts without mutations. Pts with DNMT3A, NPM1 or SRSF2 mutations had the highest ORR to HMA + Ven (63%, 64% and 63% respectively). RUNX1, TP53, complex cytogenetics and del 7q were associated with worse ORR (46%, 36%, 46% and 42% respectively) as well as decreased mOS. SRSF2, mutated in both AML-MRC and De novo AML, not only had an elevated ORR, but improved mRFS and mOS. Contrarily, mRFS and mOS were not significantly improved despite the high ORR in DMT3A mutated pts. DNMT3A was mutated most often in AML-MRC and was associated with a higher rate of other epigenetic regulatory gene co-mutations. The same is true for patients with KMT2A mutations (ORR 50%, mOS 2.8m, mRFS 6.1m) which suggests ineffectiveness of HMA+ Ven in maintaining remissions with this alteration with possible early selection for resistant clones. RUNX1 mutations were associated with an improved mRFS (16.1m) despite lower mOS (8.8m). NPM1 mutations had the highest mRFS of 34.4m. The survival advantage may be secondary to the absence of adverse cytogenetics in 88% of these pts. IDH2 mutations was associated with a significantly improved mOS compared to unmutated IDH2; however this may be confounded by the use of an IDH2 inhibitor at relapse. Our review of molecular alterations in AML pts identified several molecular alterations such as SRSF2, DNMT3A, RUNX1 which we found to be associated with favorable responses when treated with HMA + Ven. In addition, we demonstrated that NPM1 mutation remains favorable in patients treated with HMA + Ven. Our findings help contribute to the ever-growing, complex molecular and genomic profiling of AML patients.

The Significance of Variant Allele Frequency in SF3B1 Mutated Myelodysplastic Neoplasms/Syndromes

Introduction: Recent iterations of the World Health Organization (WHO) and international consensus classification (ICC) guidelines for myelodysplastic neoplasms (MDS) refined disease defining characteristics through incorporation of morphologic and genetic criteria. Despite these welcome updates, discrepancies between the WHO and ICC remain, particularly with respect to variant allele frequency (VAF) threshold in disease defining mutations such as SF3B1 and TP53. We evaluated patients with SF3B1-mutated MDS, a specific molecular class of MDS in both classification schemes , providing additional biologic and survival information to inform both diagnosis and prognosis. Methods: We queried the International Working Group for Prognosis in MDS (IWG-PM) cohort of adult (age ≥ 18 years) patients (pts) with MDS (N= 3,323; Bernard et al. NEJM Evidence 2022) for baseline clinical demographic, cytogenetic and molecular information, and clinical outcomes. SF3B1 VAF was assessed using targeted next generation sequencing. Demographics were analyzed using descriptive statistics. Between group differences were assessed using the Wilcoxon rank-sum test or Fisher's exact test as appropriate. Time to event endpoints were analyzed using the log-rank method. Multivariate analysis utilized cox proportional hazards regression. Results: We identified 447 (14%) pts met WHO 5th criteria for MDS with low blasts and SF3B1 mutation. Among these, 30 (7%) of pts had a SF3B1 VAF < 10% ( SF3B1low;currently classified as MDS, not otherwise specified by ICC) while 93% (N=417/447) had SF3B1 VAF of ≥ 10% ( SF3B1high). Median VAF in pts with SF3B1low vs. SF3B1high was 6% (range: 2.2-9.9%) vs. 37% (range: 10.9-54.1%). Pts with SF3B1low vs. SF3B1high were older (median age 79 vs. 74, p=0.010), and had lower median platelet (185 x10 9/L vs. 264 x10 9/L, p < 0.001) and white blood cell levels (3.94 x10 9/L vs. 5.46 x10 9/L , p < 0.001). The median number of mutations other than SF3B1 in SF3B1low and SF3B1high was 2 (range: 0-5 vs. 0-8, p=0.42), and SF3B1 was the sole genetic alteration in 10% vs. 20%, respectively (OR=2.2, p=0.24). Common SF3B1 variants in SF3B1low vs. SF3B1 high included p.K666 (27% vs. 10%, OR: 0.31, p=0.01) and p.K700 (50% vs. 59%, OR: 1.42, p=0.44). In pts with SF3B1low, single-hit mutations in TP53 (13% vs. 3%, OR: 0.21, p=0.021), SRSF2 (10% vs. 3%, OR: 0.25, p=0.06), and RUNX1 (7% vs. 4%, OR: 0.60, p=0.37) were more frequent (Fig. A). Other co-mutations had similar frequencies in SF3B1low vs. SF3B1high MDS: TET2 (33% vs. 42%, OR: 1.45, p=0.44), DNMT3A (23% vs. 27%, OR 1.22, p=0.83), ASXL1 (17% vs. 13%, OR: 0.71, p=0.57).The distribution of SF3B1 VAF, and observed patterns of co-mutations did not differ by sample type (peripheral blood or bone marrow). More pts with SF3B1low vs. SF3B1high (76% vs. 46%, p: 0.0011) had a subclonal SF3B1 mutation compared with other co-occurring mutations. In the 213 (48%) pts with subclonal SF3B1, the most frequent dominant mutations included TET2 (35%, N=75), DNMT3A (21%, N=45), and ASXL1 (4%, N=8). Among the top co-mutations in SF3B1low vs. SF3B1high, SF3B1low was more frequently subclonal to TP53 (50% vs. 0%, p=0.04), SRSF2 (33% vs. 0%, p=0.2), and RUNX1 (50% vs. 0%, p=0.1). As anticipated, SF3B1high cases were enriched for very-low/low risk IPSS-M subtypes (78% vs. 43%, OR: 2.9, p=0.011) compared to SF3B1low cases which had an increased frequency of moderate IPSS-M subtypes (30% vs. 14%, OR: 0.39, p=0.03; Fig.B). Median leukemia free survival (LFS; 5 vs. 6 years, p=0.10) was not significantly different between pts with SF3B1low vs. SF3B1high MDS. Median overall survival (OS; 5 vs. 6.2 years, p=0.04) was significantly shorter in pts with SF3B1low, however after adjusting for SF3B1 VAF, age, and IPSS-M score, only age (HR: 1.05 95% CI: 1.03-1.07, p < 0.0001), and increasing IPSS-M score (HR: 2.60 95% CI: 2.10-3.20, p< 0.0001) significantly associated with OS. Conclusion: Patients with MDS with SF3B1-mutation VAF < 10% are older and have an increased frequency of other clonally dominant co-mutations in adverse risk genes (i.e., TP53, SRSF2, RUNX1). Despite more adverse disease biology, LFS and OS were similar between pts with SF3B1low vs. SF3B1high with respect to SF3B1 VAF after accounting for age and IPSS-M score. Future diagnostic and prognostic schema could account for differences in SF3B1lowdisease biology through use of comprehensive prognostic tools such as the IPSS-M score.

Acute Leukemias of Ambiguous Lineage Have Durable Response to Hypomethylating Agents Plus Venetoclax in Older Patients

Background: The standard of care for frontline therapy of acute leukemias of ambiguous lineage (ALAL) remains controversial due to their rarity; however, outcomes are generally poor. Intensive chemotherapy (IC) regimens are standard, with evidence suggesting that acute lymphoblastic leukemia regimens are more effective than those used for acute myeloid leukemia (AML). Strategies for treating older or frail patients are limited. Although treatment with a hypomethylating agent plus venetoclax (HMA/Ven) is standard therapy for IC-ineligible AML patients, the role of HMA/Ven in ALAL remains poorly characterized. We performed a retrospective chart review of patients at our institution with Philadelphia-negative ALAL, comparing the outcomes of those treated with HMA/Ven and those who received IC. Method: Patients ≥ 18 years treated at Weill Cornell Medical Center with newly diagnosed, pathologically confirmed acute undifferentiated leukemia (AUL), T/myeloid, or Philadelphia chromosome-negative B- and B/T-myeloid leukemia were included. Frontline HMA/Ven was defined as Ven plus azacytydine, decitabine, or oral decitabine/cedazuridine (one patient had initial HMA monotherapy followed by HMA/Ven). Intensive chemotherapy included patients who received variations of standard ALL or AML IC regimens (hyper- or mini-hyper-CV[A]D, cytarabine plus daunorubicin or idarubicin, or cladribine plus idarubicin and cytarabine) with or without Ven. Tyrosine kinase inhibitors including midostaurin or gilteritinib were added for patients with fms-like tyrosine kinase 3 ( FLT3) mutations. Baseline and disease characteristics were collected as well as disease response, subsequent lines of therapy, whether the patient proceeded to allogeneic hematopoietic cell transplantation (HCT), rate of morphologic complete remission (CR), and overall survival (OS). Results: Of 16 patients, 7 received frontline HMA/Ven. B/myeloid was the most common disease type (n=8), followed by T/myeloid (n=4), AUL (n=3), and 1 patient with B/T/myeloid disease. The median age was 74 years (interquartile range [IQR] 62-80). Patients who received HMA/Ven were older than those who received IC, with median ages of 79 (IQR: 77-82) and 62 (IQR: 56-70; p = 0.01), respectively. Baseline white blood cell, hemoglobin, platelet counts, and lactate dehydrogenase, as well as blast percentages in both peripheral blood and bone marrow were similar between the groups. Although not validated in ALAL, markers of adverse myeloid disease as per the ELN 2022 schema were prevalent in both groups, including mutations in RUNX1, ASXL1, SRSF2, and TP53 (Figure A). One HMA/Ven patient and 3 IC patients underwent HCT. Of evaluable patients, 83% and 88% of HMA/Ven and IC patients achieved CRs, respectively. At 2 years, both groups had 50% overall survival (95% CI 22.5-100 in both). Among HMA/Ven recipients, overall survival ranged from 10-56 months, not including two patients with ongoing follow-up at 3 and 46 months (Figure B). Discussion: The treatment of ALAL remains a challenge, particularly in older patients who may be unfit for intensive treatment strategies. In our study, patients who received HMA/Ven had similarly durable disease control to younger patients who received IC in the frontline setting. Prolonged responses were seen in both AUL and MPAL. Multicenter registry and prospective analyses are needed; however, given the rarity of these diagnoses, our findings suggest that HMA/Ven should be considered as a frontline therapy for unfit patients with ALAL.

Clinical Factors but Not Somatic Mutations Predict for Survival in Patients with Myelofibrosis Undergoing Allogeneic Hematopoietic Cell Transplant: Analysis of the North American Myelofibrosis Transplant Outcome (NAMTO) Study

Introduction: Myelofibrosis (MF) is a clonal hematologic malignancy characterized by constitutive JAK-STAT activation and aberrant cytokine signaling. Allogeneic hematopoietic stem cell transplantation (allo-HCT) remains the only potentially curative therapy in MF. The contribution of disease-, patient- and donor-related factors to allo-HCT outcomes remains to be fully elucidated, as well as the presence of somatic mutations in genes such as ASXL1, EZH2, SRSF2, U2AF1 and IDH1/2 which are associated with worse prognosis in MF patients (pts). In this large multi- center retrospective analysis, we aimed to study the impact of clinical and molecular mutations on transplant outcomes. Methods: This analysis including 498 pts from 11 centers in North America and Canada. Univariate proportional-hazard Cox regression analysis stratified by center was used to assess the association of patient, transplant, and disease characteristics on overall survival (OS). Baseline patient demographic data and disease characteristics were selected as covariates in the multivariate analysis. Results: Pts transplanted between 2002-2021 were included in this analysis. Baseline and transplant characteristics are summarized in table 1. The 1- and 2-year OS was 77% (95% CI; 73-81) and 70% (95% CI; 66-74) and non-relapse mortality (NRM) 19% (95% CI: 17-21) and 23% (95% CI: 19-27), respectively. The cumulative incidence (CMI) of relapse at 1- and 2-years was 12% (95% CI; 10-14) and 16% (95% CI; 12-20). The CMI of acute graft versus host disease (aGVHD) grade II-IV was 31% (95% CI; 27-35) at 3 months and 42% (95% CI; 38-46) at 1-year post-transplant and grade was III-IV 13% (95% CI; 11-15) and 18% (95% CI; 14-22), respectively. The CMI of neutrophil engraftment at 1 and 3 months was 90% (95% CI: 87-93) and 97% (95% CI: 95-95) and for platelets 55% (95% CI: 50-59) and 80% (95% CI: 76-83). Univariate analysis included pts (age and gender), transplant (donor type and conditioning regimen intensity) and disease characteristics (DIPSS, mutations, cytogenetics (CG), blood counts, and spleen size). Hemoglobin > 10 g/dL (HR .5, 95% CI .34 -.73 p=3 x 10 -4) and platelets >50× 10 9/L (HR .59, 95% CI .42-.81, p=.0013) prior to transplant were associated with improved OS. High risk DIPSS was associated with decreased OS (p=0.0002). Mutations in ASXL1, EZH2, IDH1/2, U2AF1 and SRSF2 were not associated with decreased OS in this analysis (Figure 1). However, mutations in ZRSR2 were associated with inferior OS (HR 2.07, 95% CI 1.08-3.95, p=.0252). Lastly, JAK2 which had the most frequent mutations was not associated with OS (HR .0.93, 95% CI .65-1.31). There was no association between the CG risk groups and OS. Splenomegaly, measured radiographically, had no impact on OS but was strongly associated with engraftment (better engraftment defined as HR>1). For platelets, spleen size of 15.6-18.9 cm HR of 0.69 (95% CI .47-1, p=.0489) and size >18.9-22.5 cm HR of 0.48 ( 95% CI .33-.7, p=1x10^-4). For neutrophils, spleen size >19.9-22.5 cm had a HR of 0.68, (95% CI .48-.96, p=.0268) and size>22.5 cm had a HR of 0.65 (95% CI .46-.91, p=.0114). Mismatched unrelated (MMURD) and haplo identical donors had no impact on survival but were associated with delayed platelet engraftment; MMURD (HR .67, 95% CI .47-.96, p=.0298) and haploidentical donors (HR .56, 95% CI .39-.8, p=.0017). In a multivariate analysis adjusted for age, gender, highest DIPSS, donor type and conditioning regimen, platelets > 50× 10 9/L (HR .61, 95% CI .44-.87, p=.0053) hemoglobin >10 g/dL (HR .6, 95% CI .4-.9, p=.0244) and lower DIPSS at the time of transplant were associated with improved OS. Conclusions: In this large multicenter analysis only clinical variables; hemoglobin and platelets, were found to be associated with OS after allo-HCT in MF patients. Somatic mutations associated with poor prognosis were not associated with OS suggesting that transplant can overcome their negative impact. Splenomegaly was associated with delayed engraftment but not OS. Interestingly, using alternative donors (MMURD and haplo identical) didn't have a negative effect on OS, possibly reflecting the use of post-transplant cyclophosphamide for GVHD prophylaxis in recent years. These results highlight the importance of biologic factors in the prognostication of outcomes in MF pts undergoing allo-HCT independent of somatic mutations. Supported by the American Society of Hematology (ASH) and MPN Research Foundation

Classification of Philadelphia-Negative MPN As Low Risk and High Risk MPN Based on Peripheral Blood Values and Molecular Genetics Only

Background: Philadelphia-negative myeloproliferative neoplasms (Ph -MPN) are characterized by overproduction of differentiated hematopoietic cells mediated in the majority of cases by mutations in JAK2, MPL or CALR (MPN driver genes). Ph - MPN include polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF) and MPN, unclassifiable (MPN-U) which differ in clinical presentation, prognosis, fibrosis and leukemic transformation rate as well as therapeutic options. However, WHO based classification requires experienced pathologists, in particular to diagnose prefibrotic PMF as high risk MPN, and thus remains observer dependent. Aim: Observer independent classification of Ph - MPN solely based on molecular genetics and peripheral blood (PB) parameters. Patients and Methods: We analyzed 267 Ph - MPN cases diagnosed as ET (n=76), PV (n=74), PMF (n=68) or MPN-U (n=49) following the WHO4R classification including only patients with an MPN driver mutation (median age: 68 years [22-91]; female: 41%; median follow-up: 5 years). All samples were analyzed by cytomorphology and whole genome sequencing (median coverage 100x). Mutation status of 20 genes associated with myeloid malignancies were analyzed in detail. Results: Genomic landscape of the MPN cohort showed mutations in JAK2 in 222 (83%) (n=132: single mutation; n=90: either mutation and copy neutral loss of heterozygosity or mutation and 9p gain), in CALR in 36 (14%), and in MPL in 9 (3%) patients. The median number of mutations per patient was two (range: 1-6). Within the cohort, 141 patients (53%) harbored MPN driver mutations only, while in 126 (47%) one to 5 additional mutations were found. The most frequent additional mutations were ASXL1 (n=50), TET2 (n=49; thereof 15 biallelic), SRSF2 (n=26), DNMT3A (n=18), U2AF1 (n=11) and TP53 (n=9; thereof 3 biallelic). Regarding PB parameters, high WBC (≥11×10 9/ L) were detected in 127 patients (48%), high PLT (≥450×10 9/ L) in 116 (43%) and anemia (HB <♂12 or ♀11 g/dL) in 50 patients (19%). We then performed Cox regression analyses for overall survival (OS) including only genetic abnormalities and PB values. In univariate analyses, biallelic TET2 inactivation ( TET2bi: hazard ratio/HR: 3.789), RUNX1 (n=4; HR: 13.479), ASXL1 (HR: 1.886), SRSF2 (HR: 3.218) mutations as well as high PLT (HR: 0.440), high WBC (HR: 1.998) and PB blasts >1% (n=57; HR: 1.904) showed significant associations with OS (for all p<0.02), while no effect was observed for MPN driver mutations, DNMT3A and monoallelic TET2 mutations. In addition, anemia showed a trend towards poor prognosis (HR: 1.595; p=0.079). Following this, we determined high and low risk MPN. In the absence of thrombocytosis, high risk MPN was defined if any of the four following risk factors were present: i) mutation in ASXL1 or SRSF2 or RUNX1 or TET2bi, ii) PB blasts >1%, iii) high WBC or iv) anemia. In the presence of thrombocytosis, at least two of these risk factors were required (Figure 1). Survival analysis revealed a significantly worse median OS of high risk (n=137; 51%) compared to low risk MPN (n=130; 49%) (8 years vs. not reached; p<0.001). This proposed novel stratification reflected prognosis better than WHO entities (median OS: MPN-U: 7 years; MF: 8 years; PV/ ET not reached; overall p=0.001) (Figure 1A). All 76 ET cases (100%) and 44/74 PV cases (59%) were classified as low risk MPN, while 63/68 PMF cases (93%) and 44/49 MPN-U cases (90%) were classified as high risk MPN (Figure 1B). Within low risk and high risk MPN, no significant OS differences were observed between the WHO entities ( p=0.114 and p=0.355, respectively). Conclusions: JAK2-pathway mutated Ph - MPN can be categorized into low and high risk MPN based on molecular genetics and PB values only. The presence of these objectively assessable risk factors in a patient with ET or PV warrants for a profound reevaluation of bone marrow histology (eventually by a reference pathologist for MPN) and clinical course before a high risk MPN (including prefibrotic PMF) can be ruled out. Whether the predictive value of low risk MPN based on molecular genetics and PB values only could be sufficient to omit BM biopsy in selected patients, needs to be evaluated in further prospective studies.

Deconvoluting Clonal and Cellular Architecture in IDH-Mutant Acute Myeloid Leukemia

Introduction Mutations in Isocitrate dehydrogenase 1/2 ( IDH) occur in 20% of acute myeloid leukemias (AML) and frequently co-occur with DNMT3A, NPM1, SRSF2, and NRAS. In clonal hematopoiesis (CH), IDH mutations confer high risk of AML transformation. Recently developed methods linking single cell genotype to single cell transcriptomic profiles and cell lineage offer the opportunity to define the transcriptomic consequences of each mutation across leukemic cell lineages and clonal phylogenies. Here, we develop an integrative single cell laboratory and analytical framework to study the genetic, clonal and cellular heterogeneity of IDH mutated CH and AML, across disease stages (diagnosis and relapse) and deliver a high-resolution map of IDH-mutant AML. Methods Bone marrow or peripheral blood mononuclear samples from 15 AML patients, 2 CH individuals, and 12 unaffected age-matched donors were profiled by single cell RNA-sequencing. For the AML cases, a median of 3 samples per patient were profiled under treatment with IDH inhibitor (IDHi) monotherapy (n=5 patients), IDHi in combination with intensive chemotherapy (NCT02632708, n=6) or in combination with hypomethylating agent (n=2). This dataset comprised 259,610 cells across AML (n=190,133), CH (n=16,705) and normal controls (n=52,772). Genotyping of Transcriptomes (Nam et al., 2019) (for IDH1/2, NPM1, SRSF2, and NRAS mutations) across 6 AML patients enabled genotyping 23% of cells at diagnosis for at least one clone-defining mutation. Results Through meta-analysis of 3,653 diagnostic AML samples profiled by a targeted DNA panel (Papaemmanuil et al., 2016; Tazi et al., 2022), we identified DNMT3A, SRSF2 and NPM1 as critical co-operative mutations in IDH-mutant AML. Amongst the 15 AML patients, 6 had IDH1 mutation, 8 had IDH2 mutations, and 1 had both IDH1 and IDH2. The co-occurring mutations in DNMT3A (n=11 patients), NPM1 (n=5), SRSF2 (n=5) reflected the genomic landscape of IDH-mutant AML. At diagnosis, IDH-mutant AML was enriched in immature hematopoietic stem and progenitor-like blasts. Compared to normal hematopoiesis, IDH-mutant AML blasts upregulated inflammatory response markers including TNFɑ/NFκB-signaling and downregulated proliferation-associated pathways including G2M Checkpoint, and MYC and E2F Targets, and DNA damage response. To investigate how co-mutations modify the IDH-mutant phenotype, we established an integrative single-cell profiling approach to assign single cells to distinct phylogenetic subclones and extract clone-specific transcriptional programs. SRSF2 and NPM1 co-mutations modulated the AML blast phenotype, towards erythroid ( SRSF2) or granulomonocytic lineage ( NPM1). NRAS- or SRSF2-mutant subclones defined distinct gene expression-derived clusters and upregulated proliferation and metabolic pathways. Furthermore, NPM1 co-mutated blasts upregulated KMT2A-target genes. Next, we tracked clonal responses to combination IDHi and chemotherapy using GoT and targeted DNA sequencing. In 4 cases, the ancestral clone, defined by IDH and DNMT3A mutations, retained clonal dominance in both mature and immature myeloid compartments at complete response (median 4 weeks). Conversely, subclones defined by mutations in NPM1, NRAS, or SRSF2, were either reduced or not detectable (limit of detection 2%). In two cases, mutations were not detected after therapy. In patients who relapsed after IDHi monotherapy treatment, blasts upregulated stemness, fatty acid metabolism, OxPHOS, and inflammation at relapse compared to diagnosis. Furthermore, MHC Class II was downregulated at relapse, pointing to immune evasion of AML as a potential relapse mechanism. Finally, we investigated the role of IDH2 mutations at CH. IDH-mutant CH-derived monocytes upregulated inflammation-associated pathways, mirroring the phenotypes observed in IDH-mutant AML at diagnosis. Conclusion We defined how IDH mutations and their frequent co-mutations dysregulated hematopoiesis. We leveraged state-of-the-art single cell techniques to assign leukemic cells to phylogenetic subclones and delineated the role of serially acquired co-mutations in shaping lineage bias and transcriptional programs. Furthermore, we defined genetic, clonal and transcriptional changes at three stages of the AML disease process: diagnosis, remission, and relapse under IDH inhibitor therapy.

What Is the Optimal Treatment Modality in Molecularly Defined Secondary AML? a Multicenter Cohort Study

Introduction Secondary ontogeny acute myeloid leukemia (AML), defined by the presence of mutations in ASXL1, BCOR, EZH2, SF2B1, SRSF2, STAG2, U2AF1 or ZRSR2 was recently integrated into both the ICC and WHO diagnostic criteria, as well as into the ELN 2022 risk classification as adverse risk. However, it is unknown whether cytarabine + anthracycline (7+3), liposomal cytarabine and daunorubicin (CPX-351) or hypomethylating agent + venetoclax (HMA+VEN) is the optimal frontline treatment for these patients (pts). We performed the largest multicenter retrospective cohort study to date, dedicated to pts with molecular-defined secondary ontogeny AML, comparing treatment modalities and assessing the impact of clinical and molecular characteristics on response and survival. Methods We included pts with newly diagnosed (ND) AML who were treated at 4 large academical centers with 7+3, CPX-351 or HMA+VEN. Secondary ontogeny was defined as absence of TP53 mutation and presence of at least one of the aforementioned mutations. Composite complete response (cCR) was defined as complete response (CR) + CR with incomplete count recovery (CRi). Logistic regression was fitted to evaluate odds ratio (OR) for cCR. Overall survival (OS) was compared between groups by log-rank test. COX regression for OS were fitted to evaluate effect of secondary/co-mutations within each treatment group, as well as the effect of treatment and allogeneic stem cell transplantation (SCT) as a time-varying covariate. Results Out of 1132 ND AML pts in the entire cohort, 401 (35%) were molecularly defined as secondary ontogeny and included in the final analysis. Initial treatment was 7+3 in 173 (43%), HMA+VEN in 162 (40%) and CPX-351 in 66 pts (17%). Pts in the HMA+VEN group were older (median age 74 years[yrs]; CPX351 66 yrs; 7+3 63 yrs, p<0.001), while pts in the CPX351 group were more likely to have prior myeloid neoplasm (n=52 [79%]; HMA+VEN n=72 [44%]; 7+3 n=48 [28%], p<0.001) and prior HMA exposure (n=27 [41%]; HMA+VEN n=23 [14%]; 7+3 n=28 [16%], p<0.001). The cCR rates were 56% (97/173), 56% (90/162) and 44% (29/66) in 7+3, HMA+VEN and CPX-351, respectively (p=0.21). In the 7+3 group, the presence of RUNX1 co-mutation was associated with lower cCR rate (OR 0.8, 95% confidence interval [CI] 0.7-0.95, p=0.01), while PTPN11 was associated with higher cCR rate (OR 1.4, 95% CI 1.1-1.8, p=0.011). In the HMA+VEN group, monosomal karyotype (OR 0.7, 95% CI 0.5-0.9, p=0.002), NRAS co-mutation (OR 0.6, 95% CI 0.5-0.8, p<.001) and SF3B1 mutation (OR 0.76, 95% CI 0.6-0.9, p=0.008) were associated with lower cCR rate and FLT3-TKD with higher cCR rate (OR 1.5, 95% CI 1.1-2.1, p=0.01). In the CPX-351 group, NRAS co-mutation was associated with lower cCR rate (OR 0.65, 95% CI 0.5-0.9, p=0.005). As most younger pts (aged ≤ 60 yrs, n=85) were treated with 7+3 (n=64) or CPX-351 (n=13) and almost exclusively older pts (age >75, n=78) were treated with HMA+VEN (n=74), we performed age-group based analyses. In pts aged > 60 yrs (n=318), the median OS (mOS) was comparable between groups (7+3: 16 months [mo], 95% CI 13-27; HMA+VEN 15 mo, 95% CI 13-19; CPX-351 11 mo, 95% CI 9-28 p=0.57). Similar results were seen in pts 60-75 yrs (n=238): 7+3 mOS 16 mo, 95% CI 13-27; HMA+VEN mOS 16 mo, 95% CI 13-26; CPX-351 mOS 10 mo, 95% CI 8-28, p=0.74. The effect of secondary/co-mutations on survival differ between groups: For 7+3 splicing mutations were associated with worse OS, whereas IDH1/2 were associated with improved OS ( Figure). Conversely, in HMA+VEN and CPX351 groups K/NRAS co-mutations were associated with worse survival. NPM1 co-mutation did not affect survival in any treatment group. In multivariable analysis, age, prior myeloid disease, K/NRAS co-mutations and monosomal karyotype were associated with worse OS ( Table). Conversely, BCOR mutation, IDH1/2 co-mutation and SCT were associated with improved OS. Treatment with HMA+VEN or CPX351 were not statistically different vs 7+3, although there was a trend for better OS with HMA+VEN vs 7+3 (HR 0.68, 95% CI 0.44-1.03, p=0.069). Conclusion In pts with ND secondary ontogeny AML the OS with HMA+VEN was at least comparable to 7+3 or CPX351 when adjusted for multiple covariates. The effect of co-mutations on response and OS differed between treatment modalities and may aid in optimal treatment selection in this population. Prospective trials should evaluate the potential superiority of HMA+VEN and effect of co-mutations in secondary ontogeny AML.

Sex-associated differences in frequencies and prognostic impact of recurrent genetic alterations in adult acute myeloid leukemia (Alliance, AMLCG)

Clinical outcome of patients with acute myeloid leukemia (AML) is associated with demographic and genetic features. Although the associations of acquired genetic alterations with patients’ sex have been recently analyzed, their impact on outcome of female and male patients has not yet been comprehensively assessed. We performed mutational profiling, cytogenetic and outcome analyses in 1726 adults with AML (749 female and 977 male) treated on frontline Alliance for Clinical Trials in Oncology protocols. A validation cohort comprised 465 women and 489 men treated on frontline protocols of the German AML Cooperative Group. Compared with men, women more often had normal karyotype, FLT3-ITD, DNMT3A, NPM1 and WT1 mutations and less often complex karyotype, ASXL1, SRSF2, U2AF1, RUNX1, or KIT mutations. More women were in the 2022 European LeukemiaNet intermediate-risk group and more men in adverse-risk group. We found sex differences in co-occurring mutation patterns and prognostic impact of select genetic alterations. The mutation-associated splicing events and gene-expression profiles also differed between sexes. In patients aged <60 years, SF3B1 mutations were male-specific adverse outcome prognosticators. We conclude that sex differences in AML-associated genetic alterations and mutation-specific differential splicing events highlight the importance of patients’ sex in analyses of AML biology and prognostication.

Data-Driven Harmonization of 2022 Who and ICC Classifications of Myelodysplastic Syndromes/Neoplasms (MDS): A Study By the International Consortium for MDS (icMDS)

Background. The inclusion of gene mutations and chromosomal abnormalities in the 2022 WHO and ICC Classifications of MDS has enhanced diagnostic precision and is expected to improve clinical decision-making process. Although these two systems share similarities, clinically relevant discrepancies still exist and potentially cause inconsistency in their adoption in a clinical setting. In this study on behalf of the International Consortium for MDS (icMDS), we adopted a data-driven approach to provide a harmonization roadmap between the 2022 WHO and ICC classification for MDS. A modified Delphi Process consensus approach is currently ongoing among icMDS experts to finalize a harmonized MDS classification scheme. Methods. We analyzed retrospective international cohorts of patients with a diagnosis of MDS (n=7017) and AML (n=1002) according to WHO 2016 criteria. Hierarchical Dirichlet Processes were applied to define clusters capturing broad dependencies among all gene mutations and cytogenetic abnormalities. To investigate the features of importance and their impact on the clustering process, we employed the SHapley Additive exPlanations approach (SHAP). This allowed to define harmonized labels for each clinical entity. The clinical relevance of the unsupervised clustering was assessed through the analysis of phenotypic features and outcomes among each group. ( Blood 2022;140: 9828-9830) Results. Patients' characteristics are summarized in Table 1. We identified 9 clusters, defined by specific genomic features. The cluster of highest hierarchical importance was characterized by biallelic inactivation of TP53 (biTP53). According to SHAP analysis, bi TP53 was defined as 2 or more TP53 mutations, or 1 mutation with copy number loss or cnLOH. Most patients assigned to bi TP53 cluster had TP53 VAF&amp;gt;10% (77.9%) and complex karyotype (70.1%). Assignment to bi TP53 cluster was irrespective of blast count. Patients with monoallelic TP53 mutation segregated into other clusters. Hierarchically, the second cluster included patients with del(5q). SHAP analysis highlighted 5q deletion alone, or with one other chromosomal abnormality other than -7, and absence of bi TP53, as the most relevant features. Most of these patients had blast counts &amp;lt;5% (88.1%). The third distinct cluster included patients with SF3B1 mutations (in the absence of concurrent del(7q), abn3q26.2, complex karyotype or RUNX1 mutation). Most patients with MDS and SF3B1 mutation had &amp;lt;5% blasts (94.2%). Common co-mutated variants in the SF3B1 cluster included mutant DNMT3A (25.2%) and TET2 (38.3%). Morphologically defined MDS cases (i.e., not meeting criteria for bi TP53, del(5q) or SF3B1) were preferentially assigned to the following additional clusters: SF3B1 and concurrent higher-risk mutations (e.g., RUNX1 and ASXL1); SRSF2 and concomitant TET2 mutations; U2AF1 mutations with del(20q), del(7q) or -7; SRSF2 with TET2 mutations and co-mutational patterns including RUNX1 and ASXL1; and AML-like genomic signatures. Our analyses suggest that morphologically defined MDS is characterized by a large heterogeneity in terms of mutation profiles, not entirely captured by the presence of unilineage versus multilineage dysplasia, percentage of bone marrow blasts, and presence of hypocellularity and fibrosis. To better investigate the continuum between high risk MDS (i.e., patients with ≥10% blasts) and AML, an exploratory comparison was made using a cohort of AML (defined according to WHO 2016) patients analyzed using the same statistical methods. Only a partial overlap in genetic signatures was observed between MDS with ≥10% blasts and AML. However, similarities were observed between the AML-like MDS clusters (characterized by mutant NPM1, bZIP CEBPA, and Core Binding Factor abnormalities) and AML clusters defined by the same genetic signature, thus supporting the classification of these entities as AML, irrespective of blast count. Conclusion. Our study demonstrated the utility of a data-driven approach based on advanced statistical methods to generate a harmonized classification for MDS. Table 2 shows a provisional, hierarchical classification algorithm. Further refinement of entity labels and classification criteria is the subject of the ongoing modified Delphi Process consensus approach among icMDS experts.

Impact of Pre-Transplant Molecular and Cytogenetic Remission on Outcomes of Allogeneic Stem Cell Transplant in Patients with Myelodysplastic Syndrome

Background: Allogeneic stem cell transplant (allo-SCT) carries a high relapse rate (~35% within 2 years) in patients (pts) with myelodysplastic syndrome (MDS). Pre-transplant measurable residual disease (MRD) increases the risk of relapse and death in acute myeloid leukemia (Thol et al, Blood 2018). However, the impact of pre-transplant MRD on post-transplant outcomes is less clear in MDS. Prior studies have compared outcomes between myeloablative (MAC) and reduced intensity conditioning (RIC) in pts with pre-transplant MRD persistence based on either cytogenetic remission alone or ultra-deep genomic sequencing with a limited 10-gene panel, suggesting reduced risk of relapse in pts receiving MAC (Festuccia et al, Biol Blood Marrow Transplant 2016; Dillon et al, JCO PO 2021). However, pre-transplant MRD assessment using a commercial next-generation sequencing (NGS) panel in addition to cytogenetic testing to assess post-transplant outcomes has not been evaluated in MDS. Methods: We conducted a multicenter retrospective review of MDS pts who underwent allo-SCT from 2015-2022. Pts with FISH/cytogenetic (FC) and/or molecular abnormalities at diagnosis and MRD assessment by commercial myeloid-panel NGS (with a variant-allele frequency detection limit up to 5%) and FC performed on peripheral blood (PB) or bone marrow (BM) aspirate within 3 months prior to transplant were included for analysis. The Kaplan-Meier method and log-rank tests were used to estimate overall survival (OS). Gray's test/cumulative incidence functions were used to estimate relapse-free survival (RFS) with non-relapse mortality (NRM) as competing risk. Results: Table 1 includes baseline pt characteristics. Of 81 pts, 69 pts (85.2%) had residual FC and/or molecular abnormalities (MRD+) at pre-transplant PB/BM assessment. Twelve (14.8%) pts were in both FC and molecular remission (MRD-) prior to transplant. With a median follow-up of 13.9 months [IQR 6.8 - 38.9], 43 (53%) died and 24 (30%) pts experienced a relapse. Twenty-three of 69 (33%) MRD+ pts had relapsed disease with a 38% cumulative incidence of relapse (CIR) at 2 years. In contrast, only 1/12 (8.3%) MRD- pts experienced a relapse after 7 years, with chromosomal loss of TP53 not present at initial diagnosis. CIR at 2 years was 33% and 41% (p=0.207) for MRD+ pts who received MAC vs RIC, respectively with NRM of 34.5% associated with MAC vs 28.2% for RIC (p=0.61). TP53 mutations were most frequently associated with relapse in 8/24 (33%) pts with a median OS of 9.8 months [8.2 - NR]. Besides the previously defined 10-gene panel (Dillon et al, JCO PO 2021), relapses were also driven by SRSF2, U2AF1, KRAS, SETBP1 and NF1 mutations present in the original clone. Six pts had DNMT3A, TET2 and/or ASXL1 (DTA) mutations only on pre-transplant NGS, with 2/6 pts relapsing without the re-emergence of DTA mutations. Median OS was not reached for MRD- pts and was 14.1 months [11.35-NR] for MRD+ pts, p = 0.061 [Fig.1]. OS probability at 2 years was 35% for MRD+ pts vs 75% for MRD- pts. Type of conditioning regimen, RIC vs MAC, did not impact OS (p= 0.6). An equal number of deaths, 35% each, were attributable to GvHD and relapse, respectively. Thirteen (30%) pts died from other causes, primarily infections and bleeding complications. NRM was 25% and 36% for MRD- and MRD+ cohorts, respectively. Pts received a median of 6 cycles [range, 2-36] of hypomethylating agent (HMA) +/- venetoclax prior to transplant with no association between the number of cycles and MRD status (p=0.80). The incidence of grade 3-4 acute GvHD and chronic GvHD requiring systemic therapy did not significantly differ, at 25% and 18.8% (p= 0.696) and 33.3% and 31.8% (p= 1.00) in MRD+ and MRD- pts, respectively. Conclusions: MRD assessment using commercially available NGS panels and cytogenetic testing that are routinely performed in MDS pts in real-world practice can predict risk of relapse. Pre-transplant MRD is associated with worse OS irrespective of the intensity of conditioning regimen. Although limited in statistical power due to a small sample size of MRD- pts in our cohort, further studies with a larger cohort are underway to better clarify the role of MRD on transplant outcomes in MDS. Our data also highlights that only a small minority of MDS pts (&amp;lt;15%) achieve complete molecular and cytogenetic remission at the time of transplant; strategies to eliminate the pre-transplant MDS clone are urgently needed.