Squash Samples Research Articles

COLOR AND SELECTED SECONDARY METABOLITES OF CONVECTIVE AND MICROWAVE-DRIED SQUASH (CUCURBITA PEPO L.) SLICES

This work was undertaken to evaluate the impact of drying techniques (convective and microwave drying) on color and selected secondary metabolites (ascorbic acid, total phenolic substances, and antioxidant capacity) of squash slices. Convective drying at 3 different temperatures (55, 65, and 75 oC), and microwave drying at 2 different power levels (100W and 200W) were applied. Significant differences were found among fresh and dried-squash slices. Convective-dried squash samples showed better quality characteristics in comparison with the microwave-dried squash samples. The convective-dried squash samples at 65 oC exhibited the highest retention of bioactive components and best color among all convective drying conditions. The microwave-dried squash samples at lower power (100W) showed higher quality characteristics compared to the dried squash samples at 200W.

Probing of ultrasonic assisted pasteurization (UAP) effects on physicochemical profile and storage stability of jambul (Syzygium cumini L.) squash

ABSTRACT The present study focused on evaluating the influence of ultrasonic-assisted pasteurization (UAP) on the quality and shelf stability of jambul squash. Squash was analyzed for physicochemical characteristics during a storage period of 4 months. There was a significant effect (p < .05) of storage period on the acidity, DPPH radical scavenging activity, and flavonoids of jambul squash with a significant increase in acidity and DPPH radical scavenging activity and decrease in flavonoids with the corresponding increases in sonication time and pasteurization temperature during storage. The microbial content of jambul squash during storage remained lower than untreated samples. Microstructure evaluation of jambul squash showed de-shaped middle lamella and cell wall after UAP treatment. Outcomes of the current study revealed that squash samples with increased sonication time and pasteurization temperature had less microbial content than untreated samples.

Results of competitive variety testing of new squash varieties in Uzbekistan

The aim of the research is to breed short climbing, early maturing, high-yielding varieties of squash in the natural and climatic zone of Uzbekistan.Methods. The samples of squash 0044SQ (Holland) and BT+KB-001 (Turkey) were taken from the gene pool of the Research Institute of Plant Industry (Uzbekistan) in 2012 for breeding work. In 2013, squash samples were studied in the nursery of the source material, where they were evaluated for biological and economically valuable traits. Individual selection of plants was carried out. In further breeding work (2014-2016 and 2018), the lines LZ-2513 and LH-1916 were distinguished.Results. The method of analytical breeding created short-climbing, early maturing, high-yielding of squash lines LZ-2513 and LH-1916. Line LZ-2513 has rounded fruits of light green color. The LH-1916 variety has elongated, dark green fruits. Competitive variety trials of new lines were conducted in 2019-2020. Unumdor variety zoned in the republic served as a standard. It was found that from sprouting to maturity of the fruit in the line LZ-2513 is 44 days, in the line LH-1916 – 45 days. High marketable yield was recorded for squash line LZ-2513 – 18.3 tons/ha (122% of the standard); in line LH-1916 marketable yield was 16.4 tons/ha (112.4% of the standard). This year we organized the primary seed production of squash lines LZ-2513 and LH-1916 for multiplication.Conclusion. Promising for cultivation in conditions of Uzbekistan squash line LZ-2513 Orbita (NAP 20200087) and line LH-1916 Viridi (NAP 20200088) were submitted to the Intellectual Property Agency under the Ministry of Justice of the Republic of Uzbekistan to be patented.

Genetic Diversity, Pathogenicity and Pseudorecombination of Cucurbit-Infecting Begomoviruses in Malaysia.

Cucurbits are important crops in the world. However, leaf curl disease constrains their production. Here, begomovirus diversity and pathogenicity associated with the disease in Malaysia were studied based on 49 begomovirus-detected out of 69 symptomatic plants from seven cucurbit crops in 15 locations during 2016 and 2017. The presence of Squash leaf curl China virus (SLCCNV) and Tomato leaf curl New Delhi virus (ToLCNDV) were confirmed by virus detection by polymerase chain reaction, viral DNA sequence analysis and specific detection of the viral components. ToLCNDV Malaysian isolates were further distinguished into strains A, B, C and D. Virus co-infection was detected in bitter gourd, bottle gourd and squash. Among them, eight bitter gourd samples were detected without SLCCNV DNA-A. However, one bottle gourd and five squash samples were without ToLCNDV DNA-B. Pseudorecombination of ToLCNDV DNA-A and SLCCNV DNA-B was detected in two bitter gourd samples. The pathogenic viruses and pseudorecombinants were confirmed by agroinoculation. The viral DNA-B influencing on symptomology and host range was also confirmed. The results strengthen the epidemic of cucurbit-infecting begomovirus in Malaysia as well as Southeast Asia. Especially, the natural pseudorecombinant of begomovirus that extends host range and causes severe symptom implies a threat to crops.

Development of a simple one-step multiplex RT-PCR system for simultaneous detection of DNA and RNA viruses of cucurbit leaf crumple virus, cucurbit yellow stunting disorder virus, squash vein yellowing virus, and cucurbit chlorotic yellows virus

A highly sensitive one-step multiplex RT-PCR (OMRT-PCR) system with an internal plant gene control was developed to simultaneously detect single and mixed RNA and DNA viral pathogens affecting watermelon and squash in the Southeastern United States. Current methods rely on a singleplex detection system for several viruses which is time-consuming for large-scale field monitoring. The gene-specific primers for one DNA virus, cucurbit leaf crumple virus (CuLCrV), and three RNA viruses, cucurbit yellow stunting disorder virus (CYSDV), squash vein yellowing virus (SqVYV), and cucurbit chlorotic yellows virus (CCYV), were used for the development of OMRT-PCR. A plant gene, rubisco from cucurbits was used as an internal control in the standardization of the assay and to monitor false amplification. In addition, we examined the use of total nucleic acid as a template in OMRT-PCR for simultaneously detection of mixed viral infection. The OMRT-PCR demonstrated high sensitivity and detected all four virus infections from 1 ng of total plant nucleic acid in a single reaction. The multiple virus detection approach was successful in the diagnosis of 16 watermelon and 18 squash samples collected from commercial fields in Florida. The OMRT-PCR system is specific, rapid, sensitive, and cost-efficient for the detection of multiple viruses. This technique is expected to improve the ease in the detection of CuLCrV, CYSDV, SqVYV and CCYV and assist in the monitoring of the viral pathogens in commercial cucurbit production fields.

First report of squash vein yellowing virus naturally infecting butternut squash (Cucurbita moschata) in Texas.

Virus diseases are major constraints to the production of cucurbits in the Texas Lower Rio Grande Valley. In September 2020, a ~8.1 ha butternut squash (Cucurbita moschata) field in Hidalgo County, Texas, was observed with virus-like symptoms of vein yellowing, leaf curl, mosaic, and foliar chlorosis. The proportion of plants with virus-like symptoms in this field was estimated at 30% and seven samples (symptomatic = 5; non-symptomatic = 2) were collected randomly for virus diagnosis. Initially, equimolar mixtures of total nucleic acid extracts (Dellaporta et. al. 1983) from two symptomatic samples from this field and extracts from 12 additional symptomatic samples from six other fields across south and central Texas was used to generate one composite sample for diagnosis by high throughput sequencing (HTS). The TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was used to construct cDNA library from the composite sample, which was then sequenced on the Illumina NextSeq 500 platform. More than 26 million single-end HTS reads (75 nt each) were obtained and their bioinformatic analyses (Al Rwahnih et al. 2018) revealed several virus-like contigs belonging to different species (data not shown). Among them, 6 contigs that ranged in length from 429 to 3,834 nt shared 96 to 100% identities with isolates of squash vein yellowing virus (SqVYV), genus Ipomovirus, family Potyviridae. To confirm the HTS results, total nucleic acid extracts from the cucurbit samples from all seven fields (n = 46) were used for cDNA synthesis with random hexamers and the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). A 1-μL aliquot of cDNA was used in 12.5-μL PCR reaction volumes with PrimeSTAR GXL DNA Polymerase (Takara Bio) and two pairs of SqVYV-specific primers designed based on the HTS derived contigs. The primer pairs SqYVV-v4762: 5'-CTGGATTCTGCTGGAAGATCA & SqYVV-c5512: 5'-CCACCATTAAGGCCATCAAAC and SqYVV-v8478: 5'-TTTCTGGGCAAACAAACATGG & SqYVV-c9715: 5'-TTCAGCGACGTCAAGTGAG targeted ~0.75 kb and ~1.2 kb fragments of the cylindrical inclusion (CI) and the complete coat protein (CP) gene sequences of SqVYV, respectively. The expected DNA band sizes were obtained only from the five symptomatic butternut squash samples from the Hidalgo Co. field. Two amplicons per primer pair from two samples were cloned into pJET1.2/Blunt vector (Life Technologies) and bidirectionally Sanger sequenced, generating 753 nt partial CI specific sequences (MW584341-342) and 1,238 nt that encompassed the complete CP (MW584343-344) of SqVYV. In pairwise comparisons, the partial CI sequences shared 100% nt/aa identity with each other and 98-99% nt/aa identity with corresponding sequences of SqVYV isolate IL (KT721735). The CP cistron of TX isolates shared 100% nt/aa identity with each other and 90-98% nt (97-100% aa) identities with corresponding sequences of several SqVYV isolates in GenBank, with isolates IL (KT721735) and Florida (EU259611) being at the high and low spectrum of nt/aa identity values, respectively. This is the first report of SqVYV in Texas, naturally occurring in butternut squash. SqVYV was first discovered in Florida (Adkins et al. 2007) and subsequently reported from few other states in the U.S. (Adkins et al. 2013; Egel and Adkins 2007; Batuman et al. 2015), Puerto Rico (Acevedo et al. 2013), and locations around the world. The finding shows an expansion of the geographical range of SqVYV and adds to the repertoire of cucurbit-infecting viruses in Texas. Further studies are needed to determine the prevalence of SqVYV in Texas cucurbit fields and an assessment of their genetic diversity.

Isolation and characterization of small colony variants of Staphylococcus aureus in various food samples

Staphylococcus aureus is one of the major foodborne pathogen. It may persist for a long time in harsh environment and is responsible for deterioration of food quality (texture, color and taste). The present study is designed to investigate the survival strategy of S. aureus in acidic and sweet based food items. The food samples showed <10 colony forming units CFU/mL through conventional methods. Therefore, resuscitation method was applied to recover metabolically inactive or mutant isolates. Food samples consisted of 61 mango squash (pH = 4.5), 32 sweet mixes (pH = 4.5), 6 canned food (pH = 5.0), 6 bakery items (pH = 5.0) and 9 other food items including ready to eat meal and vermicelli (pH = 4.5–5.0). The Resuscitation method showed the growth of S. aureus in 12 (19.6%) mango squash samples, 7 (31.8%) sweet mixes, 1 (16.6%) canned food, 3 (50.0%) bakery items and 3 (33.3%) other food items. Out of 12 mango squash, 7 samples showed the growth of Wild type (WT) and small colony variants (SCVs), whereas 5 samples showed only WT colonies. The majority (5 out of 7 samples) of the sweet mix showed WT colonies and only 2 samples showed mixed growth of WT and SCVs. WT isolates were oxacillin sensitive, while SCVs were oxacillin resistant. Similarly, SCVs exhibited higher MICs against Ascorbic Acid and Potassium Sorbate. Furthermore, SCVs adapted biofilm to survive under hostile environment. This study shows that conversion to SCVs and biofilm life style is the survival strategy of S. Aureas to persist for a long time in acidic or unfavorable environment.

NATURAL INFECTION OF Tobacco mosaic virus ON BUTTERNUT SQUASH IN BALI, INDONESIA

Natural infection of Tobacco mosaic virus on butternut squash in Bali, Indonesia. Tobacco mosaic virus (TMV) was a newly emerging virus infecting cucumbers in Indonesia since 2017. The mosaic disease caused by TMV potentially caused yield loss cucumber in Java. In 2019, mosaic symptoms were observed in butternut squash plants in Bali and molecular detection using universal primer of Tobamovirus indicated the presence of TMV infection. Further research was conducted to determine molecular characteristics of TMV on butternut squash plants in Bali. Specific DNA bands of Tobamovirus were amplified using reverse transcription polymerase chain reaction method, followed by DNA sequencing. The DNA were successfully amplified from CP Tobamovirus using universal primers from several butternut squash samples, i.e. Denpasar, Gianyar, Buleleng, and Karangasem Districts. The homology analysis of nucleotide and amino acid sequences of TMV among isolates from Denpasar, Gianyar, Buleleng, and Karangasem Districts was ranged between 95.6 – 97.7% and 98.1 – 99.4%, respectively. This indicated that low genetic diversity of TMV among Bali isolates. The highest homology of corresponding sequences of TMV isolates from Denpasar, Gianyar, Buleleng, and Karangasem Districts was closely related to TMV Kediri-Indonesia isolate on cucumber plant. Correspondingly, the phylogenetic analysis showed that TMV Bali isolates were categorized into same cluster with Kediri-Indonesia isolates. This was the first report of TMV on butternut squash in Indonesia.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

Aphid‐borne viruses infecting cultivated watermelon and squash in Spain: Characterization of a variant of cucurbit aphid‐borne yellows virus (CABYV)

AbstractAphid‐borne viruses are responsible for major cucurbit diseases and hamper the sustainability of crop production. Systematic monitoring can reveal the occurrence and distribution of these viruses, in addition to unadvertised viruses, facilitating the control of diseases. For three consecutive (2018–2020) seasons, the presence of aphid‐borne viruses was monitored from a total of 292 samples of watermelon and squash plants that showed yellowing symptoms in three major cucurbit‐producing areas (Castilla La‐Mancha, Alicante, and Murcia) in Spain. We observed that cucurbit aphid‐borne yellows virus (CABYV) was the most common virus found (29%) in the plants from both crops. Likewise, except for squash samples from Castilla La‐Mancha and Alicante, watermelon mosaic virus (WMV) was also found (23%) with a relatively high frequency. Furthermore, we observed the exacerbation of bright yellowing symptoms in watermelon plants that was often accompanied by considerable fruit abortion. CABYV was the only causative agent for this new yellowing disease, and two infectious cDNA clones (one from watermelon, CABYV‐LP63, and another from melon, CABYV‐MEC12.1) were constructed to further compare and characterize this CABYV disease. Based on the full‐length genome, both isolates were grouped phylogenetically together within the Mediterranean clade. However, the Koch's postulates tests were only successfully completed for the LP63 isolate, which also showed several amino acid changes and two potential recombination events, as compared to MEC12.1. Remarkably, the LP63 isolate caused more severe symptoms and showed higher RNA accumulation than MEC12.1 in five cucurbit plant species. These results suggest that a novel CABYV variant that causes severe yellowing symptoms may be causing outbreaks in cucurbit crops.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

Effect of natural antimicrobial agent (MicroGARD) combined with edible coating (NatureSeal) treatment on fresh-cut butternut squash.

To improve fresh-cut produce quality and shelf life, 0.5% or 1.0% MicroGARD® 730 (MG) as a natural alternative to synthetic chemical preservatives, 2.5% NatureSeal® (NS) product (vitamin/mineral-based blends), 0.5% MG combined with 2.5% NS, and 1% MG combined with 2.5% NS were used to treat fresh-cut butternut squash (Cucurbita moschata). The 240g samples were put into food grade bags and stored at 4or 7 °C.Microbial population, including aerobic plate counts (APCs), yeast and molds, total coliforms, and quality parameters, including head space O2 /CO2 concentration in package, pH, soluble solids, color, and conductivity, were evaluated after 0, 3, 6, 9, 12, and 20 days of storage. Results showed that after 6 days of storage at 7 °C, APC of check and control samples reached to 2.6 × 108 and 1.5 × 107 CFU/g, respectively; while they were kept at 104 CFU/g (3 to 4 log reduction) in the squash samples treated with 0.5% or 1% MG combined with NS at 7 °C. Similar results were found on squash samples stored at 4 °Cfor 9 days. The cut squash treated with MG combined with NS had APC ≤ 107 CFU/g at 4 °Cfor about 20 days compared to 9 days in controls or 0.5% MG-treated samples, and 12 days in 1% MG-treated or NS-treated samples, respectively. Considering overall quality and extended shelf life, MG combined with NS was recommended to apply to cut squashes stored at 4 °C. PRACTICAL APPLICATION: This research provided useful information and practical treatment application for developing fresh-cut produce with good quality and extended shelf life up to 20 days at 4 °C.

Polysaccharide identification through oligosaccharide fingerprinting

The identification of polysaccharide structures in complex samples remains a unique challenge complicated by the lack of specific tools for polymeric mixtures. In this work, we present a method that depolymerizes polysaccharides to generate diagnostic oligosaccharide markers that are then analyzed by high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (HPLC-QTOF MS). Rapid identification of food polysaccharides was performed by aligning the identified oligosaccharides with a library of oligosaccharide markers generated from standard polysaccharides. Measurements of standard and food polysaccharides were performed to obtain the contributions of the identified polysaccharides using percent peak coverage and angle cosine methods. The method was validated using a synthetic mixture of standard polysaccharides while the reproducibility was confirmed with experimental triplicates of butternut squash samples, where standard deviation was less than 3% for the relative abundance of oligosaccharides. The method was further employed to examine diverse set of food samples.

Carotenoid quantification of Cucurbita spp. by spectrophotometry, high-performance liquid chromatography and photoacoustics.

Photoacoustic spectroscopy (PAS) is a tool for the rapid and non-destructive identification of materials even without contact. In recent years, there have been several works concerning the applicability of PAS in food analytical measurements. The intention of this work is to identify whether there is a correlation between total carotenoid and the &beta;-carotene content of pumpkin and squash measured by high-performance liquid chromatography (HPLC), spectrophotometry (SP) and PAS. &lsquo;Crown prince F1&rsquo;, &lsquo;Veenas F1&rsquo;, &lsquo;Atlas F1&rsquo; and &lsquo;Apollo F1&rsquo; (SAKATA) were used as experimental materials. The samples were measured in a fresh state and in a lyophilised condition with HPLC, SP and PAS. The results of SP show that total carotene content varies according to the species and variety. Lyophilisation resulted in lower, although varying carotene content compared to the raw form. Typical PA spectra of pumpkins were determined (300&ndash;550 nm), normalized to the carbon black powder. At 17 Hz the amplitude and carotene content shows direct proportionality in the range investigated. Photoacoustic (PA) signal and carotenoid content of pumpkin samples gave a linear correlation (R2 = 0.9821). The measurement of PA spectra gives reliable information about the total carotene content of pumpkin and squash samples. These findings may allow the use of PAS as a fast tool for the carotenoid determination in squashes and give the possibility of instead for the results to be used for the evaluation of squash varieties currently used for industrial processing in functional food development.

Alternaria SPP. in food commodities of Slovak origin: occurrence and mycotoxin production abilities

Various food commodities of Slovak origin were analysed for the occurrence of Alternaria species-groups. Totally we analysed 14 samples of grapes, 3 samples of barley, 2 samples of wheat, 17 samples of fruit, vegetable and fruit-vegetable juices, 6 samples of red kuri squash with macroscopically visible infection. Mycological analyses were performed by using plate dilution method, method of direct placing of berries or grains on the plates with dichloran, rose bengal and chloramphenicol agar or by direct inoculation by mycological needle to the identification medium (potato-carrot agar). In all grape, barley, wheat and squash samples the presence of representatives of this genus was detected (100% isolation frequency). In juices, 41% of the samples were positive for their occurrence. The highest relative density of Alternaria isolates was found in grape samples (87%). All detected strains were segregated into four morphological species-groups: A. alternata, A. arborescens, A. infectoria and A. tenuissima. The most dominant species-group in grapes was A. arborescens, in barley and wheat A. tenuissima, followed by A. alternata, in juices only A. alternata and A. arborescens species-groups were detected and isolates of squashes were not classified to the species-groups. Randomly selected 67 isolates were analysed for the ability to produce mycotoxins alternariol (AOH), alternariol monomethylether (AME) and altenuene (ALT) by means of thin-layer chromatography. Of all tested isolates, AOH production was most frequently reported (70% of tested isolates). AME was produced by 60% and ALT by 49% of tested isolates. The largest share of the productive strains originated from the squashes, where all tested isolates produced ALT and AOH, followed by isolates of juices. From the viewpoint of individual species-groups, A. arborescens isolates and Alternaria spp. appeared to be the most productive in all mycotoxins tested.

Soil biochemical properties and crop productivity following application of locally produced biochar at organic farms on Waldron Island, WA

Biochar (a carbon-rich product from pyrolysis of organic materials) additions to agricultural soils have been shown to often result in neutral to positive influences on soil properties and processes; however, the only a limited number of studies have been conducted on active organic farming systems and of those, none have used multivariate analytical methods to examine the influence of biochar on soil microbial activity, nutrient cycling, and crop performance. In this study, biochar produced from local timber harvest residues on Waldron Island, WA was applied in factorial combination with a poultry litter based fertilizer to replicated plots on six organic farms that were all growing Kabocha squash (Cucurbita maxima) in the summer of 2016. A series of soil physicochemical and biochemical properties were examined after 5 months of biochar application; squash samples were evaluated for productivity and nutrient uptake. Factorial multivariate analysis of variance (MANOVA) revealed a significant influence of biochar on soil properties as well as a synergistic effect of biochar and poultry litter during a 5 month field trial. Principle component analysis (PCA) highlighted soil total C content, microbial biomass C, enzyme activities, bioavailable P, and phosphatase enzyme activity as the variables most influenced by biochar incorporation into surface mineral soil. Redundancy analysis (RDA) further indicated that better soil biochemical conditions, particularly soil enzyme activities and available P concentrations, were associated with higher crop productivity in biochar-treated plots. Overall, our study demonstrates that locally produced wood biochar, in addition to improving soil C storage, has the potential to significantly improve soil fertility and crop productivity in organic farming systems on sandy soils.

Investigations into the role of rats as intermediate hosts for Neospora caninum in Chennai, India

Attempts were made to detect Neospora caninum in rats (Rattus rattus) in and around Chennai, India. During the study, 112 feral rats were trapped and blood, brain, heart, lungs and diaphragm samples were collected for serological, parasitological and molecular identification of N. caninum. Out of 112 rats, cyst-like structures were identified in 16 brain squash samples. However, the identity of the cysts could not be confirmed as N. caninum. A total of 12 sera samples were positive for N. caninum by indirect fluorescence antibody test (IFAT). Four of the ‘cyst’ positive samples were also positive by IFAT. None of the above samples showed amplification of N. caninum (Nc5) or toxoplasmatiid (ITS-1) fragments by PCR. In conclusion, the present study showed 10.71% seroprevalence of N. caninum among feral rats, which is a first report in India. Low prevalence of the organism in the environment and the consequent low chance of exposure of rats to N. caninum might explain the failure to detect the DNA in any of the samples tested in the study.

Biological characterization of Tomato leaf curl New Delhi virus from Spain

Tomato leaf curl New Delhi virus (ToLCNDV; family Geminiviridae, genus Begomovirus) is an emerging virus in horticulture crops in Asia, and has recently been introduced in Spain, Tunisia and Italy. No betasatellite DNA was detected in infected tomato and zucchini squash samples from Spain, and agroinoculated viral DNA‐A and DNA‐B were sufficient to reproduce symptoms in plants of both crop species. Infected tomato and zucchini squash plants also served as inoculum sources for efficient transmission either mechanically or using Bemisia tabaci whiteflies. Cucumber, melon, watermelon, zucchini squash, tomato, eggplant and pepper, but not common bean, were readily infected using viruliferous whiteflies and expressed symptoms 8–15 days post‐inoculation. New full‐length sequences from zucchini squash and tomato indicated a high genetic homogeneity (&gt;99% sequence identity) in the ToLCNDV populations in Spain, pointing to a single recent introduction event.

Seed transmissibility of viruses in winter squash landraces collected from the Black Sea region of Turkey

Sevik M.A., Balkaya A. (2015): Seed transmissibility of viruses in winter squash landraces collected from the Black Sea region of Turkey. Plant Protect. Sci., 51: 195–199. The presence of seed-borne viruses in winter squash landraces in the Black Sea region of Turkey were detected. The seed samples of landraces were tested by ELISA for Cucumber mosaic virus (CMV), Zucchini yellow mosaic virus (ZYMV), Squash mosaic virus (SqMV), Tobacco ring spot virus (TRSV), and Cucumber green mottle mosaic virus (CGMMV). Based on the ELISA results, 11.3% of the samples were infected with the viruses; ELISA, CMV was found at the rate of 5.1% in the winter squash samples, while incidence of ZYMV was determined as 6.2%. Moreover, none of the plants germinated from seeds were found to be infected with SqMV, TRSV, and CGMMV. This is for the first time that seed-borne viruses of winter squash landraces have been identified in the Black Sea region of Turkey.

First Report of Watermelon mosaic virus in Zucchini Squash in Bosnia and Herzegovina.

Aphid-borne Watermelon mosaic virus (WMV; genus Potyvirus, family Potyviridae) is widely distributed in the Mediterranean area and is one of the most prevalent cucurbit viruses in the region (4). In July 2012, approximately 20% of zucchini squash (Cucurbita pepo L.) plants showing virus-like symptoms were observed in one field in Kukulje locality (region of Banja Luka), Bosnia and Herzegovina. Infected plants exhibited mild to severe mosaic, chlorotic mottling, and dark green vein banding, as well as puckering and leaf deformation. Symptoms mostly developed on leaves, while fruits usually only failed to develop a normal coloration. Leaves from 15 symptomatic zucchini squash plants were sampled and analyzed utilizing double-antibody sandwich (DAS)-ELISA kits (Bioreba, AG, Reinach, Switzerland) with commercial antisera specific for five commonly occurring cucurbit-infecting viruses: WMV, Zucchini yellow mosaic virus (ZYMV), Papaya ringspot virus (PRSV), Cucumber mosaic virus (CMV), and Squash mosaic virus (SqMV) (1,3,4). Commercial positive and negative controls were included in each test. WMV was detected serologically in all tested zucchini squash samples, while no presence of other tested viruses were found. Crude sap extracted from leaves of a serologically positive sample (307-12) using 0.01 M phosphate buffer (pH 7) was mechanically inoculated onto five plants of C. pepo 'Ezra F1' and severe mosaic accompanied by bubbling and leaf malformation was observed 14 days post-inoculation. Viral identification in all naturally and mechanically infected plants was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was performed using the One-Step RT-PCR Kit (Qiagen) with specific primers WMV 5' and WMV 3' (4), yielding a 402- to 408-bp fragment corresponding to the N-terminal part of the coat protein (CP) gene (2). Total RNAs obtained from the Serbian WMV isolate from oil pumpkin (GenBank Accession No. JF325890) and healthy zucchini squash leaves were used as positive and negative controls, respectively. A product of the correct predicted size was obtained in all naturally and mechanically infected plants as well as positive control. No amplicon was recorded in healthy control. After purification (QIAquick PCR Purification Kit, Qiagen) the amplicon obtained from one selected isolate 307-12 was sequenced directly in both direction, aligned and compared by MEGA5 software with WMV sequences available in GenBank. Sequence comparisons revealed that the zucchini squash isolate from Bosnia and Herzegovina (KF517099) showed the highest nucleotide identity of 100% with one isolate from Serbia (FJ325891) and two Slovakian WMV isolates (GQ241712 to 13), all belonging to the classical group of WMV isolates (4). To our knowledge, this is the first report of WMV infecting zucchini squash in Bosnia and Herzegovina. Since squash and other cucurbit species represent valuable crops in Bosnia and Herzegovina, with annual production close to US$8.5 million ( http://faostat.fao.org ) and rising rapidly, the presence of a devastating pathogen like as WMV could be a serious constraint for their production.