Spontaneous Variants Research Articles

Mutation in the Bacillus subtilis RNA Polymerase β′ Subunit Confers Resistance to Lipiarmycin

Lipiarmycin (Lprm) (8), a macrocyclic antibiotic also known as tiacumicin (2), is currently under development under the name of OPT-80 (Optimer Pharmaceuticals, Inc., San Diego, Calif.) as a narrow-spectrum antibacterial agent to treat Clostridium difficile-associated diarrhea (1, 7). Lprm is a transcription inhibitor, but unlike rifampin and streptolydigin, it preferentially inhibits holoenzyme transcription at a much greater rate than it inhibits transcription of the core enzyme (5, 6). Genetic mapping experiments in Bacillus subtilis indicate that mutants are located between loci determining rifampin resistance and streptolydigin resistance (6). To precisely identify the positions of the mutations, we selected lipiarmycin-resistant colonies and sequenced the domains of the RNA polymerase located between these two loci. Lprm was produced and purified by fermentation of Actinoplanes deccanensis (DSMZ 43806) by the method of Talpaert et al. (8). Mutant strains were isolated as spontaneous variants of Bacillus subtilis CIP 52.62 that were able to form colonies on nutrient agar plates containing Lprm (40 μg/liter). At this concentration the frequency of resistant colonies was less than 10−7. Among the 10 resistant colonies selected, 8 exhibited an increased MIC for several classes of antibiotics and were likely to be permeability mutants (Table ​(Table1).1). Two mutants (mut1 and mut2) were highly resistant to Lprm. TABLE 1. Antibiotic resistance and transcription activity of Lprm-resistant Bacillus subtilis To correlate the resistance phenotypes with the activity of Lprm on the RNA polymerase, we tested enzymes from the wild-type and mutant colonies in an in vitro transcription assay by the method of Sonenshein et al. (6). The parent cells (CIP 52.62) and mutant cells specifically resistant to Lprm (mut1 and mut2) showed the same pattern of sensitivity to rifampin. In contrast, the transcription activity of the wild-type cells was more strongly affected by the addition of Lprm than was the activity of either mut1 or mut2. This confirmed the link between resistance to Lprm resistance and transcription. mut3 to mut10 strains were equally sensitive to rifampin and Lprm, suggesting that the resistance was not due to a mutation in the polymerase. After purification of the genomic DNA, we PCR amplified and sequenced the regions located between the loci determining rifampin and streptolydigin resistance. The following primers were used: 5′-1285CGTGTGGTTCGTGAGAGAATGT1306-3′, 5′-3257TAAGCTTCAAGTGCCCAAACCT3236-3′, and 5′-2524CTTGTTGGTAAAGTAACGCCTA2545-3′ for rpoB and 5′-1163CGTTTCGCACTCTTAATGTTGTG1141-3′, 5′-593CACAAGGACAACGCCGTAC611-3′, and 5′-2804GTTAACTGTGTACCAGGCTCACC2782-3′ for rpoC. A point mutation resulting in the substitution of the R326 of rpoC by L (CG[T/C]TT) was found in mut1 and mut2 in a highly conserved region; no mutation was detected in mut3 to mut10. When the PCR product harboring the R326L mutation was transfected into B. subtilis CIP 52.62, the frequency of lipiarmycin-resistant bacteria was 100-fold higher than the frequency observed for bacteria with the wild-type fragment. By analogy with the three-dimensional structure of the Thermus aquaticus enzyme (3), R326 is located in proximity to region 3.2 of σ, which in turn occupies the same space as the exiting RNA transcript (3). This could delineate a new binding site for transcription inhibitors.

In vitro and in vivo characterization of smooth small colony variants of Brucella abortus S19

Brucella abortus is known to produce chronic infections in both humans and a variety of animal species. However, the mechanisms underlying the persistence of the bacteria in the presence of an ongoing immune response are still unknown. In this respect we made use of the observation that in vitro grown B. abortus S19 exhibits heterogenicity in colony size when plated onto TS agar, while experimental infection of mice uniformly results in the in vivo selection of the small colony variant. We demonstrate that the spontaneous smooth small colony variant is characterized not only by a slower growth rate in vitro but also by an increased tolerance to hyperosmotic medium and, most importantly, a less effective clearance from spleens and livers of experimentally infected mice. On a molecular level, a gene with homology to a formerly described galactoside transport ATP binding protein ( mglA) was differentially expressed in small versus large colonies of B. abortus S19.

Common Evolutionary Origin for the Unstable Virulence Plasmid pMUM Found in Geographically Diverse Strains ofMycobacterium ulcerans

The 174-kb virulence plasmid pMUM001 in Mycobacterium ulcerans epidemic strain Agy99 harbors three very large and homologous genes that encode giant polyketide synthases (PKS) responsible for the synthesis of the lipid toxin mycolactone. Deeper investigation of M. ulcerans Agy99 resulted in identification of two types of spontaneous deletion variants of pMUM001 within a population of cells that also contained the intact plasmid. These variants arose from recombination between two 8-kb sections of the same plasmid sequence, resulting in the loss of a 65-kb region bearing two of the three mycolactone PKS genes. Investigation of nine diverse M. ulcerans strains by using PCR and Southern hybridization for eight pMUM001 gene sequences confirmed the presence of pMUM001-like elements (collectively called pMUM) in all M. ulcerans strains. Physical mapping of these plasmids revealed that like M. ulcerans Agy99, three strains had undergone major deletions in their mycolactone PKS loci. Online liquid chromatography-sequential mass spectrometry analysis of lipid extracts confirmed that strains with PKS deletions were unable to produce mycolactone or any related cometabolites. Interstrain comparisons of the plasmid gene sequences revealed greater than 98% nucleotide identity, and the phylogeny inferred from these sequences closely mimicked the phylogeny from a previous multilocus sequence typing study in which chromosomally encoded loci were used, a result that is consistent with the hypothesis that M. ulcerans diverged from the closely related organism Mycobacterium marinum by acquiring pMUM. Our results suggest that pMUM is a defining characteristic of M. ulcerans but that in the absence of purifying selection, deletion of plasmid sequences and a corresponding loss of mycolactone production readily arise.

Phenotypic and genotypic characterization of mutants of the virginiamycin producing strain 899 and its relatedness to the type strain of Streptomyces virginiae

A representative set of 19 mutants, with a known genealogy, of the virginiamycin producing strain Streptomyces virginiae 899 was investigated phenotypically and genotypically. Colour of the aerial and substrate mycelium were very variable both among spontaneous variants and those obtained after induced mutagenesis. At genotypic level, all mutants showed nearly identical BOX patterns, not reflecting the phenotypic heterogeneity observed. More than 40 years of forced mutational pressure did not cause huge chromosomal distortions but was most likely limited to base substitutions. The specie s S. virginiae, including besides producers of virginiamycin the type strain and non-type strains producing other bioactive compounds , is genomically heterogeneous on the basis of BOX-PCR fingerprinting and DNA–DNA hybridizations. The virginiamycin producing strain 899 does not belong to the species S. virginiae despite its phenotypic similarity to the latter.

A phage protein confers resistance to the lactococcal abortive infection mechanism AbiP.

Phage bIL66M1 is sensitive to the lactococcal abortive infection mechanism AbiP. No spontaneous AbiP-resistant variant could be obtained at a frequency of <10(-10). However, AbiP-resistant variants were readily obtained during infection with both bIL66M1 and the highly homologous AbiP-resistant phage bIL170. Gain of AbiP resistance was due to the acquisition of the e6 gene from bIL170.

Expression of Vibrio vulnificus capsular polysaccharide inhibits biofilm formation.

Vibrio vulnificus is a human pathogen that produces lethal septicemia in susceptible persons, and the primary virulence factor for this organism is capsular polysaccharide (CPS). The role of the capsule in V. vulnificus biofilms was examined under a variety of conditions, by using either defined CPS mutants or spontaneous CPS expression phase variants derived from multiple strains. CPS expression was shown to inhibit attachment and biofilm formation, which contrasted with other studies describing polysaccharides as integral to biofilms in related species.

Search for A-factor-Dependent Variants in Actinomycete Populations

A study of 28 nocardia-like, asporogenous, and oligosporous spontaneous morphological variants belonging to 23 species of streptomycetes revealed five strains producing regulators of the A-factor group. Streptomyces griseus 1439, which forms aerial mycelium and spores only in the presence of exogenous A-factor was used as the test strain. Among the 28 spontaneous variants, three new A-factor-dependent strains were revealed, which represented the species Streptomyces griseus, S. citreofluorescens, and S. viridovulgaris subsp. albomarinus. These weakly differentiated variants id not produce A-factor and behaved as its recipients, responding by changes in their morphological characteristics at a concentration of this regulator in the medium of 0.01 microgram/ml and higher. The original collection strains in whose populations the variants were selected produced substances of the A-factor group. The A-factor-dependent variants differed in the level of the regulator required for maximal expression of the morphological characteristics were shown: it was necessary to introduce the A-factor at a concentration of 1 microgram/ml for S. citreofluorescens and S. viridovulgaris subsp. albomarinus and at 10 micrograms/ml for S. griseus.

Generation of biologically active anti-Cryptococcus neoformans IgG, IgE and IgA isotype switch variant antibodies by acridine orange mutagenesis.

Administration of MoAbs to Cryptococcus neoformans capsular glucuronoxylomannan (GXM) can alter the course of infection in mouse models. However, the effectiveness of these antibodies appears to depend on isotype and specificity. Comparison of isotype protection efficacy requires families of MoAbs with identical fine specificity and different constant region domain. The generation of such families by hybridoma technology is not always possible because the immune response produces MoAbs of limited classes or subclasses. In these instances isotype switch variants can be isolated in vitro. Unfortunately, standard methods of recovering spontaneous switch variants are often unsuccessful, mainly because of the low frequency of switching. In this study we demonstrate that acridine orange stimulation of an IgG3 anti-C. neoformans-producing hybridoma can be used to recover the entire set of isotype switch variants: IgGl, IgG2b, IgG2a, IgE and IgA. All isotype switch variants bind to GXM; fine specificity mapping, using an 11 amino acid peptide polysaccharide mimetope, revealed conservation of binding site specificity. Furthermore, all isotype switch variants reacted with an anti-idiotopic MoAb. The functional activity of this set of MoAbs was demonstrated by their ability to enhance phagocytosis and antifungal efficacy of human macrophage-like THP-1 cells, with IgG3 being the most effective and IgE being the least effective.

A single V317A or V317M substitution in Enzyme II of a newly identified beta-glucoside phosphotransferase and utilization system of Corynebacterium glutamicum R extends its specificity towards cellobiose.

A catabolic system involved in the utilization of beta-glucosides in Corynebacterium glutamicum R and its spontaneous mutant variants allowing uptake of cellobiose were investigated. The system comprises a beta-glucoside-specific Enzyme IIBCA component (gene bglF) of the phosphotransferase system (PTS), a phospho-beta-glucosidase (bglA) and an antiterminator protein (bglG) from the BglG/SacY family of transcription regulators. The results suggest that transcription antitermination is involved in control of induction and carbon catabolite repression of bgl genes, which presumably form an operon. Functional analysis of the bglF and bglA products revealed that they are simultaneously required for uptake, phosphorylation and breakdown of methyl beta-glucoside, salicin and arbutin. Although cellobiose is not normally a substrate for BglF permease and is not utilized by C. glutamicum R, cellobiose-utilizing mutants can be obtained. The mutation responsible was mapped to the bgl locus and sequenced, and point mutations were found in codon 317 of bglF. These led to substitutions V317A and/or V317M near the putative PTS active-site H313 in the membrane-spanning IIC domain of BglF and allowed BglF to act on cellobiose. Such results strengthen the evidence that the IIC domains can be regarded as selectivity filters of the PTS.

Colonial morphology of Burkholderia cepacia complex genomovar III: implications in exopolysaccharide production, pilus expression, and persistence in the mouse.

The purpose of this study was to determine the role of colonial morphology of Burkholderia cepacia complex (BCC) organisms in pathogenicity in a mouse model of pulmonary infection. BCC strain C1394 was rapidly cleared by leukopenic mice after intranasal challenge, whereas a spontaneous variant (C1394mp2) that was indistinguishable from the parent strain by genetic typing persisted in the lungs and differed in colonial morphology. The parent strain had a matte colonial phenotype, made scant exopolysaccharide (EPS), and was lightly piliated. The variant had a shiny phenotype, produced abundant EPS, and was heavily piliated. Matte to shiny colonial transformation was induced by growth at 42 degrees C. Colonial morphology in the BCC strain variant was associated with persistence after pulmonary challenge and appeared to be correlated with the elaboration of putative virulence determinants.

The PhlA hemolysin from the entomopathogenic bacterium Photorhabdus luminescens belongs to the two-partner secretion family of hemolysins.

Photorhabdus is an entomopathogenic bacterium symbiotically associated with nematodes of the family Heterorhabditidae. Bacterial hemolysins found in numerous pathogenic bacteria are often virulence factors. We describe here the nucleotide sequence and the molecular characterization of the Photorhabdus luminescens phlBA operon, a locus encoding a hemolysin which shows similarities to the Serratia type of hemolysins. It belongs to the two-partner secretion (TPS) family of proteins. In low-iron conditions, a transcriptional induction of the phlBA operon was observed by using the chloramphenicol acetyltransferase reporter gene, causing an increase in PhlA hemolytic activity compared to iron-rich media. A spontaneous phase variant of P. luminescens was deregulated in phlBA transcription. The phlA mutant constructed by allelic exchange remained highly pathogenic after injection in the lepidopteran Spodoptera littoralis, indicating that PhlA hemolysin is not a major virulence determinant. Using the gene encoding green fluorescent protein as a reporter, phlBA transcription was observed in hemolymph before insect death. We therefore discuss the possible role of PhlA hemolytic activity in the bacterium-nematode-insect interactions.

N-Methylation in polylegionaminic acid is associated with the phase-variable epitope of Legionella pneumophila serogroup 1 lipopolysaccharide. Identification of 5-(N,N-dimethylacetimidoyl)amino and 5-acetimidoyl(N-methyl)amino-7-acetamido-3,5,7,9-tetradeoxynon-2-ulosonic acid in the O-chain polysaccharide.

Previously, a phase-variable epitope was detected in the virulent wild-type strain RC1 of Legionella pneumophila serogroup 1 subgroup OLDA using a lipopolysaccharide-specific monoclonal antibody, mAb 2625 [Lüneberg, E., Zähringer, U., Knirel, Y. A., Steinmann, D., Hartmann, M., Steinmetz, I., Rohde, M., Kohl, J. & Frosch, M. (1998) J.Exp. Med. 188, 49-60]. In the present study, an isogenic mutant strain, termed 5215, was constructed by deletion of genes involved in the biosynthesis of the mAb 2625 epitope. Mutant 5215 was as virulent as the parental wild-type RC1 but did not bind mAb 2625. The two strains showed no difference in the core oligosaccharide and lipid A but in the O-chain polysaccharide structure, which is a homopolymer of 5-acetimidoylamino-7-acetamido-3,5,7,9-tetradeoxy-d-glycero-d-galacto-non-2-ulosonic acid (a derivative of legionaminic acid). NMR spectroscopic studies revealed a hitherto unknown modification of bacterial polysaccharides in the wild-type strain, namely N-methylation of the 5-acetimidoylamino group on a single legionaminic acid residue that is located, most likely, proximal to the core oligosaccharide. Two major N-methylated substituents, the (N,N-dimethylacetimidoyl)amino and acetimidoyl(N-methyl) amino groups, could be allocated to the long- and middle-chain O-polysaccharide species, respectively. N-Methylation of legionaminic acid that was absent from the isogenic mutant 5215 and from the spontaneous phase variant 811, correlated with the presence of the mAb 2625 epitope.

Hormone Status Selects for Spontaneous Somatic Androgen Receptor Variants That Demonstrate Specific Ligand and Cofactor Dependent Activities in Autochthonous Prostate Cancer

We have used the autochthonous transgenic adenocarcinoma of mouse prostate (TRAMP) model to investigate the relationship between somatic mutation in the androgen receptor (AR) and the emergence of androgen-independent prostate cancer. Here we report the identification, isolation, and characterization of distinct classes of AR variants from spontaneous prostate tumors in the TRAMP model. Using cDNA cloning, single stranded conformation polymorphism and sequencing strategies, 15 unique somatic mutations in the AR were identified in prostate tumors obtained from eight TRAMP mice between 24 and 29 weeks of age. At least one mutation was isolated from each mouse. All mutations were single base substitutions, 10 were missense and 5 were silent. Nine mutations in the AR were identified in tumors of four mice that were castrated at 12 weeks of age. Interestingly, the majority of mutations (seven out of nine, 78%) identified in the androgen-independent tumors colocalized in the AR transactivation domain. The remaining mutations colocalized in the AR ligand binding domain. In general, the AR variants demonstrated promoter-, cell-, and cofactor-specific activities in response to various hormones. All AR variants isolated in this study maintained strong sensitivity for androgens, and four AR variants isolated from castrated mice demonstrated increased activities in the absence of ligand. The K638M and F677S variants demonstrated increased activities in response to androgen, and K638M also demonstrated increased response to estradiol. In the presence of AR coactivator ARA70 the E231G variant demonstrated increased activity in response to both androgen and estradiol. However, in the presence of AR coactivator ARA160 the E231G variant was selectively responsive to androgen. Collectively these analyses not only indicate that somatic mutations in the AR gene occur spontaneously in TRAMP tumors but also how changes in the hormonal environment may drive the selection of spontaneous somatic mutations that provide a growth advantage.

Characterization of Vibrio cholerae O1 El tor galU and galE mutants: influence on lipopolysaccharide structure, colonization, and biofilm formation.

Recently we described the isolation of spontaneous bacteriophage K139-resistant Vibrio cholerae O1 El Tor mutants. In this study, we identified phage-resistant isolates with intact O antigen but altered core oligosaccharide which were also affected in galactose catabolism; this strains have mutations in the galU gene. We inactivated another gal gene, galE, and the mutant was also found to be defective in the catabolism of exogenous galactose but synthesized an apparently normal lipopolysaccharide (LPS). Both gal mutants as well as a rough LPS (R-LPS) mutant were investigated for the ability to colonize the mouse small intestine. The galU and R-LPS mutants, but not the galE mutant, were defective in colonization, a phenotype also associated with O-antigen-negative mutants. By investigating several parameters in vitro, we could show that galU and R-LPS mutants were more sensitive to short-chain organic acids, cationic antimicrobial peptides, the complement system, and bile salts as well as other hydrophobic agents, indicating that their outer membrane no longer provides an effective barrier function. O-antigen-negative strains were found to be sensitive to complement and cationic peptides, but they displayed significant resistance to bile salts and short-chain organic acids. Furthermore, we found that galU and galE are essential for the formation of a biofilm in a spontaneous phage-resistant rugose variant, suggesting that the synthesis of UDP-galactose via UDP-glucose is necessary for biosynthesis of the exopolysaccharide. In addition, we provide evidence that the production of exopolysaccharide limits the access of phage K139 to its receptor, the O antigen. In conclusion, our results indicate involvement of galU in V. cholerae virulence, correlated with the observed change in LPS structure, and a role for galU and galE in environmental survival of V. cholerae.

Capsule impedes adhesion to and invasion of epithelial cells by Klebsiella pneumoniae.

The adhesion of K21a, K26, K36, and K50 capsulated Klebsiella strains to ileocecal (HCT-8) and bladder (T24) epithelial cell lines was significantly lower than that of their corresponding spontaneous noncapsulated variants K21a/3, K26/1, K36/3, and K50/3, respectively. Internalization of the bacteria by both epithelial cell lines was also significantly reduced. Similarly, a capsule-switched derivative, K2(K36), that exhibited a morphologically larger K36 capsule and formed more capsular material invaded the ileocecal epithelial cell line poorly compared to the corresponding K2 parent strain. None of the capsulated strains exhibited significant mannose-sensitive type 1 fimbriae, whereas two of the noncapsulated variants K21a/3 and K50/3 exhibited potent mannose-sensitive hemagglutinating activity. Although hemagglutinating activity that could be attributed to mannose-resistant Klebsiella type 3 fimbriae was weak in all strains, in several cases the encapsulated parent strains exhibited lower titers than their corresponding noncapsulated variants. Although the level of adhesion to the ileocecal cells is not different from adhesion to bladder cells, bacterial internalization by bladder cells was significantly lower than internalization by ileocecal cells, suggesting that bladder cells lack components required for the internalization of Klebsiella.

Maintenance and control of redox poise in Rhodobacter capsulatus strains deficient in the Calvin-Benson-Bassham pathway.

Carbon dioxide serves as the preferred electron acceptor during photoheterotrophic growth of nonsulfur purple photosynthetic bacteria such as Rhodobacter capsulatus and Rhodobacter sphaeroides. This CO2, produced as a result of the oxidation of preferred organic carbon sources, is reduced through reactions of the Calvin-Benson-Bassham reductive pentose phosphate pathway. This pathway is thus crucial to maintain a balanced intracellular oxidation-reduction potential (or redox poise) under photoheterotrophic growth conditions. In the absence of a functional Calvin-Benson-Bassham pathway, either an exogenous electron acceptor, such as dimethylsulfoxide, must be supplied or the organism must somehow develop alternative electron acceptor pathways to preserve the intracellular redox state of the cell. Spontaneous variants of Rba. capsulatus strains deficient in the Calvin-Benson-Bassham pathway that have become photoheterotrophically competent (in the absence of an exogenous electron acceptor) were isolated. These strains (SBP-PHC and RCNd1, RCNd3, and RCNd4) were shown to obviate normal ammonia control and derepress synthesis of the dinitrogenase enzyme complex for the dissipation of excess reducing equivalents and generation of H2 gas via proton reduction. In contrast to previous studies with other organisms, the dinitrogenase reductase polypeptides were maintained in an active and unmodified form in strain SBP-PHC and the respective RCNd strains. Unlike the situation in Rba. sphaeroides, the Rba. capsulatus strains did not regain full ammonia control when complemented with plasmids that reconstituted a functional Calvin-Benson-Bassham pathway. Moreover, dinitrogenase derepression in Rba. capsulatas was responsive to the addition of the auxiliary electron acceptor dimethylsulfoxide. These results indicated a hierarchical control over the removal of reducing equivalents during photoheterotrophic growth that differs from strains of Rba. sphaeroides and Rhodospirillum rubrum deficient in the Calvin-Benson-Bassham pathway.

Detecting genes in new and old mouse models for epilepsy: a prospectus through the magnifying glass

Various spontaneous mutants and natural strain variants for either generalized tonic-clonic seizures, or non-convulsive absence seizures have been described in mice and rats over the years. Convulsive seizure models are usually ascertained by mere visual observation, while finding the less noticeable seizures of absence models often requires proactive screening of existing mutants with other phenotypes. To date, molecular cloning technologies has elucidated the primary basis of most of the known single locus epilepsy mutants. Together with the 20 or so mouse knockouts with seizure-related phenotypes described to date, the frequency at which the mutants appear and diversity of the proteins involved would suggest that 1000 or more genes can be mutated to give rise to influence epilepsy phenotypes. As many of these genes will cluster into molecular, cellular and developmental pathways, their identification may be very important for better understanding epileptic mechanisms. With this perspective, the approaches taken towards positional cloning of mouse epilepsy mutations is illustrated by comparing and contrasting the different stages of gene identification in three different models with which this author has been fortunate enough to be intimately involved: slow-wave epilepsy (common gene symbol: swe, Chr 4); tottering ( tg, Chr 8); and stargazer ( stg, Chr 15). The comparatively sobering outlook for positional cloning of the more common genetically ‘complex’ epilepsies will also be discussed, as will more efficient new strategies for model screening and identifying the remaining 985 (or so) genes.

Growth characteristics and influence of antibiotics on rough/smooth phenotypic variants of Helicobacter pylori.

Helicobacter pylori shows a rather high variability of several biochemical markers including lipopolysaccharide structures. This study aimed to determine whether Helicobacter pylori has a potential for phenotypic variability and to describe its effects on bacterial pathogenesis. From colonies of three clinical strains of Helicobacter pylori with rough (R) colony morphology, spontaneous phenotypic variants with smooth (S) colony morphology were isolated that occurred with a frequency of 10(-2) to 10(-3), irrespective of growth conditions. R-variant bacteria produced exclusively low-molecular-mass lipopolysaccharide. They exhibited increased lysis in the presence of plain air. In contrast, the S variants produced low- and high-molecular-mass lipopolysaccharide and did not exhibit increased lysis in the presence of plain air. Cocultivation of bacterial cells with AGS stomach cancer cells revealed that R-variant bacteria but not S-variant bacteria effected an inhibition of high molecular-weight glycoprotein biosynthesis and secretion by the host cells. Skirrow supplement added as selective agent to liquid and/or solid media was tolerated to a similar extent among R- and S-variant bacteria, while all variants proved sensitive to metronidazole, amoxicillin and clarithromycin except for the R and S isolates of strain Hp57, which showed resistance to the latter compound. It was concluded that R- and S-variants of Helicobacter pylori may have distinct roles in pathogenesis; nevertheless, these bacteria may be isolated by traditional methods and eradicated by conventional anti-infective therapy.

Phenotypic variation in Actinobacillus actinomycetemcomitans during laboratory growth: implications for virulence.

This study examined alteration of specific virulence traits associated with phenotypic changes seen when a low-passage disease-associated and well maintained parent strain of Actinobacillus actinomycetemcomitans was compared to a laboratory-grown spontaneous variant/mutant. Clinical isolates of A. actinomycetemcomitans recovered from periodontitis patients typically grow as rough, adherent colonies on primary culture but undergo transformation to smooth, non-adherent colonies following repeated passage in vitro. The relationship of these phenotypic changes to the virulence of the organism or to the processes that underlie this transformation are not understood. A fresh clinical isolate, designated strain CU1000, was obtained from the first molar site of a patient with classical signs of localized juvenile periodontitis and used as the parent strain to study virulence-related phenotypes. Following several passages of CU1000 on selective agar, a spontaneous variant that demonstrated smooth, opaque, non-adherent colonies was isolated and designated strain CU1060. This study compared the properties of these two strains with respect to colony morphology, autoaggregation, surface appendages, adherence to saliva-coated hydroxyapatite (SHA), LPS chemotype and activity, induction of fibroblast proteinase activity and antigenic properties. CU1000 demonstrated rough, raised, star-positive colonies which upon electron microscopic examination revealed the presence of large, flexible, bundled fibrils. In addition, CU1000 showed adherence to SHA, several unique protein antigens and elevated endotoxin and fibroblast proteinase activity. CU1060, on the other hand, showed minimal adherence to SHA and fewer reactive proteins compared to the fresh clinical isolates. This strain formed smooth, opaque colonies on agar, showed minimal fibril formation and limited endotoxin and fibroblast-proteinase-inducing activity. These findings demonstrate that clinical isolates of A. actinomycetemcomitans undergo significant virulence-reducing phenotypic alterations during in vitro passage and support the need to study this organism in its clinical form.

Diversification of Pseudomonas corrugata 2140 produces new phenotypes altered in GC-FAME, BIOLOG, and in vitro inhibition profiles and taxonomic identification.

Bacteria are known to rapidly produce new phenotypes, but it is unclear how phenotype "plasticity" relates to studies on the population ecology of bacteria in complex environments. We characterised a collection of 14 spontaneous phenotype variants, derived from in vitro and in vivo cultures (wheat roots) of Pseudomonas corrugata 2140, using fatty acid methyl ester profiles (GC-FAME), carbon substrate utilisation (BIOLOG), and in vitro inhibition against seven soil microorganisms. All three phenotype profiles indicated marked differences between some variants and the parent isolate. Some variant types were classified taxonomically by GC-FAME as different species to their wild-type parent, and up to a Euclidian distance of 11 from their parent. Taxonomic identification by the BIOLOG assay was more consistent; however, use of 22 carbon sources were altered (lost or gained) in one or more variants. All variant types had a reduced ability to inhibit one or more test organisms, depending on the variant and test organism. Hierarchical cluster analysis of variants using GC-FAME, BIOLOG, and inhibition profiles produced different groupings. The ability of variants to cross taxonomic boundaries specified by the GC-FAME and BIOLOG libraries at the species level has implications for both taxonomy and the ecological study of bacterial communities.