Spliced Leader Sequence Research Articles

Rapid detection and identification of Wuchereria bancrofti, Brugia malayi, B. pahangi, and Dirofilaria immitis in mosquito vectors and blood samples by high resolution melting real-time PCR.

A simple, rapid, and high-throughput method for detection and identification of Wuchereria bancrofti, Brugia malayi, Brugia pahangi, and Dirofilaria immitis in mosquito vectors and blood samples was developed using a real-time PCR combined with high-resolution melting (HRM) analysis. Amplicons of the 4 filarial species were generated from 5S rRNA and spliced leader sequences by the real-time PCR and their melting temperatures were determined by the HRM method. Melting of amplicons from W. bancrofti, B. malayi, D. immitis, and B. pahangi peaked at 81.5±0.2℃, 79.0±0.3℃, 76.8±0.1℃, and 79.9±0.1℃, respectively. This assay is relatively cheap since it does not require synthesis of hybridization probes. Its sensitivity and specificity were 100%. It is a rapid and technically simple approach, and an important tool for population surveys as well as molecular xenomonitoring of parasites in vectors.

A directed approach for the identification of transcripts harbouring the spliced leader sequence and the effect of trans-splicing knockdown in Schistosoma mansoni

Schistosomiasis is a major neglected tropical disease caused by trematodes from the genus Schistosoma. Because schistosomes exhibit a complex life cycle and numerous mechanisms for regulating gene expression, it is believed that spliced leader (SL) trans-splicing could play an important role in the biology of these parasites. The purpose of this study was to investigate the function of trans-splicing in Schistosoma mansoni through analysis of genes that may be regulated by this mechanism and via silencing SL-containing transcripts through RNA interference. Here, we report our analysis of SL transcript-enriched cDNA libraries from different S. mansoni life stages. Our results show that the trans-splicing mechanism is apparently not associated with specific genes, subcellular localisations or life stages. In cross-species comparisons, even though the sets of genes that are subject to SL trans-splicing regulation appear to differ between organisms, several commonly shared orthologues were observed. Knockdown of trans-spliced transcripts in sporocysts resulted in a systemic reduction of the expression levels of all tested trans-spliced transcripts; however, the only phenotypic effect observed was diminished larval size. Further studies involving the findings from this work will provide new insights into the role of trans-splicing in the biology of S. mansoni and other organisms. All Expressed Sequence Tags generated in this study were submitted to dbEST as five different libraries. The accessions for each library and for the individual sequences are as follows: (i) adult worms of mixed sexes (LIBEST_027999: JZ139310 - JZ139779), (ii) female adult worms (LIBEST_028000: JZ139780 - JZ140379), (iii) male adult worms (LIBEST_028001: JZ140380 - JZ141002), (iv) eggs (LIBEST_028002: JZ141003 - JZ141497) and (v) schistosomula (LIBEST_028003: JZ141498 - JZ141974).

The Candidate Histocompatibility Locus of a Basal Chordate Encodes Two Highly Polymorphic Proteins

The basal chordate Botryllus schlosseri undergoes a natural transplantation reaction governed by a single, highly polymorphic locus called the fuhc. Our initial characterization of this locus suggested it encoded a single gene alternatively spliced into two transcripts: a 555 amino acid–secreted form containing the first half of the gene, and a full-length, 1008 amino acid transmembrane form, with polymorphisms throughout the ectodomain determining outcome. We have now found that the locus encodes two highly polymorphic genes which are separated by a 227 bp intergenic region: first, the secreted form as previously described, and a second gene encoding a 531 amino acid membrane-bound gene containing three extracellular immunoglobulin domains. While northern blotting revealed only these two mRNAs, both PCR and mRNA-seq detect a single capped and polyadenylated transcript that encodes processed forms of both genes linked by the intergenic region, as well as other transcripts in which exons of the two genes are spliced together. These results might suggest that the two genes are expressed as an operon, during which both genes are co-transcribed and then trans-spliced into two separate messages. This type of transcriptional regulation has been described in tunicates previously; however, the membrane-bound gene does not encode a typical Splice Leader (SL) sequence at the 5′ terminus that usually accompanies trans-splicing. Thus, the presence of stable transcripts encoding both genes may suggest a novel mechanism of regulation, or conversely may be rare but stable transcripts in which the two mRNAs are linked due to a small amount of read-through by RNA polymerase. Both genes are highly polymorphic and co-expressed on tissues involved in histocompatibility. In addition, polymorphisms on both genes correlate with outcome, although we have found a case in which it appears that the secreted form may be major allorecognition determinant.

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Evolutionary Acquisition and Loss of Saxitoxin Biosynthesis in Dinoflagellates: the Second “Core” Gene, sxtG

Saxitoxin and its derivatives are potent neurotoxins produced by several cyanobacteria and dinoflagellate species. SxtA is the initial enzyme in the biosynthesis of saxitoxin. The dinoflagellate full mRNA and partial genomic sequences have previously been characterized, and it appears that sxtA originated in dinoflagellates through a horizontal gene transfer from a bacterium. So far, little is known about the remaining genes involved in this pathway in dinoflagellates. Here we characterize sxtG, an amidinotransferase enzyme gene that putatively encodes the second step in saxitoxin biosynthesis. In this study, the entire sxtG transcripts from Alexandrium fundyense CCMP1719 and Alexandrium minutum CCMP113 were amplified and sequenced. The transcripts contained typical dinoflagellate spliced leader sequences and eukaryotic poly(A) tails. In addition, partial sxtG transcript fragments were amplified from four additional Alexandrium species and Gymnodinium catenatum. The phylogenetic inference of dinoflagellate sxtG, congruent with sxtA, revealed a bacterial origin. However, it is not known if sxtG was acquired independently of sxtA. Amplification and sequencing of the corresponding genomic sxtG region revealed noncanonical introns. These introns show a high interspecies and low intraspecies variance, suggesting multiple independent acquisitions and losses. Unlike sxtA, sxtG was also amplified from Alexandrium species not known to synthesize saxitoxin. However, amplification was not observed for 22 non-saxitoxin-producing dinoflagellate species other than those of the genus Alexandrium or G. catenatum. This result strengthens our hypothesis that saxitoxin synthesis has been secondarily lost in conjunction with sxtA for some descendant species.

Putative Monofunctional Type I Polyketide Synthase Units: A Dinoflagellate-Specific Feature?

Marine dinoflagellates (alveolata) are microalgae of which some cause harmful algal blooms and produce a broad variety of most likely polyketide synthesis derived phycotoxins. Recently, novel polyketide synthesase (PKS) transcripts have been described from the Florida red tide dinoflagellate Karenia brevis (gymnodiniales) which are evolutionarily related to Type I PKS but were apparently expressed as monofunctional proteins, a feature typical of Type II PKS. Here, we investigated expression units of PKS I-like sequences in Alexandrium ostenfeldii (gonyaulacales) and Heterocapsa triquetra (peridiniales) at the transcript and protein level. The five full length transcripts we obtained were all characterized by polyadenylation, a 3′ UTR and the dinoflagellate specific spliced leader sequence at the 5′end. Each of the five transcripts encoded a single ketoacylsynthase (KS) domain showing high similarity to K. brevis KS sequences. The monofunctional structure was also confirmed using dinoflagellate specific KS antibodies in Western Blots. In a maximum likelihood phylogenetic analysis of KS domains from diverse PKSs, dinoflagellate KSs formed a clade placed well within the protist Type I PKS clade between apicomplexa, haptophytes and chlorophytes. These findings indicate that the atypical PKS I structure, i.e., expression as putative monofunctional units, might be a dinoflagellate specific feature. In addition, the sequenced transcripts harbored a previously unknown, apparently dinoflagellate specific conserved N-terminal domain. We discuss the implications of this novel region with regard to the putative monofunctional organization of Type I PKS in dinoflagellates.

5′-Terminal chemical capping of spliced leader RNAs

Spliced leader (SL) RNA trans-splicing adds a N2,N2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5′ end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5′-terminal capped MMG and TMG wild-type, and mutant 22nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3′ biotin tag.

Nucleus‐encoded mRNAs for Chloroplast Proteins GapA, PetA, and PsbO are Trans‐spliced in the Flagellate Euglena gracilis Irrespective of Light and Plastid Function

Euglena gracilis is a fresh-water flagellate possessing secondary chloroplasts of green algal origin. In contrast with organisms possessing primary plastids, mRNA levels of nucleus-encoded genes for chloroplast proteins in E. gracilis depend on neither light nor plastid function. However, it remains unknown, if all these mRNAs are trans-spliced and possess spliced leader sequence at the 5'-end and if trans-splicing depends on light or functional plastids. This study revealed that polyadenylated mRNAs encoding the chloroplast proteins glyceraldehyde-3-phosphate dehydrogenase (GapA), cytochrome f (PetA), and subunit O of photosystem II (PsbO) are trans-spliced irrespective of light or plastid function.

Cloning and characterization of a selenium-independent glutathione peroxidase (HC29) from adultHaemonchus contortus

The complete coding sequence of Haemonchus (H.) contortus HC29 cDNA was generated by rapid amplification of cDNA ends in combination with PCR using primers targeting the 5'- and 3'-ends of the partial mRNA sequence. The cloned HC29 cDNA was shown to be 1,113 bp in size with an open reading frame of 507 bp, encoding a protein of 168 amino acid with a calculated molecular mass of 18.9 kDa. Amino acid sequence analysis revealed that the cloned HC29 cDNA contained the conserved catalytic triad and dimer interface of selenium-independent glutathione peroxidase (GPX). Alignment of the predicted amino acid sequences demonstrated that the protein shared 44.7~80.4% similarity with GPX homologues in the thioredoxin-like family. Phylogenetic analysis revealed close evolutionary proximity of the GPX sequence to the counterpart sequences. These results suggest that HC29 cDNA is a GPX, a member of the thioredoxin-like family. Alignment of the nucleic acid and amino acid sequences of HC29 with those of the reported selenium-independent GPX of H. contortus showed that HC29 contained different types of spliced leader sequences as well as dimer interface sites, although the active sites of both were identical. Enzymatic analysis of recombinant prokaryotic HC29 protein showed activity for the hydrolysis of H2O2. These findings indicate that HC29 is a selenium-independent GPX of H. contortus.

Comparative Genomic and Transcriptomic Characterization of the Toxigenic Marine Dinoflagellate Alexandrium ostenfeldii

Many dinoflagellate species are notorious for the toxins they produce and ecological and human health consequences associated with harmful algal blooms (HABs). Dinoflagellates are particularly refractory to genomic analysis due to the enormous genome size, lack of knowledge about their DNA composition and structure, and peculiarities of gene regulation, such as spliced leader (SL) trans-splicing and mRNA transposition mechanisms. Alexandrium ostenfeldii is known to produce macrocyclic imine toxins, described as spirolides. We characterized the genome of A. ostenfeldii using a combination of transcriptomic data and random genomic clones for comparison with other dinoflagellates, particularly Alexandrium species. Examination of SL sequences revealed similar features as in other dinoflagellates, including Alexandrium species. SL sequences in decay indicate frequent retro-transposition of mRNA species. This probably contributes to overall genome complexity by generating additional gene copies. Sequencing of several thousand fosmid and bacterial artificial chromosome (BAC) ends yielded a wealth of simple repeats and tandemly repeated longer sequence stretches which we estimated to comprise more than half of the whole genome. Surprisingly, the repeats comprise a very limited set of 79–97 bp sequences; in part the genome is thus a relatively uniform sequence space interrupted by coding sequences. Our genomic sequence survey (GSS) represents the largest genomic data set of a dinoflagellate to date. Alexandrium ostenfeldii is a typical dinoflagellate with respect to its transcriptome and mRNA transposition but demonstrates Alexandrium-like stop codon usage. The large portion of repetitive sequences and the organization within the genome is in agreement with several other studies on dinoflagellates using different approaches. It remains to be determined whether this unusual composition is directly correlated to the exceptionally genome organization of dinoflagellates with a low amount of histones and histone-like proteins.

Spliced leader sequences detected in EST data of the dinoflagellates Cochlodinium polykrikoides and Prorocentrum minimum

Spliced leader (SL) trans-splicing is a mRNA processing mechanism in dinoflagellate nuclear genes. Although studies have identified a short, conserved dinoflagellate SL (dinoSL) sequence (22-nt) in their nuclear-encoded transcripts, whether the majority of nuclear-coded transcripts in dinoflagellates have the dinoSL sequence remains doubtful. In this study, we investigated dinoSL-containing gene transcripts using 454 pyrosequencing data (Cochlodinium polykrikoides, 93 K sequence reads, 31 Mb; Prorocentrum minimum, 773 K sequence reads, 291 Mb). After making comparisons and performing local BLAST searches, we identified dinoSL for one C. polykrikoides gene transcript and eight P. minimum gene transcripts. This showed transcripts containing the dinoSL sequence were markedly fewer in number than the total expressed sequence tag (EST) transcripts. In addition, we found no direct evidence to prove that most dinoflagellate nuclear-coded transcripts have this dinoSL sequence.

Discovery of Nuclear-Encoded Genes for the Neurotoxin Saxitoxin in Dinoflagellates

Saxitoxin is a potent neurotoxin that occurs in aquatic environments worldwide. Ingestion of vector species can lead to paralytic shellfish poisoning, a severe human illness that may lead to paralysis and death. In freshwaters, the toxin is produced by prokaryotic cyanobacteria; in marine waters, it is associated with eukaryotic dinoflagellates. However, several studies suggest that saxitoxin is not produced by dinoflagellates themselves, but by co-cultured bacteria. Here, we show that genes required for saxitoxin synthesis are encoded in the nuclear genomes of dinoflagellates. We sequenced >1.2×106 mRNA transcripts from the two saxitoxin-producing dinoflagellate strains Alexandrium fundyense CCMP1719 and A. minutum CCMP113 using high-throughput sequencing technology. In addition, we used in silico transcriptome analyses, RACE, qPCR and conventional PCR coupled with Sanger sequencing. These approaches successfully identified genes required for saxitoxin-synthesis in the two transcriptomes. We focused on sxtA, the unique starting gene of saxitoxin synthesis, and show that the dinoflagellate transcripts of sxtA have the same domain structure as the cyanobacterial sxtA genes. But, in contrast to the bacterial homologs, the dinoflagellate transcripts are monocistronic, have a higher GC content, occur in multiple copies, contain typical dinoflagellate spliced-leader sequences and eukaryotic polyA-tails. Further, we investigated 28 saxitoxin-producing and non-producing dinoflagellate strains from six different genera for the presence of genomic sxtA homologs. Our results show very good agreement between the presence of sxtA and saxitoxin-synthesis, except in three strains of A. tamarense, for which we amplified sxtA, but did not detect the toxin. Our work opens for possibilities to develop molecular tools to detect saxitoxin-producing dinoflagellates in the environment.

Identification of a voltage‐gated proton channel gene in Karlodinium veneficum

Karlodinium veneficum, an ichthyotoxic dinoflagellate, is responsible for massive fish kills through the release of toxins (karlotoxins). The mechanism of release of the karlotoxin has not been elucidated. In bioluminescent dinoflagellates such as Noctiluca milaris and Lingulodinium polyhedra, voltage-gated proton channels serve as an unusual type of ion channel exhibiting several unique properties. It is known that voltage-gated proton channels form a low resistance pathway across the cell membrane that allows for the passage of particular ionic species in a controlled manner. Therefore, it was hypothesized that a voltage-gated proton channel is present in K. veneficum and that permits the release of the karlotoxins. Identification of the gene suspected to code for this channel in the Karlodinium genome was accomplished using an EST library database created at University of Maryland Biotechnology Institute. The 5′ end of the suspected proton channel gene in K. veneficum strain 1609 was identified and sequenced revealing the splice leader sequence at the 5′ end, four transmembrane domains and similarity with the EST identified in strain 2778. The 3′ end of the gene was not successfully sequenced. This gene will be ligated into a vector for expression which will permit for the study of its role in the release of karlotoxins. Supported by NIH 5T34GM008411

Aberrant transcription and post-transcriptional processing of hepatitis C virus non-structural genes in transgenic mice

Hepatitis C virus (HCV) infection is a leading cause of chronic liver disease worldwide. Since several aspects of the infection remain unresolved, there is a pressing need for a convenient animal model that can mimic the clinical disease and aid the evaluation of treatment strategies. Although some success has been achieved in transgenic approaches for development of rodent models of HCV, transgenic expression of the complete HCV polyprotein or an entire set of the viral non-structural (NS) proteins continues to be a serious challenge. Using northern blot and 5' rapid amplification of cDNA ends (RACE), we unraveled two possible mechanisms that can impede HCV NS transgene expression in the mouse liver. Several truncated transcripts are produced from alternate transcription start sites along the HCV NS sequence within the murine environment, in vivo. Translation of these shorter transcripts is blocked either by the positioning of a contextual stop codon or through a shift in the reading frame. In addition, the complete NS transcript undergoes trans-splicing through 5' recombination with a non-transgene-derived, spliced leader sequence that appends a potential stop codon upstream of the translation start. These findings thus demonstrate that HCV NS-derived transgenes are subject to aberrant transcriptional initiation and post-transcriptional processing in the nucleus of a mouse host. Strategies to prevent such aberrant transcription start/RNA processing might be key to the development of a successful HCV transgenic mouse model.

Analysis of a botryllid enriched-full-length cDNA library: insight into the evolution of spliced leader trans-splicing in tunicates

In some animals, mRNA may be modified after transcription by the addition of a 5' spliced leader sequence. This is known as spliced leader (SL) trans-splicing, and is of uncertain function and evolutionary origin. Here, we report the identification of SL trans-splicing in the colonial ascidian Botryllus schlosseri. Combining our own expressed sequence tag (EST) data with additional data from GenBank, we identify the dominant spliced leader sequence and show it to be similar to that of other ascidians and to that of Oikopleura dioica, a basally diverging tunicate. Gene Ontology analysis of B. schlosseri ESTs with and without a 5' spliced leader shows that genes encoding ribosomal proteins tend not to be trans-spliced, a character shared with the ascidian Ciona intestinalis. We also examine individual cases of genes that produce mRNAs that are SL trans-spliced in B. schlosseri but not in C. intestinalis. We conclude that SL trans-splicing evolved early in the tunicate lineage and shows stability over considerable evolutionary time. However, SL trans-splicing may be gained or lost in individual genes.

Development of a dual reporter system to identify regulatory cis-acting elements in untranslated regions of Trypanosoma cruzi mRNAs

In trypanosomatids, transcription is polycistronic and gene expression control occurs mainly at the post-transcriptional level. To investigate the role of sequences present in the 3′UTR of stage-specific mRNAs of Trypanosoma cruzi, we generated a new vector, named pTcDUALuc, containing the firefly and Renilla luciferase reporter genes. To test this vector, sequences derived from the 3′UTR plus intergenic regions of the alpha tubulin gene, which is up-regulated in epimastigotes, and amastin, which is up-regulated in amastigotes, were inserted downstream from the firefly reporter gene and luciferase activity was compared in transient and stable transfected parasites. As expected, increased luciferase activity was detected in epimastigotes transiently transfected with pTcDUALuc containing tubulin sequences. Using stable transfected cell lines that were allowed to differentiate into amastigotes, we observed increased luciferase activity and mRNA levels in amastigotes transfected with pTcDUALuc containing amastin sequences. We also showed that the spliced leader sequence and poly-A tail were inserted in the predicted sites of the firefly luciferase mRNA and that deletions in the alpha tubulin 3′UTR resulted in decreased luciferase expression because it affects polyadenylation. In contrast to the constructs containing 3′UTR sequences derived from tubulin and amastin genes, the presence of the 3′UTR from a trans-sialidase gene, whose expression is higher in trypomastigotes, resulted in increased luciferase activity in trypomastigotes without a corresponding increase in luciferase mRNA levels.

Cross-validated methods for promoter/transcription start site mapping in SL trans-spliced genes, established using the Ciona intestinalis troponin I gene.

In conventionally-expressed eukaryotic genes, transcription start sites (TSSs) can be identified by mapping the mature mRNA 5′-terminal sequence onto the genome. However, this approach is not applicable to genes that undergo pre-mRNA 5′-leader trans-splicing (SL trans-splicing) because the original 5′-segment of the primary transcript is replaced by the spliced leader sequence during the trans-splicing reaction and is discarded. Thus TSS mapping for trans-spliced genes requires different approaches. We describe two such approaches and show that they generate precisely agreeing results for an SL trans-spliced gene encoding the muscle protein troponin I in the ascidian tunicate chordate Ciona intestinalis. One method is based on experimental deletion of trans-splice acceptor sites and the other is based on high-throughput mRNA 5′-RACE sequence analysis of natural RNA populations in order to detect minor transcripts containing the pre-mRNA’s original 5′-end. Both methods identified a single major troponin I TSS located ∼460 nt upstream of the trans-splice acceptor site. Further experimental analysis identified a functionally important TATA element 31 nt upstream of the start site. The two methods employed have complementary strengths and are broadly applicable to mapping promoters/TSSs for trans-spliced genes in tunicates and in trans-splicing organisms from other phyla.

Genetic diversity of levamisole receptor subunits in parasitic nematode species and abbreviated transcripts associated with resistance

The molecular mechanisms of levamisole (LEV) activity and expression of resistance remain largely unknown in parasitic nematodes. In contrast, genetic screens for mutants that survive exposure to LEV in the free-living nematode Caenorhabditis elegans have led to the identification of five genes (unc-38, unc-63, unc-29, lev-1 and lev-8) that encode a LEV-sensitive acetylcholine receptor (L-AChR). Loss of these genes leads to LEV resistance. In this study, orthologues of these genes were identified in three species of trichostrongylid nematodes that have a major impact on small ruminants: Haemonchus contortus, Teladorsagia circumcincta and Trichostrongylus colubriformis. Polymorphism associated with LEV resistance have been investigated by comparing transcripts of these subunits in LEV susceptible and LEV-resistant isolates of the three strongylid species. Partial sequences were identified by PCR experiments and full-length cDNA sequences corresponding to AChR subunits in the three trichostrongylid species were obtained using 3'-rapid amplification of cDNA ends-PCR and 5' rapid amplification of cDNA ends anchored with the spliced leader sequence, SL1. Expression of L-AChR subunits was investigated in LEV-resistant and LEV-susceptible isolates of H. contortus, T. circumcincta and T. colubriformis using reverse transcription PCR. We have identified a total of 20 full-length cDNA sequences corresponding to L-AChR subunits in three parasitic trichostrongylid species of which 14 correspond to novel sequences. Genes orthologous to unc-29, unc-63, unc-38 and lev-1 were found in each trichostrongylid species, whereas no gene corresponding to lev-8 has yet been identified. We have found 11 distinct paralogous sequences corresponding to the C. elegans unc-29 gene clustered in four groups revealing an unexpected diversity of unc-29-like genes. Complete coding sequences of the L-AChR subunits in two LEV-resistant and three susceptible isolates of H. contortus, T. circumcincta and T. colubriformis were essentially unchanged, but abbreviated transcripts of the unc-63 subunit were specifically expressed in resistant isolates of all three species. The candidate gene strategy developed in this study revealed an unexpectedly high diversity of L-AChR subunits specific to the trichostrongylid parasites that are a principal target for the drug LEV. Abbreviated variants, predicted to produce nonfunctional unc-63, were associated with LEV resistance. This study contributes significantly to a better understanding of LEV receptor constitution in parasitic nematodes and highlights the putative role of aberrant mRNA encoding L-AChR subunits in LEV resistance.

Processing of a phosphoglycerate kinase reporter mRNA in Trypanosoma brucei is not coupled to transcription by RNA polymerase II

Capping of mRNAs is strictly coupled to RNA polymerase II transcription and there is evidence, mainly from metazoans, that other steps in pre-mRNA processing show a similar linkage. In trypanosomes, however, the mRNA cap is supplied by a trans spliced leader sequence. Thus pre-mRNAs transcribed by RNA Polymerase I are capped by trans splicing, and translation-competent transgenic mRNAs can be produced by RNA Polymerase I and T7 RNA polymerase so long as the primary transcript has a splice acceptor signal. We quantified the efficiency of processing of trypanosome pre-mRNAs produced from a plasmid integrated either at the tubulin locus, or in an rRNA spacer, and transcribed by RNA polymerase II, RNA polymerase I or T7 RNA polymerase. The processing efficiencies were similar for primary transcripts from the tubulin locus, produced by RNA polymerase II, and for RNA from an rRNA spacer, transcribed by RNA polymerase I. Primary transcripts produced by T7 RNA polymerase from the tubulin locus were processed almost as well. There was therefore no evidence for recruitment of the 3′-splicing apparatus by the RNA polymerase. Abundant transcripts transcribed from the rRNA locus by T7 RNA polymerase were somewhat less efficiently processed.

The Nematode Eukaryotic Translation Initiation Factor 4E/G Complex Works with a trans-Spliced Leader Stem-Loop To Enable Efficient Translation of Trimethylguanosine-Capped RNAs

Eukaryotic mRNA translation begins with recruitment of the 40S ribosome complex to the mRNA 5' end through the eIF4F initiation complex binding to the 5' m(7)G-mRNA cap. Spliced leader (SL) RNA trans splicing adds a trimethylguanosine (TMG) cap and a sequence, the SL, to the 5' end of mRNAs. Efficient translation of TMG-capped mRNAs in nematodes requires the SL sequence. Here we define a core set of nucleotides and a stem-loop within the 22-nucleotide nematode SL that stimulate translation of mRNAs with a TMG cap. The structure and core nucleotides are conserved in other nematode SLs and correspond to regions of SL1 required for early Caenorhabditis elegans development. These SL elements do not facilitate translation of m(7)G-capped RNAs in nematodes or TMG-capped mRNAs in mammalian or plant translation systems. Similar stem-loop structures in phylogenetically diverse SLs are predicted. We show that the nematode eukaryotic translation initiation factor 4E/G (eIF4E/G) complex enables efficient translation of the TMG-SL RNAs in diverse in vitro translation systems. TMG-capped mRNA translation is determined by eIF4E/G interaction with the cap and the SL RNA, although the SL does not increase the affinity of eIF4E/G for capped RNA. These results suggest that the mRNA 5' untranslated region (UTR) can play a positive and novel role in translation initiation through interaction with the eIF4E/G complex in nematodes and raise the issue of whether eIF4E/G-RNA interactions play a role in the translation of other eukaryotic mRNAs.