Spleen Phosphodiesterase Research Articles

PLD3 and PLD4 are single-stranded acid exonucleases that regulate endosomal nucleic-acid sensing.

Leukocyte sensing of microbial genetic material often elicits beneficial proinflammatory cytokines, but dysregulated responses can cause severe pathogenesis. Genome-wide association studies have linked Phospholipase D3 (PLD3) to Alzheimer’s disease and PLD4 to rheumatoid arthritis and systemic sclerosis. PLD3 and PLD4 are endolysosomal proteins whose functions are obscure. PLD4-deficient mice were found to have an inflammatory disease, marked by elevated interferon-γ (IFN-γ) and splenomegaly. These phenotypes were traced to an altered responsiveness of PLD4-deficient dendritic cells to ligands of the single-stranded DNA (ssDNA) sensor Toll-like receptor 9 (TLR9). Macrophages from PLD3-deficient mice also had exaggerated TLR9 responses. Although PLD4 and PLD3 were presumed to be phospholipases, we found that they are 5′ exonucleases, likely identical to spleen phosphodiesterase, that break down TLR9 ligands. Mice deficient in both PLD3 and PLD4 developed lethal early life liver inflammation indicating that both enzymes are required to regulate inflammatory cytokine responses by degradation of nucleic acids.

Acyclic analogs of nucleosides based on tris(hydroxymethyl)phosphine oxide: synthesis and incorporation into short DNA oligomers

Abstract Tris-(hydroxymethyl)phosphine oxide (THPO) to a certain extent resembles a part of 2′-deoxyribofuranose, although it exists in an acyclic form only and the oxygen atom at the THPO phosphorus center provides additional hydration site or acceptor of hydrogen bonds. After proper protection of hydroxyl groups, THPO was functionalized with nucleobases and converted into phosphoramidite monomers suitable for incorporation into growing oligonucleotide chains within the solid phase synthesis protocol. The resultant THPO-DNA analogs show reduced affinity to complementary DNA strands, and are resistant towards snake venom and calf spleen exonucleases.

An RNA modification with remarkable resistance to RNase A

A 3'-deoxy-3'-C-methylenephosphonate modified diribonucleotide is highly resistant to degradation by spleen phosphodiesterase and not cleaved at all by snake venom phosphodiesterase. The most remarkable finding is that, despite the fact that both the vicinal 2-hydroxy nucleophile and the 5'-oxyanion leaving group are intact, the 3'-methylenephosponate RNA modification is also highly resistant towards the action of RNase A.

Endonuclease and Exonuclease Activities on Oligodeoxynucleotides Containing Spiroiminodihydantoin Depend on the Sequence Context and the Lesion Stereochemistry.

8-Oxo-7,8-dihydro-2'-deoxyguanosine (dOG), a well-studied oxidation product of 2'-deoxyguanosine (dG), is prone to facile further oxidation forming spiroiminodihydantoin 2'-deoxyribonucleoside (dSp) in the nucleotide pool and in single-stranded oligodeoxynucleotides (ODNs). Many methods for quantification of damaged lesions in the genome rely on digestion of DNA with exonucleases or endonucleases and dephosphorylation followed by LC-MS analysis of the resulting nucleosides. In this study, enzymatic hydrolysis of dSp-containing ODNs was investigated with snake venom phosphodiesterase (SVPD), spleen phosphodiesterase (SPD) and nuclease P1. SVPD led to formation of a dinucleotide, 5'-d(Np[Sp])-3' (N = any nucleotide) that included the undamaged nucleotide on the 5' side of dSp as the final product. This dinucleotide was a substrate for both SPD and nuclease P1. A kinetic study of the activity of SPD and nuclease P1 showed a sequence dependence on the nucleotide 5' to the lesion with rates in the order dG>dA>dT>dC. In addition, the two diastereomers of dSp underwent digestion at significantly different rates with dSp1>dSp2; nuclease P1 hydrolyzed the 5'-d(Np[Sp1])-3' dinucleotide two- to six-fold faster than the corresponding 5'-d(Np[Sp2])-3', while for SPD the difference was two-fold. These rates are chemically reasoned based on dSp diastereomer differences in the syn vs. anti glycosidic bond orientation. A method for the complete digestion of dSp-containing ODNs is also outlined based on treatment with nuclease P1 and SVPD. These findings have significant impact on the development of methods to detect dSp levels in cellular DNA.

Optimized enzymatic hydrolysis of DNA for LC–MS/MS analyses of adducts of 1-methoxy-3-indolylmethyl glucosinolate and methyleugenol

Mass spectrometric analyses of DNA adducts usually require enzymatic digestion of the DNA to nucleosides. The digestive enzymes used in our laboratory included a calf spleen phosphodiesterase, whose marketing was stopped recently. Using DNA adducted with bioactivated methyleugenol and 1-methoxy-3-indolylmethyl glucosinolate—each forming dA and dG adducts—we demonstrate that replacement of calf spleen phosphodiesterase (Merck) with bovine spleen phosphodiesterase (Sigma–Aldrich) leads to unchanged results. Enzyme levels used for DNA digestion are extremely variable in different studies. Therefore, we sequentially varied the level of each of the three enzymes used. All dose (enzyme)–response (adduct level) curves involved a long plateau starting below the enzyme levels employed previously. Thus, we could reduce the amounts of micrococcal nuclease, phosphodiesterase, and alkaline phosphatase for quantitative DNA digestion by factors of 4, 2, and 333, respectively, compared to our previous protocols. Moreover, we observed significant phosphatase activity of both phosphodiesterase preparations used, which may affect the recovery of adducts with methods requiring digestion to 2′-deoxynucleoside-3′-monophosphates (e.g., 32P-postlabeling). In addition, the phosphodiesterase from Sigma–Aldrich, but not that from Merck, deaminated dA. This was irrelevant for the dA adducts studied, involving bonding at N6, but might complicate the analysis of other dA adducts.

Templated synthesis of nylon nucleic acids and characterization by nuclease digestion.

Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2'-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control.

Synthesis, physico-chemical and biological properties of DNA and RNA oligonucleotides containing short alkylamino internucleotide bond

The condensation of the 5′-O-DMT-3′-deoxy-3′-aminothymidine with 3′-O-TBDMS-thymidine- 5′-aldehyde, followed by reduction of the resultant imine derivative and removal of tert-butyldimethylsilyl (TBDMS) protecting group, provided a dimer (denoted as TNHT), which is a congener of dithymidine phosphate with the phosphate linkage 3′-O-P(O)(OH)-O-5′ replaced with an amino group (–NH–). After phosphitylation of the 3′-OH group, the dimer TNHT was introduced (by the standard phosphoramidite approach) into a central part of the nonadecathymidylate. This oligomer exhibited lower affinity to the complementary single and double stranded DNA complements as compared to unmodified T19 oligonucleotide. The cleavage of modified oligomer with the snake venom and calf spleen phosphodiesterases was completely suppressed at the site of modification. RNA oligomers containing the TNHT dimer were used for preparation of siRNA molecules directed towards mRNA of BACE1 (beta-site amyloid precursor protein cleaving enzyme). The presence of the TNHT units at the 3′-ends of the RNA strands of the siRNA molecule (the siRNA itself is an effective gene expression inhibitor for BACE1) preserved the gene silencing activity and improved the stability of the modified siRNA in 10% fetal bovine serum.

METHODS FOR AROMATIC AND HETEROCYCLIC AMINE CARCINOGEN-DNA ADDUCT ANALYSIS BY LIQUID CHROMATOGRAPHY-TANDEM MASS SPECTROMETRY

Xenobiotic-DNA adducts are used as biomarkers to assess the genotoxic effects of carcinogens. Rats were dosed with 4-aminobiphenyl (4-ABP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), or 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). DNA was isolated from the colons of vehicle and carcinogen-treated rats and digested using different nucleases and alkaline phosphatase. Deoxyribonucleoside adducts were quantified by capillary liquid chromatography-tandem mass spectrometry (LC-MS/MS) using isotope dilution methods with deuterated internal standards. Major adducts were those bound to the C8 position of deoxyguanosine. 3′- and 5′- Exonucleases were the most efficient nucleases at isolating dG-C8-ABP adducts. However, bulky adducts such as dG-C8-MeIQx and dG-C8-PhIP were better isolated using nuclease P1 rather than a combination of micrococcal nuclease and spleen phosphodiesterase. The use of DNase I enhanced the detection of all three adducts. We describe LC-MS/MS methods for DNA adduct detection and support the testing of different nucleases that increase DNA digestion efficiency and make available more DNA adducts for detection.

The 4-(N-Dichloroacetyl-N-methylamino)benzyloxymethyl Group for 2‘-Hydroxyl Protection of Ribonucleosides in the Solid-Phase Synthesis of Oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

32P-Post-labelling method improvements for aromatic compound-related molecular epidemiology studies

The (32)P-post-labelling assay has emerged as a major tool for detecting bulky DNA adducts in subjects exposed to carcinogens, especially aromatic compounds. However, the (32)P-post-labelling protocol still requires the use of high amounts of radioactivity, i.e. 25-50 muCi per sample, an obstacle that limits its use in large studies. The characterization of the DNA adducts measured is also limited. Methodological improvements and increased DNA adduct characterization are necessary to make this assay capable of achieving higher throughput. A new protocol was tested to ensure efficient hydrolysis to reduce the use of radioactive material and to obtain higher chromatography resolution. Different chromatography systems based on high-urea or ammonium hydroxide systems were also employed to characterize the adducts being measured. Improvements were tested by re-analysing DNA adducts in a group of police officers and urban residents in Genoa, Italy. The analysis of carcinogen-modified DNA standards was also included in the study for qualitative and quantitative comparison. An efficient DNA digestion was obtained using a method involving hydrolysis by micrococcal nuclease and a mixture of two spleen phosphodiesterases at fixed concentrations. A 72% reduction of the amount of radioactivity used for labelling was achieved in respect to the non-modified protocol without loss of DNA adduct sensitivity. An improved chromatography resolution was obtained by reducing the volume of sample to be spotted on the chromatogram. Lower volume of spotting sample can decrease sample diffusion and the formation of unresolved spots on the thin-layer chromatography plate. The amount of output produced using a single batch of carrier-free [gamma-(32)P]ATP was increased by about 3.5-fold. A complex pattern of DNA adducts was observed in leukocytes using both high-urea or isopropanol-ammonium hydroxide systems, two techniques effective in the detection of aromatic DNA adducts. The above observations indicate that DNA adducts being measured are likely to have been induced by aromatic compounds.

Characterization of a New Thermophilic Spore Photoproduct Lyase from Geobacillus stearothermophilus (SplG) with Defined Lesion Containing DNA Substrates

The Geobacillus stearothermophilus splG gene encodes a thermophilic spore photoproduct lyase (SplG) that belongs to the family of radical S-adenosylmethionine (AdoMet) enzymes. The aerobically purified apo-SplG forms a homodimer, which contains one [4Fe-4S] cluster per monomer unit after reconstitution to the holoform. Formation of the [4Fe-4S] cluster was proven by quantification of the amount of iron and sulfur per homodimer and by UV and EPR spectroscopy. The UV spectrum features a characteristic absorbance at 420 nm typical for [4Fe-4S] clusters, and the EPR data were found to be identical to those of other proteins containing an [4Fe-4S]+ center. Probing of the activity of the holo-SplG with oligonucleotides containing one spore photoproduct lesion at a defined site proved that the enzyme is able to turn over substrate. In addition to repair, we observed cleavage of AdoMet to generate 5'-deoxyadenosine. In the presence of aza-AdoMet the SplG is completely inhibited, which provides direct support for the repair mechanism.

A Novel Class of DNA Analogs Bearing 5′-C-Phosphonothymidine Units: Synthesis and Physicochemical and Biochemical Properties

S(C) and R(C) diastereomers of 5'-C-(O,O-diethyl)-phosphonylthymidine ((R)T and (S)T) were used for the synthesis of the dimers T(R)T and T(S)T, respectively. These dimers were incorporated at selected sites in oligonucleotide constructs. Melting temperature (Tm) experiments demonstrated that relative to the unmodified oligodeoxyribonucleotide, the presence of the (R)T moiety reduced the thermal stability of the duplexes by approximately 5.0 degrees C per modification, whereas their (S)T counterparts only slightly destabilized the duplex structure (deltaTm < or = 1 degree C/modification). The stability of the triple-helical complexes containing one, two, or three modified thymidines is slightly higher than that of the parent complex. Nuclease resistance studies performed with snake venom phosphodiesterase, calf spleen phosphodiesterase, and 3'-exonuclease from human plasma showed that cleavage of the oligonucleotides at the site of the modification was completely suppressed regardless of the stereochemistry of the 5'-C-chiral center. The influence of the (R)T and (S)T modification in the recognition sequence of HindIII, EcoRI, and HpaI restriction endonucleases was also investigated. Although the catalytic activity of HindIII was not affected by the presence of the 5'-C-ethoxyphosphonyl modification, the activities of the two remaining restriction enzymes were partially suppressed depending on the site of modification or the stereochemistry of the modification or both ((R)T vs. (S)T).

Identification of the α and β Anomers of 1-(2-Deoxy-d-Erythro-Pentofuranosyl)-Oxaluric Acid at the Site of Riboflavin-mediated Photooxidation of Guanine in 2′-Deoxyguanosine and Thymidylyl-(3′-5′)-2′-Deoxyguanosine†

Products of riboflavin-mediated photosensitization of 2'-deoxyguanosine (dG) and thymidylyl-(3'-5')-2'-deoxyguanosine (TpdG) by 350-nm light in oxygen-saturated aqueous solution have been isolated and identified as 1-(2-deoxy-beta-D-erythro-pentofuranosyl) oxaluric acid (beta-dOx) and thymidylyl-(3'-5')-1-(2-deoxy-beta-D-erythro-pentofuranosyl) oxaluric acid (Tpbeta-dOx), respectively. In aqueous solution the modified beta-deoxyribonucleoside is slowly converted to the alpha-anomer, generating alpha-dOx and Tpalpha-dOx. These modified nucleosides and dinucleoside monophosphates have been isolated by HPLC and characterized by proton and carbon NMR spectroscopy, fast atom bombardment mass spectrometry, and enzymatic analyses. Both alpha-dOx and Tpalpha-dOx slowly convert back into the modified beta-deoxyribonucleoside, indicating that the furanosidic anomers are in dynamic equilibrium. Relative to TpdG, the rate of hydrolysis of Tpbeta-dOx and Tpalpha-dOx by spleen phosphodiesterase is greatly reduced. Hot piperidine (1.0 M, 90 degrees C, 30 min) destroys Tpbeta-dOx and Tpalpha-dOx. Riboflavin-mediated photosensitization of TpdG in D2O instead of H2O has no detectable effect on the yield of Tpbeta-dOx, suggesting that oxaluric acid is generated through a Type-I reaction mechanism, likely through the intermediary on initially generated 8-oxo-7,8-dihydro-2'-deoxyguanosine.

A General Method for the Synthesis of 2‘-O-Cyanoethylated Oligoribonucleotides Having Promising Hybridization Affinity for DNA and RNA and Enhanced Nuclease Resistance

[reaction: see text] An effective method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides as a new class of 2'-O-modified RNAs was developed. The reaction of appropriately protected ribonucleoside derivatives with acrylonitrile in t-BuOH in the presence of Cs2CO3 gave 2'-O-cyanoethylated ribonucleoside derivatives in excellent yields, which were converted by a successive selective deprotection/protection strategy to 2'-O-cyanoethylated 5'-O-dimethoxytritylribonucleoside 3'-phosphoramidite derivatives in high yields. Fully 2'-O-cyanoethylated oligoribonucleotides, (Uce)12 and (GceAceCceUce)3, were successfully synthesized in the phosphoramidite approach by use of the phosphoramidite building blocks. It was also found that oligoribonucleotides having a 2'-O-cyanoethylated ribonucleoside (Uce, Cce, Ace, or Gce) could be obtained by the selective removal of the TBDMS group from fully protected oligoribonucleotide intermediates without loss of the cyanoethyl group by use of NEt3 x 3HF as a desilylating reagent. The detailed T(m) experiments revealed that oligoribonucleotides containing 2'-O-cyanoethylated ribonucleosides have higher hybridization affinity for both DNA and RNA than the corresponding unmodified and 2'-O-methylated oligoribonucleotides. In addition, introduction of a cyanoethyl group into the 2'-position of RNA resulted in significant increase of nuclease resistance toward snake venom and bovine spleen phosphodiesterases compared with that of the methyl group.

Reminiscences of Leon A. Heppel

Reminiscences of Leon A. Heppel

Selective digestion and novel cleanup techniques for detection of benzo[a]pyrene diol epoxide-DNA adducts by capillary electrophoresis/mass spectrometry.

Benzo[a]pyrene (BP) is a ubiquitous environmental polycyclic aromatic hydrocarbon (PAH) which, upon metabolic conversion to reactive benzo[a]pyrene-7,8-diol-9,10-epoxide (BPDE), has been found to attach covalently to DNA. Given the low level of DNA adducts typically present in vivo or in vitro, an essential first step prior to capillary electrophoresis/mass spectrometry (CE/MS) (or liquid chromatography/mass spectrometry (LC/MS)) analysis of the DNA digests is the removal of the bulk non-adducted nucleotides, enzymes or salts, and isolation of enriched adducts. This report focuses on the development of novel sample handling methods aimed at facilitating the analysis of BPDE-DNA adducts by CE/MS. This approach involves a simple variation on the digestion procedure, in combination with the use of metal affinity ZipTips for the more efficient cleanup of BPDE-DNA adducts formed in vitro for subsequent CE/MS analysis. The previously described digestion procedure, consisting of micrococcal nuclease, spleen phosphodiesterase and nuclease P1, allows for selective dephosphorylation of normal nucleotides, while leaving adducted nucleotides intact. Metal affinity ZipTips, typically used for selective extraction of phosphopeptides, were used here for extraction of adducted nucleotides. The utility of metal affinity SPE was tested on mixtures of dG and dGp, wherein nucleotide extracts contained no detectable nucleosides by CE/UV analysis. An in vitro BPDE-DNA incubation was then digested using the above procedure. Metal affinity solid-phase extraction (SPE) was subsequently used for the selective isolation of phosphorylated components, i.e., adducted nucleotides, from the mixture of enzymes and non-adducted nucleosides. SPE extracts were enriched in nucleotide adducts and analyzed using sample stacking and CE/MS. This method has several advantages over previously described cleanup procedures for dGp-BPDE adducts: fast, simple, uses commercially available materials, no need for excessive dilution (small scale), the suitability for use with automation, and possible applicability to other bulky hydrophobic adducts.

Template‐Mediated Synthesis of Lariat RNA and DNA.

Nucleic acid have been of great interest to the biological community since their discovery two decades ago as splicing intermediates in the biosynthesis of messenger RNA (lariat RNA introns). We report here the first synthesis of lariat DNA and RNA via template-mediated chemical ligation of Y-shaped oligonucleotides. The method allows for the synthesis of lariat DNA of any base composition as well as the more biologically relevant lariat RNA. Typically, branched precursors and complementary linear templates (splints) were dissolved in an equimolar ratio at a total concentration of 10(-4) M, and ligation was promoted by addition of cyanogen bromide in a pH 7.6 buffer. The template-directed cyclization was very efficient, since the amount of circularized lariat product observed in all cases was in the 40-60% range. The lariats were purified by polyacrylamide gel electrophoresis, and their structure and nucleotide composition confirmed by MALDI-TOF mass spectrometry. Thermal denaturation and circular dichroism studies of lariat:RNA and lariat:DNA duplexes were fully supportive of the isolated lasso structures. Further characterization was conducted by enzymatic degradation with spleen phosphodiesterase (a 3'-exonuclease) and the RNA lariat debranching enzyme, a specific 2',5'-phosphodiesterase.

Template-mediated synthesis of lariat RNA and DNA.

Nucleic acid "lariats" have been of great interest to the biological community since their discovery two decades ago as splicing intermediates in the biosynthesis of messenger RNA (lariat RNA introns). We report here the first synthesis of lariat DNA and RNA via template-mediated chemical ligation of Y-shaped oligonucleotides. The method allows for the synthesis of lariat DNA of any base composition as well as the more biologically relevant lariat RNA. Typically, branched precursors and complementary linear templates ("splints") were dissolved in an equimolar ratio at a total concentration of 10(-4) M, and ligation was promoted by addition of cyanogen bromide in a pH 7.6 buffer. The template-directed cyclization was very efficient, since the amount of circularized lariat product observed in all cases was in the 40-60% range. The lariats were purified by polyacrylamide gel electrophoresis, and their structure and nucleotide composition confirmed by MALDI-TOF mass spectrometry. Thermal denaturation and circular dichroism studies of lariat:RNA and lariat:DNA duplexes were fully supportive of the isolated "lasso" structures. Further characterization was conducted by enzymatic degradation with spleen phosphodiesterase (a 3'-exonuclease) and the RNA lariat debranching enzyme, a specific 2',5'-phosphodiesterase.

Synthesis, Biophysical, and Biochemical Properties of PNA-DNA Chimeras

Three PNA-DNA chimeric dimer synthons (tT, upT and uhT, see Sch. 1) have been synthesized in solution and used to make T20-analogue chimeras applying standard solid-phase DNA synthesis protocol. Duplex forming ability of chimeras with dA20 and their hydrolyses by 3′- and 5′-exonucleases (snake venom and bovine spleen phosphodiesterase, respectively) have been investigated.

Structural characterization of carcinogen-modified oligodeoxynucleotide adducts using matrix-assisted laser desorption/ionization mass spectrometry.

The aim of this study was to determine the chemical structure of in vitro 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-modified oligodeoxynucleotides (ODNs) by exonuclease digestion and matrix-assisted laser desorption/ionization mass spectrometry. A single-stranded 11-mer ODN, 5'-d(CCATCGCTACC), was reacted with N-acetoxy-PhIP, resulting in the formation of one major and eight minor PhIP-ODN adducts. A 10 min treatment of the major and one minor PhIP-ODN adduct with a 3'-exonuclease, bovine intestinal mucosa phosphodiesterase (BIMP), and a 5'-exonuclease, bovine spleen phosphodiesterase, results in inhibition of the primary exonuclease activity at deoxyguanosine (dG) producing 5'-d(CCATCG(PhIP)) and 5'-d(G(PhIP)CTACC) product ions, respectively. Post-source decay (PSD) of these enzymatic end products identifies dG as the sole modification site in two 11-mer ODN-PhIP adducts. PSD of the minor PhIP-ODN adduct digestion end product, 5'-d(CCATCG(PhIP)), also reveals that the PhIP adducted guanine moiety is in an oxidized form. Prolonged treatment of the PhIP-ODN adducts at 37 degrees C with BIMP induces a non-specific, or endonuclease, enzymatic activity culminating in the formation of deoxyguanosine 5'-monophosphate-PhIP (5'-dGMP-PhIP). The PSD fragmentation pattern of the 5'-dGMP-PhIP [M + H](+) ion of the major adduct confirms PhIP binds to the C-8 position of dG. For the minor adduct, PSD results suggest that PhIP binds to the C-8 position of an oxidized guanine, supporting the hypothesis that this adduct arises from oxidative degradation, resulting in a spirobisguanidino structure.