Sperm Suspensions Research Articles

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA.
 Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C.
 To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment.
 Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C.
 Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C.
 The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C.
 The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK).
 Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm.
 Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

Sperm immobilization test and quantitative sperm immobilization test using frozen-thawed sperm preparation applied with computer-aided sperm analysis.

PurposeIn a previous study, a new method was described using the sperm immobilization test (SIT) with computer‐aided sperm analysis (CASA). However, obtaining high‐quality sperm as needed was a known issue. Here, we compared the results of using frozen‐thawed sperm and fresh sperm for the SIT using the CASA method.MethodsFor the frozen‐thawed preparation, 500 μL of condensed semen and 500 μL of Sperm Freeze were mixed in a cryovial and cryopreserved in liquid nitrogen. Density gradient centrifugation was used for the collection of motile sperm in both the fresh and frozen‐thawed sperm preparations. A total of 50 serum samples were prepared for both the fresh and frozen‐thawed sperm with each sample tested containing 10 μL of serum, 1 μL of either fresh or frozen motile sperm suspension, and 2 μL of complement. Sperm motilities were measured using CASA after a 1‐hour incubation period for both fresh and frozen‐thawed sperm.ResultsBoth fresh and frozen‐thawed sperm reacted similarly when exposed to serum containing sperm‐immobilizing antibodies asserting the use of frozen‐thawed sperm for the diagnosis of immunological infertility.ConclusionThese results suggest the possibility of using cryopreserved sperm for the SIT when fresh sperm is unavailable.

Gene Expression Alteration of Sperm-Associated Antigens in Human Cryopreserved Sperm.

Background: Sperm-associated antigens (SPAGs) are 18 types of proteins, some of which play important roles in various biological functions associated with assisted reproductive technology outcomes, and are consequently important to the success of fertility programs. Despite the favorable outcomes of fecundity rates among male patients with cancer using cryopreserved sperm, the detrimental impact of freezing on cells has been noted in many studies. Cryopreservation has been thought to have adverse effects on sperm quality through disruptions in the expressions of SPAG genes. This study aimed to evaluate the effects of cryopreservation on the expressions of SPAGs genes and their transcriptome alterations in human sperm. Materials and Methods: A total of 12 normal ejaculations were prepared using the density gradient centrifugation procedure, and the motile sperm fractions were divided into fresh and frozen groups. In the latter, sperm samples were mixed with SpermFreeze® solution as the cryoprotectant. The cryovial of sperm suspension was first held just over nitrogen vapor and then dipped inside liquid nitrogen. After 3 days, the specimens were thawed in tap water and incubated for 2 hours for recovery. Then, RNA from sperm was extracted for SPAG gene expression analysis, using real-time polymerase chain reaction. Results: Our findings showed a decrease in expression of SPAG5 (p-value = 0.009), SPAG7 (p-value = 0.004), and SPAG12 (SNU13/NHP2L1; p-value = 0.039) genes during cryopreservation. Discussion: The results indicate that the freezing procedure could negatively affect gene expression and to some extent proteins in human spermatozoa. Conclusion: The alteration of SPAG expression could provide new information on the molecular correlation between cryopreservation and increased failure in intracytoplasmic sperm injection and in vitro fertilization.

Efficacy and safety of papaverine as an in vitro motility enhancer on human spermatozoa.

The aim of this study was to examine the ability and safety of papaverine supplementation for in vitro sperm motility enhancement. In addition, sperm motility enhancement of papaverine was compared to pentoxifylline and theophylline. The post-thaw spermatozoa were used as an asthenozoospermia model. Post thaw sperm suspensions were divided into two groups: papaverine (100 μmol/L) and control, and each was investigated in two subgroups of 30- and 60-min exposure times. Detailed motility parameters were detected using a computerized sperm motility analyzer. Acrosomal status, viability, apoptosis, and DNA fragmentation were evaluated by flow cytometry. Furthermore, the motility-enhancing capacity of papaverine, pentoxifylline, and theophylline was compared. Cryopreservation impaired sperm parameters dramatically but no significant changes occurred in acrosomal status and apoptosis. Supplementation of papaverine enhanced motility parameters consistently at all exposure intervals, significantly. However, viability was lower at the 60th minute compared to the 30th minute (p=0.019). Papaverine did not alter any acrosomal or apoptotic markers at any time points. All of the compounds compared in this study increased the motility parameters, where theophylline supplementation provided significantly better improvement in total motility compared to papaverine and pentoxifylline. Our results suggest that in vitro papaverine treatment for 30 min adequately improves motility of post-thaw sperm, without leading to acrosome reaction, DNA damage, and viability loss. Theophylline's potency on increasing the ratio of total motile spermatozoa was found significantly superior than the two tested compounds. Prospective clinical studies with embryo production, pregnancy, and live birth data should be undertaken.

The Effect of PGF2α Injection on Post-Thaw Motility in Sperm of Nubian Goats

This study aims to determine the effect of PGF2α injection on the post-thaw motility (PTM) in sperm of Nubian goats. Three male Nubian goats (3-4 years) with good reproductive ability were used. This study used a 3 x 3 Latin square design. The experimental animals received a physiological NaCl injection as a control (P1); 37.5 mg of PGF2α (P2), and 75 mg of PGF2α (P3). Semen was collected using an artificial vagina with one-week storage intervals between treatments. The collected semen was then diluted and frozen using a simple freezing method. Observation of semen quality before freezing included macroscopic and microscopic examinations. Macroscopic examination consisted of volume, pH, color, odor, and consistency, while microscopic examination consisted of motility, concentration, viability, and abnormality. PTM examination was done by mixing a drop of sperm suspension and one drop of physiological NaCl on an object glass and covered prior to observation under microscope.. The results were analyzed using a Latin square pattern variant analysis, followed by Duncan's test. The PTM values of sperm (%) of Nubian goats in P1, P2, and P3 respectively are 28.71±10.24, 50.03±13.70, and 54.84±12.04 (P<0.05). Injection of PGF2α to Nubian goats by injection increased the PTM.

Evaluation of spermicidal activity of saponosides from Saponaria officinalis/Caryophyllaceae, Glycyrrhizia glabra/Fabaceae and Herniaria glabra/Caryophyllaceae.

Background and objectiveChemical spermicides currently marketed and widely used are known to have many side effects. Thereby, and in order to look for more tolerated natural spermicidal agents, the aim of this work was to evaluate the spermicidal potential of saponin extracts from the roots of Saponaria officinalis/Caryophyllaceae, Glycyrrhizia glabra/Fabaceae, and Herniaria glabra/Caryophyllaceae by studying their in vitro effects on sperm mobility and vitality.MethodsMethanolic saponin extracts from the plants roots were performed. Sperm suspensions were prepared by centrifugation on a PureSperm® density gradient (70 and 45%) and incubated with various concentrations of saponin extracts (50, 250, 500 and 750 μg/mL) at 37°C. The spermicidal activity was evaluated by studying the mobility and vitality of spermatozoa at different time intervals ranging from 10 to 240 minutes.ResultsA dose and time dependent effect on sperm mobility and vitality was observed for our extracts.Extracts from Saponaria officinalis roots induced an irreversible immobilization and a total non-viability of sperm within 10 minutes at a concentration of 750 μg/mL. A similar effect was observed within 30 minutes at 750 μg/mL for Herniaria glabra extract and within 90 minutes at 500 μg/ml for Glycyrrhizia glabra extract.ConclusionThe results of our study showed that the saponin extracts of our plants roots possess potent in vitro dose and time dependant spermicidal effect. These natural products could therefore represent a safer and better tolerated alternative to chemical spermicides.

Aseptic capillary vitrification of human spermatozoa: Cryoprotectant-free vs. cryoprotectant-included technologies

The protocol of aseptic cryoprotectant-free vitrification on human spermatozoa is well documented. However, data about the effect of permeable cryoprotectants at this procedure is limited. Presented study aimed to test the aseptic capillary vitrification technologies using permeable cryoprotectant-included or cryoprotectant-free media. Thirty-two normal samples were included and analyzed after vitrification in three different media and thawing. Three treatment groups were formed: Group 1, basic medium; Group 2, basic medium with 0.25 M sucrose; Group 3, basic medium with glycerol. Before plunging into liquid nitrogen, capillaries were filled by 10 μl of spermatozoa suspension and isolated from liquid nitrogen by location in hermetically closed 0.25 ml straws. Progressive motility, plasma membrane integrity, total motility/viability after 24, 48 and 72 h in vitro culture, apoptosis and mitochondrial membrane potential (ΔΨm) were determined after thawing at 42 °C. Progressive motility of spermatozoa in groups 1, 2, 3 was 24.9 ± 1.7%, 34.5 ± 2.8% and 34.0 ± 1.4%, respectively (P1-2,3<0.05). The plasma membrane integrity of spermatozoa in groups 2 and 3 (48.4 ± 2.9% and 45.5 ± 3.9%, respectively) was higher than in Group 1 (33.3 ± 2.1%, P < 0.05). After 24 h, 48 h and 72 h in vitro culture, the total motility and viability of spermatozoa in Group 1 was significantly lower than Group 2 and Group 3. The apoptosis rate in Group 3 (44.5 ± 3.0%) and Group 2 (47.7 ± 4.1%) were lower than in Group 1 (52.5 ± 4.4%; P < 0.05). ΔΨm rates in Group 3 and Group 2 were higher than in Group 1 (P < 0.05) with no statistical differences between this parameter in Group 2 and Group 3 (P > 0.1). In conclusion, supplementation of medium for aseptic capillary technology for cryoprotectant-free vitrification of human spermatozoa by permeable cryoprotectant does not improve the quality of spermatozoa after warming.

20 Development and Oct4/Cdx2 gene expression of Puma concolor, Leopardus geoffroyi, and Panthera onca hybrid embryos produced using domestic cat oocytes

The development of assisted reproductive technologies (ARTs) in Felidae species has been proposed to guarantee the genetic viability of species that are on the verge of extinction. Investigation of sperm cryopreservation and IVF have been studied in several Felidae species, but the lack of viable homologous oocytes makes assessment of sperm fertilization capacity after cryopreservation difficult. We propose to evaluate the capability of Puma concolor (Pc), Leopardus geoffroyi (Lg), and Panthera onca (Po) cryopreserved sperm to induce domestic cat oocyte fertilization and subsequent pre-implantation embryo development. Additionally, we evaluated blastocyst quality by analysing the gene expression patterns of pluripotency (Oct4) and differentiation (Cdx2) related markers using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). After ovariectomy, domestic cat (Felis catus, Fc) cumulus–oocyte complexes were matured invitro at 38.5°C in a humidified atmosphere of 6.5% CO2 and 21% O2 for 22h. Cryopreserved sperm from Pc, Lg, and Po were used for heterologous IVF. The sperm was frozen using Tes-Tris–based diluent (TEST), and survival, sperm motility, and acrosome integrity were evaluated. The quality post-thaw was satisfactory. The survival was high, sperm motility (65%) did not decrease during incubation post-thaw, and sperm with intact acrosome was 62% for all species. Briefly, straws were thawed by exposing them to air for 10s and then immersing in a 37°C water bath for 30s. The contents of the straws were poured into prewarmed sterile 1.5-mL microtubes. The sperm suspension was diluted (1:3 vol/vol) by the slow (drop by drop) addition of a modified Tyrode’s solution (Pope et al. 2006 Methods Molec. Biol. 254, 227-244). For IVF, invitro matured oocytes (n=635) were co-incubated with 0.5×105 mL−1 motile spermatozoa at 38.5°C in a humidified atmosphere of 6.5% CO2 and 21% O2 for 18 to 20h. Presumptive zygotes were cultured invitro in 50-µL drops of modified Tyrode’s medium in a humidified gas mixture of 5% CO2, 5% O2, and 90% N2 at 38.5°C. Cleavage was determined 48h post-fertilization and blastocyst stage was evaluated at Day 8 and stored in RNA-Later at −20°C until RT-qPCR analysis. Data were analysed by Fisher’s exact test using GraphPad Prism 6.0 (GraphPad Inc.), and differences were considered significant at P&amp;lt;0.05. We observed significantly lower cleavage rates of Po hybrid (hPo) embryos compared with hPc, hLg, and control Fc embryos (41% vs. 57%, 68%, and 58%, respectively). Additionally, we found that the blastocyst rate was higher using Lg sperm compared with sperm of other groups [hLg (50%) vs. hPc (29%), hPo (21%), and Fc (27%)].

Effect of Sodium Nitrate (NaNO3) on Sperm Motility and Abnormality: An In vitro Approach

Nitrates (NO3 ) are the naturally occurring inorganic ions with beneficial effects in both plants and animals. However, NO3 in excess has adverse effect on male and female reproductive systems. The study was undertaken to investigate the effect of 10mg/ ml and 100mg/ml of sodium nitrate (NaNO3 ) on sperm motility and abnormality at different time intervals (5,10,15,20,25 and 30 min). Treatment of cauda epididymal sperm suspension with 10mg/ml of NaNO3 significantly reduced the sperm motility only at 25 and 30 min time intervals compared to controls. However, 100mg/ml of NaNO3 resulted in significant reduction of sperm motility from 5 min to 30 min time interval in time dependent manner and complete loss of sperm motility was observed at 15 min of incubation. In addition, the number of abnormal spermatozoa was significantly high in 100mg/ml of NaNO3 treated groups compared to controls and 10 mg/ml of NaNO3 . These results clearly reflected the toxic effect of NO3 on spermatozoa and its capability in fertilization.

Both Cauda and Caput Epididymal Sperm Are Capable of Supporting Full-Term Development in FVB and CD-1 Mice

Both Cauda and Caput Epididymal Sperm Are Capable of Supporting Full-Term Development in FVB and CD-1 Mice

Aqueous leaf extract of Moringa oleifera reduced intracellular ROS production, DNA fragmentation and acrosome reaction in Human spermatozoa in vitro.

The effects of aqueous leaf extract of Moringa oleifera (MO) on human sperm functions and integrity was studied in vitro. Semen was obtained by masturbation after 3-5days' abstinence from 34 healthy donors in Western Cape, South Africa. Liquefied semen was washed in human tubular fluid supplemented with 1% bovine serum albumin (HTF-BSA;1:5) with 10min centrifugation at 300g. Sperm suspensions were subsequently incubated with MO extract (0.625, 6.25, 62.5 and 625µg/ml) for 1hr, where HTF-BSA served as control. Sperm motility, vitality, DNA fragmentation, reactive oxygen species production, mitochondrial membrane potential, capacitation and acrosome reaction were assessed. Sperm motility, vitality, mitochondrial membrane potential and capacitation remained unchanged (p>.05). A dose-dependent decrease in sperm reactive oxygen species production (p<.0001), DNA fragmentation (p<.0001) and acrosome reaction (p<.001) was observed. An increase in the percentage of non-capacitated sperm (p<.01) was noted at 625µg/ml. The antioxidant properties of MO actively maintained basic sperm functions, inhibited excess sperm free superoxide production and preserved acrosome reaction and DNA integrity. Further studies are needed to confirm the effect of aqueous MO leaf extract on fertility potential.

Computer Assisted Sperm Analysis: A Review

Background: A semen analysis exam is a routine check that is done to evaluate fertility. The World Health Organization (WHO) recommended a manual method to obtain objective and standardized values. However, sometimes some errors can be found with this method such as motility. Computer-Assisted Sperm Analysis offers a way to reduce inaccuracies that often occur with manual methods.&#x0D; Reviews: CASA systems consist of a microscope which connected into a camera to detect microscopic sperm suspension images and a computer installed with special software to extract desired information and produce the desired output. In the morphological examination, CASA can reduce the coefficient of variation (CV) which is around 4.8% compared to the manual examination but the time required is longer than manual. CASA can visualize and evaluate sperm kinematics. Various parameters such as mean path velocity (VAP), curved velocity (VCL), straight-line velocity (VSL), lateral head displacement amplitude (ALH), or beat cross frequency can be obtained, and this allows a detailed view into the behavior of individual sperm. The limitations affecting CASA's ability to provide accurate results for sperm concentration and percentages of motile or progressively motile spermatozoa.&#x0D; Summary: CASA has several advantages through its ability to calculate more detailed parameters, but a qualified operator must operate it because there is some potential for misinterpretation. The combination of The Manual and CASA is highly recommended for better results.

Supplementing post-wash asthenozoospermic human spermatozoa with coenzyme Q10 for 1hr in vitro improves sperm motility, but not oxidative stress.

We investigated the effect of supplementing post-wash asthenozoospermic spermatozoa with coenzyme Q10 (CoQ10) in vitro, which may reduce oxidative stress and improve sperm motility. Semen samples were collected from 39 men with asthenozoospermia, and their spermatozoa were isolated by two-layer Percoll density-gradient centrifugation. Kinetic parameters of the isolated spermatozoa (baseline before intervention) were determined immediately by computer-aided semen analysis. Total anti-oxidant capacity and protein carbonyl levels, as markers of oxidative stress, were also measured in the baseline spermatozoa. The baseline spermatozoa suspension was divided equally into two portions, one for CoQ10 supplementation (50µg/ml for 1hr) and the other as an un-supplemented vehicle control. The total motility of the CoQ10-supplemented spermatozoa was significantly higher than in the control (p=.009) and progressive motility tended to be higher (p=.053). Immotile sperm concentration in the CoQ10-supplemented spermatozoa was significantly lower than in both the baseline (p=.026) and control (p=.009). Total anti-oxidant capacity and protein carbonyl levels between the baseline, CoQ10-supplemented and control spermatozoa were not significantly different. Our data suggest that CoQ10 treatment reactivated sperm motility. We propose short-term supplementation of post-wash asthenozoospermic spermatozoa with CoQ10 before intrauterine insemination.

Sperm quality assessment in Ficopomatus enigmaticus (Fauvel, 1923): Effects of selected organic and inorganic chemicals across salinity levels

Contamination by organic and inorganic compounds remains one of the most complex problems in both brackish and marine environments, causing potential implications for the reproductive success and survival of several broadcast spawners. Ficopomatus enigmaticus is a tubeworm polychaete that has previously been used as a model organism for ecotoxicological analysis, due to its sensitivity and ecological relevance. In the present study, the effects of five trace elements (zinc, copper, cadmium, arsenic and lead), one surfactant (sodium dodecyl sulfate, SDS) and one polycyclic aromatic hydrocarbon (benzo(a)pyrene, B(a)P) on the sperm quality of F. enigmaticus were investigated. Sperm suspensions were exposed in vitro to different concentrations of each selected contaminant under four salinity conditions (10, 20, 30, 35). Possible adverse effects on sperm function were assessed by measuring oxidative stress, membrane integrity, viability and DNA damage. Sperm quality impairments induced by organic contaminants were more evident than those induced by inorganic compounds. SDS exerted the largest effect on sperm. In addition, F. enigmaticus sperm showed high tolerance to salinity variation, supporting the wide use of this species as a promising model organism for ecotoxicological assays. Easy and rapid methods on polychaete spermatozoids were shown to be effective as integrated sperm quality parameters or as an alternative analysis for early assessment of marine and brackish water pollution.

Egg-sperm interaction in sturgeon: role of ovarian fluid.

Fertilization of freshwater fish occurs in the environment which negatively affects a lifespan of gametes mostly due to the osmotic shock; therefore, male gametes should reach the female gamete, as soon as possible. The existence of mechanisms controlling the encounter of gametes would be highly expedient in this case. By analogy with other species for which guidance was demonstrated, it is likely that this control may be performed by ovarian fluid or substances released by eggs. The aim was to study the effect of ovarian fluid and egg-released substances on spermatozoa behavior in sterlet. It was found that the presence of a particular concentration of ovarian fluid (30% solution in water) had an inhibiting effect on spermatozoa motility initiation. Lower concentrations of the ovarian fluid improved the longevity of spermatozoa and did not affect their trajectories. Test of chemotactic response (using a microcapillary injection of fluids into the suspension of motile spermatozoa) showed no effect of ovarian fluid on spermatozoa behavior, while at the same time, the attracting effect of the egg-conditioned medium was evident (i.e., due to some substances released from the eggs during their contact with freshwater). The results of the fertilization test showed that the presence of ovarian fluid prevented the eggs from losing the fertilizing ability due to the contact with water, as well as promoted the spermatozoa to fertilize the eggs during a longer period of time. Thus, the combined physicochemical action of "female factors" affects sterlet gametes during fertilization and may be involved in the guidance and selection mechanisms.

Generation of single stranded DNA with selective affinity to bovine spermatozoa.

ObjectiveThis study was conducted to generate single stranded DNA oligonucleotides with selective affinity to bovine spermatozoa, assess its binding potential and explore its potential utility in trapping spermatozoa from suspensions.MethodsA combinatorial library of 94 mer long oligonucleotide was used for systematic evolution of ligands by exponential enrichment (SELEX) with bovine spermatozoa. The amplicons from sixth and seventh rounds of SELEX were sequenced, and the reads were clustered employing cluster database at high identity with tolerance (CD-HIT) and FASTAptamer. The enriched nucleotides were predicted for secondary structures by Mfold, motifs by Multiple Em for Motif Elicitation and 5′ labelled with biotin/6-FAM to determine the binding potential and binding pattern.ResultsWe generated 14.1 and 17.7 million reads from sixth and seventh rounds of SELEX respectively to bovine spermatozoa. The CD-HIT clustered 78,098 and 21,196 reads in the top ten clusters and FASTAptamer identified 2,195 and 4,405 unique sequences in the top three clusters from the sixth and seventh rounds, respectively. The identified oligonucleotides formed secondary structures with delta G values between −1.17 to −26.18 kcal/mol indicating varied stability. Confocal imaging with the oligonucleotides from the seventh round revealed different patterns of binding to bovine spermatozoa (fluorescence of the whole head, spot of fluorescence in head and mid- piece and tail). Use of a 5′-biotin tagged oligonucleotide from the sixth round at 100 pmol with 4×106 spermatozoa could trap almost 80% from the suspension.ConclusionThe binding patterns and ability of the identified oligonucleotides confirms successful optimization of the SELEX process and generation of aptamers to bovine spermatozoa. These oligonucleotides provide a quick approach for selective capture of spermatozoa from complex samples. Future SELEX rounds with X- or Y- enriched sperm suspension will be used to generate oligonucleotides that bind to spermatozoa of a specific sex type.

Vitrification of Donkey Sperm: Is It Better Using Permeable Cryoprotectants?

Simple SummaryConventional donkey sperm-freezing using permeable cryoprotectants has been successfully performed, and good sperm parameters have been obtained after thawing. Unfortunately, artificial insemination of jennies with cryopreserved semen has given unsatisfactory results. Vitrification by directly dropping the sperm into the liquid nitrogen following the spheres methodology has been developed in human beings as an alternative to conventional freezing. This technique has shown to be a species-specific methodology and the concentration of cryoprotectants should be optimized in donkeys. Additionally, in this study, a permeable cryoprotectant (glycerol) has been tested for the first time for donkey sperm vitrification. According to our findings, vitrification of donkey sperm was effectively carried out using an extender supplemented with sucrose or bovine serum albumin (BSA) as non-permeable agent. When glycerol, a permeable agent, was compared to sucrose 0.1 M and BSA 5%, sperm quality significantly decreased. Therefore, donkey sperm vitrification in the absence of permeable agents obtained better results and gives a new approach to create a pattern for future studies of fertility trials.Vitrification by direct exposure of sperm to liquid nitrogen is increasing in popularity as an alternative to conventional freezing. In this study, the effect of permeable cryoprotectant agents for donkey sperm vitrification was compared to an extender containing non-permeable cryoprotectants. First, three different concentrations of sucrose (0.1, 0.2, and 0.3 molar, M) and bovine serum albumin, BSA (1, 5, and 10%) were compared. Secondly, the concentration of non-permeable agents producing the most desirable results was compared to an extender containing glycerol as permeable agent. Vitrification was performed by dropping 30 μL of sperm suspension directly into LN2 and warming at 42 °C. Sperm motility (total, TM; and progressive, PM) and plasma membrane integrity, PMI (mean ± SEM) were statistically compared between treatments. Sucrose 0.1 M showed a significantly higher percentage of total sperm motility (21.67 ± 9.22%) than sucrose 0.2 M (14.16 ± 4.50%) and 0.3 M (8.58 ± 6.22%); and no differences were found in comparison to the control (19.71 ± 10.16%). Vitrification with sucrose 0.1 M or BSA 5% obtained similar results for TM (21.67 ± 9.22% vs. 19.93 ± 9.93%), PM (13.42 ± 6.85% vs. 12.54 ± 6.37%) and PMI (40.90 ± 13.51% vs. 37.09 ± 14.28); but both showed higher percentages than glycerol (TM = 9.71 ± 4.19%; PM = 5.47 ± 3.17%; PMI = 28.48 ± 15.55%). In conclusion, donkey sperm vitrification in spheres using non-permeable cryoprotectants exhibited better sperm motility and viability parameters after warming than sperm vitrification using extenders containing permeable cryoprotectants.

Methods for improving the functional and metabolic status of spermatozoa with a low-intensity laser in vitro

A method for improving the functional and metabolic status of spermatozoa, including increased motion and physiological activity of spermatozoa obtained from the seminal fluid of a healthy human in vitro and including the red wavelength radiation of a low-intensity laser, is characterized in that spermatozoa isolated from a healthy donor are washed with saline twice by centrifugation for 10 minutes at 1500 rpm and the sperm suspension is impacted on with a 632 nm semiconductor laser in the mode of variable pulse generation, with the pulse width of 2 ns, the frequency of 100 Hz, the radiant energy density of 0.56 j/cm2 , the exposure time of 1 minute, expressed in increased motion and physiological activity of spermatozoa.

Obesity as a factor in spermatogenesis disorders (experimental study)

Introduction. In recent years, the effects of obesity on male fertility have been extensively investigated. The results of existing studies are extremely contradictory.The study objective was to determine the effect of obesity on the male reproductive system using the biological model of laboratory rats as an example.Materials and methods. In vivo modeling of diet-induced obesity. The study was conducted on 22 laboratory sexually mature white rats weighing 140–160 g. The animals were divided into two groups: 1 control (10 animals) and 2 rats with diet-induced obesity (12 animals). After 12 weeks, the animals were removed from the experiment. All rats underwent: calculation of the Lee index (body mass index in rats), determination of the concentration and viability of spermatozoa in a suspension of sperm from the epididymis, determination of glucose level of total cholesterol and triglycerides in the blood, study of sperm DNA fragmentation, histological examination testis: calculating the crosssectional area of the seminiferous tubule; determination of the number of non-functioning tubules and tubules with desquamated spermiogenic epithelium; determination of the average spermatogenesis index.Results. In the study groups there were no differences in glucose and total cholesterol levels. However, a statistically significant, significant difference in the level of triglycerides in the blood was revealed. The concentration of sperm and their viability in the studied groups did not differ. The level of sperm DNA fragmentation in the experimental group is significantly higher than in the control group (31.5 ± 10.1 and ± 1.4 %, respectively, p &lt;0.05). Morphometric evaluation of histological preparations did not establish differences in the cross-sectional area of the seminiferous tubules and the average spermatogenesis index in the studied groups. In rats with obesity, compared with the control group, significantly more non-functioning tubules (2.9 ± 0.3 and 8.4 ± 0.3; p &lt;0.05) and tubules with desquamated spermatogenic epithelium (1.8 ± 0.3 and 8.8 ± 0.5; p &lt;0.05).Conclusion. Diet-induced obesity causes impaired spermatogenesis, and damage to the sperm genetic material in male white rats.

Graphene Oxide Improves in vitro Fertilization in Mice With No Impact on Embryo Development and Preserves the Membrane Microdomains Architecture.

During the latest years, human infertility worsened all over the world and is nowadays reputed as a global public health issue. As a consequence, the adoption of Assisted Reproductive Technologies (ARTs) such as In Vitro Fertilization (IVF) is undergoing an impressive increase. In this context, one of the most promising strategies is the innovative adoption of extra-physiological materials for advanced sperm preparation methods. Here, by using a murine model, the addition of Graphene Oxide (GO) at a specific concentration has demonstrated to increase the spermatozoa fertilizing ability in an IVF assay, finding that 0.5 μg/ml GO addition to sperm suspensions before IVF is able to increase both the number of fertilized oocytes and embryos created with a healthy offspring given by Embryo Transplantation (ET). In addition, GO treatment has been found more effective than that carried out with methyl-β-cyclodextrin, which represents the gold standard in promoting in vitro fertility of mice spermatozoa. Subsequent biochemical characterization of its interaction with male gametes has been additionally performed. As a result, it was found that GO exerts its positive effect by extracting cholesterol from membranes, without affecting the integrity of microdomains and thus preserving the sperm functions. In conclusion, GO improves IVF outcomes in vitro and in vivo, defining new perspectives for innovative strategies in the treatment of human infertility.