Sperm Protein Research Articles

Sperm HSP70: may not be an age-dependent gene but is associated with field fertility in Bali bulls (Bos sondaicus).

This study aimed to analyze the characteristics of the HSP70 gene and protein in spermatozoa of Bali bulls of different age groups and to examine its potential as a biomarker determining bull fertility. This study used frozen semen produced from six Bali bulls divided into two groups based on age (≤ 9 years and ≥ 12 years). Parameters of frozen semen quality analyzed included sperm motility and kinetics using computer-assisted semen analysis, sperm morphological defects using Diff-Quick staining, acrosome integrity using FITC-PNA staining, and DNA fragmentation using acridine orange staining. HSP70 gene expression characterization was analyzed using qRT-PCR, and HSP70 protein abundance was analyzed using enzyme immunoassays. Fertility field data were obtained by analyzing the percentage conception rate for each bull based on the artificial insemination service data contained in the Indonesian-integrated system of the National Animal Health Information System (iSIKHNAS). The results showed significant differences (P<0.05) in total and progressive motility, morphological defects of the neck and midpiece, and tail of sperm, and acrosome integrity between the age groups of Bali bulls. HSP70 gene expression and protein abundance showed no significant differences (P>0.05) in different age groups. HSP70 gene expression correlated with fertility rate (P<0.05). Age affected several semen quality parameters but did not affect HSP70 gene expression and protein abundance. The HSP70 gene molecule could be a biomarker that determines the fertility of Bali bulls.

Semen quality and frozen semen production in Pasundan bulls: A molecular weight perspective on seminal plasma and spermatozoa protein.

To determine the correlation between the molecular weight (MW) of proteins in seminal plasma and spermatozoa and the quality of fresh and frozen semen production in Pasundan bulls. Nine selected Pasundan bulls, aged 5-10 years, from the Regional Artificial Insemination Center at Ciamis, West Java, Indonesia, were used in the study, with fresh semen sperm motility ≥70% and <70%. We analyzed the motility, viability, integrity of the intact plasma membrane (IPM), and the morphological characteristics of spermatozoa. 1D-SDS-PAGE analysis was performed to determine the protein profile by assessing MW, depicted as bands on the gel. The motility, viability, and IPM of spermatozoa had lower values (p < 0.05) in Pasundan bulls named Bagaskara and Kertarajasa compared to the other bulls. Proteins with MW 35-50 kDa were not detected in the seminal plasma of Pasundan bulls, exhibiting low quality in fresh semen. The correlation analysis showed that the non-detected proteins with MW 35-50 kDa in seminal plasma correlated with spermatozoa motility (r = 0.421), viability (r = 0.424), and IPM (r = 0.428) so that fresh semen quality was low in both Pasundan bulls. Analysis of semen volume, spermatozoa concentration, and spermatozoa motility showed that the average frozen semen production of Pasundan bulls per ejaculate was 128.73 ± 15.35 straws. Protein analysis based on MW is a predictive indicator for the quality of fresh semen and the production of frozen semen in Pasundan bulls. Evaluation parameters of fresh semen quality by MW analysis can be used to select Pasundan bulls in Indonesia.

RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.

Environmental conditions experienced early in the life of an animal can result in gene expression changes later in its life history. We have previously shown that C. elegans animals that experienced the developmentally arrested and stress resistant dauer stage (postdauers) retain a cellular memory of early-life stress that manifests during adulthood as genome-wide changes in gene expression, chromatin states, and altered life history traits. One consequence of developmental reprogramming in C. elegans postdauer adults is the downregulation of osm-9 TRPV channel gene expression in the ADL chemosensory neurons resulting in reduced avoidance to a pheromone component, ascr#3. This altered response to ascr#3 requires the principal effector of the somatic nuclear RNAi pathway, the Argonaute (AGO) NRDE-3. To investigate the role of the somatic nuclear RNAi pathway in regulating the developmental reprogramming of ADL due to early-life stress, we profiled the mRNA transcriptome of control and postdauer ADL in wild-type and nrde-3 mutant adults. We found 711 differentially expressed (DE) genes between control and postdauer ADL neurons, 90% of which are dependent upon NRDE-3. Additionally, we identified a conserved sequence that is enriched in the upstream regulatory sequences of the NRDE-3-dependent differentially expressed genes. Surprisingly, 214 of the ADL DE genes are considered "germline-expressed", including 21 genes encoding the Major Sperm Proteins and two genes encoding the sperm-specific PP1 phosphatases, GSP-3 and GSP-4. Loss of function mutations in gsp-3 resulted in both aberrant avoidance and attraction behaviors. We also show that an AGO pseudogene, Y49F6A.1 (wago-11), is expressed in ADL and is required for ascr#3 avoidance. Overall, our results suggest that small RNAs and reproductive genes program the ADL mRNA transcriptome during their developmental history and highlight a nexus between neuronal and reproductive networks in calibrating animal neuroplasticity.

Sperm proteomic landscape is altered in breeding bulls with greater sperm DNA fragmentation index

Although, it is well understood that sperm DNA damage is associated with infertility, the molecular details of how damaged sperm DNA affects fertility are not fully elucidated. Since sperm proteins play an important role in fertilization and post-fertilization events, the present study aimed to identify the sperm proteomic alterations in bulls with high sperm DNA Fragmentation Index (DFI%). Semen from Holstein-Friesian crossbred breeding bulls (n = 50) was subjected to Sperm Chromatin Structure Assay. Based on DFI%, bulls were classified into either high- (HDFI; n = 6), or low-DFI (LDFI; n = 6) and their spermatozoa were subjected to high throughput proteomic analysis. Liquid chromatography and mass spectrometry analysis identified 4567 proteins in bull spermatozoa. A total of 2660 proteins were found common to both the groups, while 1193 and 714 proteins were unique to HDFI and LDFI group, respectively. A total of 265 proteins were up regulated and 262 proteins were down regulated in HDFI group. It was found that proteins involved in capacitation [heparin binding (molecular function), ERK1 and ERK2 cascade (biological process), PI3K-Akt signalling (pathway), Jak-STAT signalling (pathway)], spermatogenesis [TLR signalling (pathway), gamete generation (biological process)] and DNA repair mechanism (biological process) were significantly altered in the bulls with high DFI%.

Differential metabolites screening in yak (Bos grunniens) seminal plasma after cryopreservation and the evaluation of the effect of galactose on post-thaw sperm motility

Sperm survival and activity depend on the provision of energy and nutrients from seminal plasma (SP). This study aimed to investigate the variations of metabolites within SP before and after freezing and subsequently explore the potential regulatory mechanisms affecting yak sperm cryodamage due to changes in metabolites in the SP. Untargeted metabolomics analysis was performed to screen for differential metabolites, followed by KEGG analysis to identify enriched signaling pathways. The combinatorial analysis of metabolomics and sperm proteomics revealed the influence of key SP metabolites on sperm proteins. Subsequently, the relevant differentially expressed proteins were verified by Western blot analysis. Finally, the mechanism underlying the positive effect of galactose on sperm motility was determined by assessing the change in ATP content in sperm before and after freezing and thawing. The data showed that a total of 425 and 269 metabolites were identified in the positive and negative ion modes, respectively. Freezing and thawing resulted in the up-regulation of 70 metabolites and the down-regulation of 29 metabolites in SP. The primary impact of freezing and thawing was observed in carbohydrate metabolism, including pyruvate metabolism, pentose phosphate pathway, galactose metabolism, the TCA cycle, and butanoate metabolism. In the combined analysis and Western blot results, a significant positive correlation was observed between galactose and Aldo-keto reductase family 1 member B1 (AKR1B1) (P < 0.05), which has the ability to convert galactose into galactol. Furthermore, the addition of galactose to thawed semen improved sperm motility by increasing AKR1B1 protein in sperm and was associated with the content of ATP. These data identify differential metabolites between fresh and frozen-thawed SP and suggest that galactose is a valuable additive for cryopreserved sperm, providing a theoretical basis for further exploration of the refrigerant formula for yak sperm cryopreservation.

CRISPR/Cas9-mediated genome editing reveals seven testis-enriched transmembrane glycoproteins dispensable for male fertility in mice.

Mammalian fertilization is mediated by multiple sperm acrosomal proteins, many of which are testis-enriched transmembrane glycoproteins expressed during spermiogenesis (e.g., Izumo sperm-egg fusion 1, Sperm acrosome associated 6, and Transmembrane protein 95). We hypothesized that proteins with these features might have a role in sperm-egg interaction and thus carried out an in-silico screen based on multiple public databases. We generated knockout mouse lines lacking seven candidate proteins by the CRISPR/Cas9 system and conducted detailed analyses on the fecundity of the knockout males, as well as their testis appearance and weight, testis and epididymis histology, and sperm motility and morphology. Through the in-silico screen, we identified 4932438H23Rik, A disintegrin and metalloproteinase domain-containing protein 29, SAYSvFN domain-containing protein 1, Sel-1 suppressor of lin-12-like 2 (C. elegans), Testis-expressed protein 2, Transmembrane and immunoglobulin domain-containing 3, and Zinc and ring finger 4. Phenotypic analyses unveiled that the knockout males showed normal testis gross appearance, normal testis and epididymis histology, and normal sperm morphology and motility. Fertility tests further indicated that the knockout male mice could sire pups with normal litter sizes when paired with wild-type females. These findings suggest that these seven proteins are individually dispensable for male reproduction and fertilization. Future studies are warranted to devise advanced in-silico screening approaches that permit effective identification of gamete fusion-required sperm proteins.

A proteomic approach to identifying spermatozoa proteins in Indonesian native Madura bulls.

Proteins assist sperm mature, transit the female reproductive tract, and recognise sperm oocytes. Indigenous Indonesian bulls, Madura bulls, have not been studied for reproductive proteomics. As local Indonesian beef livestock, Madura cattle assist in achieving food security; hence, their number must be improved. Thus, the identification of molecular proteomics-based bull fertility biomarkers is needed. This study aimed to characterise the sperm fertility function of the superior Madura bull (Bos indicus × Bos Javanicus) spermatozoa proteome. Frozen semen from eight Madura superior bulls (Bos indicus × Bos javanicus) aged 4-8 years was obtained from the artificial insemination centre (AIC) in Singosari and Lembang. Madura superior bulls are those that have passed the bull breeding soundness evaluation. Frozen sperm were thawed and centrifuged at 3000 × g for 30 min. Proteins in sperm were characterised through proteomic analysis using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The resulting gene symbols for each protein were then subjected to bioinformatics tools, including UniProt, DAVID, and STRING databases. Regarding sperm fertility, the analysis revealed that 15 proteins were identified in the sperm of Madura bulls. Amongst the identified proteins, the superior Madura bull sperm contained several motilities, energy-related proteins, and chaperone proteins. A substantial portion of characterised proteins are linked to metabolic pathways and the tricarboxylic acid (TCA) cycle, contributing to sperm energy production. In conclusion, the first in-depth proteome identification of sperm related to sperm quality and bull fertility of a unique indigenous Madura breed of Indonesia was performed using the LC-MS/MS proteomic method. These findings may serve as a reference point for further studies related to the functions of bovine sperm and biomarkers of fertility and sperm quality.

Evidence based distribution of protamine 2 genes polymorphism variants in infertile and fertile males in Southwestern Nigeria.

Protamine 2 is a major core protein of spermatozoa and is important for maintaining male fertility. The aim of the study was to determine the distribution of protamine 2 gene polymorphisms variants in infertile males in Southwestern Part of Nigeria. This is a cross sectional study, consisted of volunteered infertile and fertile male attendees of known Fertility Clinics in Lagos Metropolis, Lagos, Nigeria. The infertile male subjects recruited, were fifty-seven (57) in number and the fertile male subjects (control) were thirty-five in number (35) and were within the age range of 30-59 years old. Semen specimen was collected from each subject in line with WHO guideline for semen analysis into sterile semen containers through masturbation. Sperm DNA from subjects’ sperm cells was extracted by chemical method (protein kinase buffer), quantified using nanodrop 1000 Spectrophotometer and amplified using the PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3’ PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -3' primers on an ABI 9700 Applied Biosystem thermal cycler at final volume of 25 µL for 35 cycles. Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer. The results of genetic testing on the flank; 5’-UTR of the PRM 2 gene showed the following variants with polymorphisms and frequencies as follow: rs2069880951 (A&gt;T /T&gt;A) 6 (6.6%), rs1382451565 (C&gt;T) 5 (5.4%), and rs935520555 (G&gt;C) 5 (5.4%), rs1479789045 (G/C&gt;A/ A&gt;G) 4 (4.3%), rs570570800 (C&gt;T/ G&gt;T) 3 (3.3%), rs1281533806 (C&gt;A) 3 (3.3%), rs1434703461 (C&gt;T/ G&gt;T) 3 (3.3%), rs2069881018 (G&gt;C) 3 (3.3%), rs549835830 (G&gt;C) 2 (2.2%), rs2069880888( C&gt;T ) 2 (2.2%), rs997110743 (G&gt;C/C&gt;G), rs1236501997 1 (1.1%), rs119399669 (C&gt;T) 1 (1.1%), and rs1052575569 (G&gt;A/C&gt;A) 1 (1.1%). In this study, there were novel variants of protamine 2 gene polymorphism, identified with reference to the reference sequence of NCBI data base in the infertile and fertile male subjects.

Proteomic analysis of boar sperm with differential ability of liquid preservation at 17 °C

Understanding the liquid preservation ability of boar sperm is pivotal for efficient management and breeding of livestock. Although sperm proteins play an important role in semen quality and freezability, how the levels of protein change in boar sperm with different liquid preservation abilities at 17 °C remains unclear. In this study, two groups of boar sperm with extreme difference in liquid preservation ability, namely the good preservation ability (GPA) and the poor preservation ability (PPA) groups, were selected by evaluating sperm motility parameters on the 7th day of liquid preservation at 17 °C. Quantitative proteomics based on tandem mass tag (TMT) labeling was used, sperm proteomic characteristics from two groups were analyzed, and potentially key proteins related to the fluid preservation ability of sperm were identified. A total of 187 differentially expressed proteins (DEPs) were identified among 2791 quantified proteins, including 85 upregulated, and 102 downregulated proteins. Further, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses of the DEPs revealed that they were enriched in GO terms associated with response to oxidative stress, enzyme activity related to oxidative stress or redox reactions, and several metabolic activities. The significant KEGG pathways included peroxisome, metabolic pathways, selenocompound metabolism, and collection duct acid secretion. In addition, analysis of protein–protein interactions further identified 8 proteins that could be used as biomarker candidates, including GPX5, GLRX, ENO4, QPCT, BBS7, OXSR1, DHRS4 and AP2S1, which may play an essential role in indicating the liquid preservation ability of boar sperm. These findings in this study provide new insights into the underlying molecular mechanisms of the liquid preservation ability of boar sperm. Moreover, the selected candidate proteins can serve as a reference for evaluating sperm quality or preservation ability in boars and their application in related biotechnologies.

CCDC65, encoding a component of the axonemal Nexin-Dynein regulatory complex, is required for sperm flagellum structure in humans.

Sperm flagella share an evolutionary conserved microtubule-based structure with motile cilia expressed at the surface of several cell types, such as the airways epithelial cells. As a result, male infertility can be observed as an isolated condition or a syndromic trait, illustrated by Primary Cilia Dyskinesia (PCD). We report two unrelated patients showing multiple morphological abnormalities of the sperm flagella (MMAF) and carrying distinct homozygous truncating variants in the PCD-associated gene CCDC65. We characterized one of the identified variants (c.1208del; p.Asn403Ilefs*9), which induces the near absence of CCDC65 protein in patient sperm. In Chlamydomonas, CCDC65 ortholog (DRC2, FAP250) is a component of the Nexin-Dynein Regulatory complex (N-DRC), which interconnects microtubule doublets and coordinates dynein arms activity. In sperm cells from the patient, we also show the loss of GAS8, another component of the N-DRC, supporting a structural/functional link between the two proteins. Our work indicates that, similarly to ciliary axoneme, CCDC65 is required for sperm flagellum structure. Importantly, our work provides first evidence that mutations in the PCD-associated gene CCDC65 also cause asthenozoospermia.

Gamete Recognition Gene Divergence Yields a Robust Eutherian Phylogeny across Taxonomic Levels

The extraordinary morphological diversity among extant mammals poses a challenge for studies of speciation, adaptation, molecular evolution, and reproductive isolation. Despite the recent wealth of molecular studies on mammalian phylogenetics, uncertainties remain surrounding both ancestral and more recent divergence events that have proven difficult to resolve. Multi-gene datasets, especially including genes that are highly divergent, often provide increased support for higher-level affinities within Mammalia; however, such analyses require vast amounts of genomic sequence data and at times, intensive, high-performance computational effort. Furthermore, despite the large-scale efforts dedicated to comprehensive, multi-gene phylogenetic analyses using a combination of mitochondrial, nuclear, and other sequences (e.g., tRNA, ultra-conserved elements, and transposable elements), many relationships across Mammalia remain highly controversial. To offer another approach and provide a phylogenetic solution to this longstanding issue, here we present a phylogenetic tool based on a single reproductive molecular marker, zonadhesin (gene: Zan), one of two known mammalian speciation genes, which encodes the rapidly evolving sperm protein zonadhesin that mediates species-specific adhesion to the egg and thereby promotes reproductive isolation among placental mammals (Eutheria). Topological comparison of Zan Maximum Likelihood phylogenies to a nearly complete mammalian supertree confirmed Zan’s striking phylogenetic utility and resolution at both deeper and more terminal nodes in the placental mammalian phylogeny. This single gene marker yielded an equivalent and/or superiorly supported topology in comparison to a supertree generated using DNA sequences from a supermatrix of 31 genes from 5911 species (extinct and extant). Resolution achieved with this new phylogenetic approach provides unique insights into the divergence of both early and recent mammalian radiations. Finally, and perhaps most importantly, the utility of zonadhesin as a singular molecular marker was especially useful in clades where sufficient taxon sampling is impossible to achieve, and where only a subset of members of the mammalian species tree is available. The eutherian relationships presented here provide a foundation for future studies in the reconstruction of mammalian classifications, including reproductive isolation, hybridization, and biodiversification of species.

N-Glycosylation Site in the Middle Region Is Involved in the Sperm-Binding Activity of Bovine Zona Pellucida Glycoproteins ZP3 and ZP4.

Mammalian fertilization is a species-selective event that involves a series of interactions between sperm proteins and the oocyte's zona pellucida (ZP) glycoproteins. Bovine ZP consists of three glycoproteins: bZP2, bZP3, and bZP4. In our previous study, we demonstrated that bovine sperm binds to plastic wells coated with recombinant bZP4 and identified that the N-terminal domain and the middle region of bZP4 are critical for sperm-binding activity. Here, we investigated the sperm-binding site in the middle region (residues 290 to 340) of bZP4, which includes the hinge region. We showed that bovine sperm binds to bZP4's middle region in a species-selective manner. We mapped the function of bZP4's middle region to its N-glycosylation site at Asn-314 using several recombinant mutated proteins. Moreover, we showed that mutations of the N-glycosylation sites at Asn-314 close to the hinge region and Asn-146 of the hinge region of bZP4 and bZP3, respectively, reduced the sperm-binding activity of the complex of the bZP3 (from 32 to 178) and bZP4 (from 136 to 464) fragments. Together, these results suggest that ZP's middle regions of bZP3 and bZP4 form one of the sperm-binding sites of bovine ZP.

The molecular structure and function of fibrocystin, the key gene product implicated in autosomal recessive polycystic kidney disease (ARPKD).

Autosomal recessive polycystic kidney disease is an early onset inherited hepatorenal disorder affecting around 1 in 20,000 births with no approved specific therapies. The disease is almost always caused by variations in the polycystic kidney and hepatic disease 1 gene, which encodes fibrocystin (FC), a very large, single-pass transmembrane glycoprotein found in primary cilia, urine and urinary exosomes. By comparison to proteins involved in autosomal dominant PKD, our structural and molecular understanding of FC has lagged far behind such that there are no published experimentally determined structures of any part of the protein. Bioinformatics analyses predict that the ectodomain contains a long chain of immunoglobulin-like plexin-transcription factor domains, a protective antigen 14 domain, a tandem G8-TMEM2 homology region and a sperm protein, enterokinase and agrin domain. Here we review current knowledge on the molecular function of the protein from a structural perspective.

Oxidative phosphorylation rather than glycolysis is the primary energy source for sperm motility in the mussels Mytilus edulis

Broadcast-spawning marine mussels rely on high sperm motility for successful fertilization in the dynamic seawater environment. Mitochondria are typically considered the primary source of ATP generation via oxidative phosphorylation (OXPHOS); however, the ATP generation pathways of mussel sperm have not been fully characterized. To better understand the importance of both OXPHOS and glycolysis for mussel sperm function, we conducted experiments inhibiting these pathways in sperm from Mytilus edulis. Our results indicate that oligomycin, an inhibitor of the mitochondrial ATP synthase, immediately decreased sperm motility rate, velocity, and ATP content, while 2-deoxy-d-glucose, a glycolysis inhibitor, had no effect. The OXPHOS inhibitor rotenone also partially reduced sperm motility rate and velocity. Interestingly, no evidence was found for the inhibitors' effects on the content of energy-rich compounds (lipids, carbohydrates, and proteins) in the mussels' sperm, indicating only modest energy demand to fuel sperm motility. Based on these findings, we conclude that OXPHOS is the primary energy source for sperm motility in marine mussels. Our study sheds light on the intricacies of mussel sperm physiology and highlights the importance of understanding the energy requirements for successful fertilization in broadcast-spawning marine invertebrates.

Regional abundances of binder of sperm (BSP) proteins are negatively associated with the quality of frozen-thawed bovine spermatozoa.

The localization and abundance of the sperm BSP proteins correlate with in vitro fertility in domestic bulls used in artificial insemination service. Binder of sperm (BSP) proteins, secreted mainly by the accessory sex glands, are the major protein family present in bovine seminal plasma and on the sperm surface after ejaculation. In vivo, BSP proteins facilitate sperm capacitation and sperm reservoir formation; however, their impact on sperm function within the in vitro systems is less clear. Therefore, this biomarker-based study aimed to characterize the localization and abundance of BSP proteins from in vitro processed frozen-thawed bovine spermatozoa. Using image-based flow cytometry and Western blotting, BSP protein localization, abundance, membrane and acrosomal integrity were investigated in the supernatant (nonmotile) and pellet (motile) fractions of gradient-separated bull spermatozoa. Spermatozoa from the supernatant fraction had high enrichment of all BSP proteins investigated (BSP1, BSP3, BSP5; P < 0.05) when compared to the pellet fraction. In the pellet fraction, BSP1 and BSP3 bound predominately to the acrosomal region, whereas BSP5 had a high affinity for the midpiece. However, in the supernatant fraction, BSP proteins predominately coated the entire sperm surface resulting in the loss of regional specificity. High BSP protein abundance in the spermatozoa also correlated with acrosome and membrane damage. Whereas a high abundance of BSP5 correlated with low embryo cleavage rates, high abundance of BSP1 on the sperm head coincided with a high blastocyst rate. Therefore, changes in the quantity and localization of specific BSP proteins could act as potential biomarkers of sperm quality and fertility.

Quantitative proteomics analysis reveals the key proteins related to semen quality in Niangya yaks

BackgroundProteins related to sperm motility and sperm morphology have an important impact on sperm function such as metabolism, motility and fertilisation etc. An understanding of the key proteins related to semen quality in Niangya yaks would help to provide support for breeding. However, the key proteins that affect semen quality in Niangya yaks remain unclear.MethodsHerein, we applied tandem mass tag (TMT) labeling and liquid chromatography-tandem mass spectrometry (LC‒MS/MS) to analyze the expression levels of sperm proteins in groups of high- and low-quality semen from Niangya yaks. And fifteen differentially expressed proteins (DEPs) were randomly selected for expression level validation by parallel reaction monitoring (PRM).ResultsOf the 2,092 quantified proteins, 280 were identified as DEPs in the high-quality group versus the low-quality group. Gene Ontology (GO) analysis revealed that in terms of biological pathways, the DEPs were mainly involved in metabolic processes, cell transformation processes, and single organism metabolic processes. In terms of cell composition, the DEPs were mainly located in the cell membrane, organelle, molecular complex. In terms of molecular functions, the most abundant functions of the DEPs were catalytic activity, binding activity, transport activity, and enzyme regulation activity. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis revealed that the DEPs were mainly involved in the cytokine and cytokine receptor interaction, notch signaling pathway, lysine biosynthesis, renal function-related protein and proteasome pathway. From protein-protein interaction (PPI) analysis of DEPs involved in important pathways, 6 related proteins affecting the semen quality of Niangya yaks were identified. And the results of the PRM and TMT analysis were consistent.ConclusionsThe differential sperm proteomic analysis of high- and low-quality semen from Niangya yaks, revealed 6 proteins (PSMC5, PSMD8, PSMB3, HSP90AA1, UGP2 and HSPB1), were mainly concentrated in energy production and metabolism, might play important roles in semen quality, which could serve as candidates for the selection and breeding of Niangya yaks.

The concentration of glucose in the media influences the susceptibility of stallion spermatozoa to ferroptosis.

Although common in many commercial extenders, supraphysiological concentrations of glucose in the media may be detrimental to stallion spermatozoa. In this study, we present evidence that these elevated glucose levels may predispose spermatozoa to ferroptosis. Stallion spermatozoa depend on oxidative phosphorylation as their major source of ATP; however, the metabolism of these cells is complex and a great degree of metabolic plasticity exists. The composition of the media in which the spermatozoa are extended, or exposed to in the mare's reproductive tract, exerts a profound effect on sperm function and may even accelerate cell demise. Recent research indicates that high concentrations of glucose in the media, although common in commercial extenders, may be detrimental. To determine if supraphysiological glucose concentration may induce or predispose to ferroptosis (a caspase-independent form of programmed cell death, triggered by oxidative stress), stallion spermatozoa were incubated under different concentrations of glucose, 67 mM (HG) or 1 mM plus 10 mM pyruvate (LG-HP), in the presence or absence of known inductors of ferroptosis. Furthermore, we developed a single-cell flow metabolic assay to identify different metabolic phenotypes in spermatozoa. Storage and incubation of spermatozoa under high glucose concentrations led to an increase in the percentage of necrotic spermatozoa (P < 0.0001). Moreover, ferroptosis was induced more intensely in sperm in media with high glucose concentrations (P < 0.0001). Finally, we observed that induction of ferroptosis modified two proteins (oxoglutarate dehydrogenase and superoxide dismutase 2) in spermatozoa incubated in media containing 67 mM glucose but not in media containing 1 mM glucose and 10 mM pyruvate. The composition of the media, especially the concentration of glucose, exerts a major impact on the functionality and life span of the spermatozoa. The results reported here may pave the way for improvements in existing semen extenders.

Sperm Quality Assessment in Stallions: How to Choose Relevant Assays to Answer Clinical Questions.

Stallion sperm analysis is indicated for infertility diagnosis, pre-sale expertise, production of fresh or frozen doses, and frozen straw quality control. Various collection methods are described, and numerous assays can be performed on semen. Determining an approach for each of these cases is challenging. This review aims to discuss how to obtain relevant clinical results, answering stallion owners' concerns. Semen can be collected with an artificial vagina on a phantom or a mare, by electro-ejaculation under anesthesia, or after pharmacological induction. The collection method influences the semen volume and concentration, while the total sperm number depends on the testicular production and collection frequency. In the seminal plasma, acidity, pro-oxidant activity, and some enzymes have repercussions for the semen quality and its conservation. Moreover, non-sperm cells of seminal plasma may impact semen conservation. Motility analysis remains a core parameter, as it is associated with fresh or frozen dose fertility. Computer-assisted motility analyzers have improved repeatability, but the reproducibility between laboratories depends on the settings that are used. Morphology analysis showing spermatozoa defects is useful to understand production and maturation abnormalities. Staining of the spermatozoa is used to evaluate viability, but recent advances in flow cytometry and in fluorochromes enable an evaluation of multiple intracellular parameters. Spermatozoa protein expression already has clinical applications, for example, as a fertility and freezing ability predictor. At present, stallion semen analysis ranges from macroscopic evaluation to assessing spermatozoa proteins. However, clinically, all these data may not be relevant, and the lack of standardization may complicate their interpretation.

Seminal Plasma Proteins Associated with The Fertility of Brahman Bulls in The Colombian Low Tropics.

The sperm interacts with seminal plasma proteins during its transport through the female reproductive tract to reach the oocyte. Seminal plasma proteins have been associated as biomarkers of fertility in bovine males, while two-dimensional electrophoresis in polyacrylamide gels under denaturing conditions (2D-PAGE) is a useful technique for their separation, allowing their subsequent analysis with the aid of specialised software. Brahman bulls are known for their tolerance to tropical conditions such as low-quality pastures, high temperatures, and relative humidity as well as moderate resistance to infestations by parasites and insects. The present study describes the two-dimensional electrophoretic profiles of the seminal plasma proteins in the rainy and dry seasons, associating them with the fertility of Brahman bulls in the Colombian Orinoquía in a 90-days breeding season and a single-sire mating system (1 bull per 50 Brahman cows) with 60 consecutive days of rest. The fertility-related seminal plasma protein spots increased in the dry season. Likewise, a meaningful relationship was found between the protein spots that possibly coincide with the Binder of Sperm Proteins. It was also found that bulls with the highest percentages of pregnancy also had similarities in their 2D seminal plasma maps. We conclude that the seminal plasma protein profile of Brahman bulls raised in the Colombian low tropic changes between rainy and dry seasons, and such changes may influence the reproductive performance of those animals.

Kaempferol Enhances Sperm Post-Thaw Survival by Its Cryoprotective and Antioxidant Behavior

This study examined the effects of three selected doses of kaempferol (KAE; 12.5, 25 or 50 μM) on bovine sperm motility and oxidative profile directly related to cold storage. We also elucidated the effect of KAE on the expression profiles of heat shock proteins (HSPs) 70 and 90 as well as the pro-apoptotic BCL2-associated X (BAX) protein and the anti-apoptotic B-cell lymphoma 2 (Bcl-2) protein. Frozen samples supplemented with KAE were compared with a native control (fresh spermatozoa) and a cryopreserved control, frozen in the absence of KAE. Our results demonstrate that the administration of all KAE doses led to a higher degree of sperm motility (p &lt; 0.05) when compared with the cryopreserved control. The highest levels of protection of sperm DNA (p &lt; 0.05), lipids (p &lt; 0.05) and proteins (p &lt; 0.05) were detected in samples exposed to 25 μM KAE when compared with samples frozen without KAE. Administration of 25 μM KAE led to a significant increase in HSP70 and HSP90 (p &lt; 0.05) when compared with the unsupplemented frozen control. No significant differences were observed in the expression patterns of BAX; however, a significant up-regulation of Bcl-2 protein was observed in the frozen samples enriched with 25 μM KAE when compared with the cryopreserved control (p &lt; 0.05). In summary, we may consider KAE as an effective agent in stabilizing the sperm membranes by preventing reactive oxygen species (ROS) overproduction in the mitochondria and subsequent oxidative damage to molecules critical for a proper sperm architecture and function. These protective properties of KAE may lead to higher post-thaw sperm activity and viability.