Specific Clinical Manifestations Research Articles

Rhino-orbital-cerebral mucormycosis caused by Rhizopus arrhizus diagnosis via metagenomics next-generation sequencing: a case report

Rhino-orbital-cerebral mucormycosis (ROCM) is a rare, invasive, and fatal fungal disease that is often easily misdiagnosed in the early stages due to the lack of specific clinical manifestations and adequate auxiliary examinations. Early diagnosis and timely therapy are essential for successful treatment. In this report, we presented a 46-year-old man with diabetes who experienced gradual vision loss, right ptosis, swelling, and headaches that progressively worsened to death within 4 days after admission. It was finally confirmed as a fungal Rhizopus arrhizus infection by metagenomics next-generation sequencing (mNGS). Our report has proved that mNGS testing should be strongly recommended in highly suspected patients.

Exome sequencing confirms the clinical diagnosis of both joubert syndrome and klinefelter syndrome with keratoconus in a han Chinese family

IntroductionJoubert syndrome a rare genetic disorder, is characterized by abnormalities in the development of the central nervous system with “molar signs” on magnetic resonance imaging of the brain and accompanied by cerebellar vermis hypoplasia, ataxia, hypotonia, and developmental delay. Keratoconus (KC) is a kind of genetically predisposed eye disease that causes blindness characterized by a dilated thinning of the central or paracentral cornea conically projected forward, highly irregular astigmatism, and severe visual impairment. Klinefelter syndrome is caused by an extra X chromosome in the cells of male patients, and the main phenotype is tall stature and dysplasia with secondary sex characteristics. This study was intended to identify the genetic etiology and determine the clinical diagnosis of one Han Chinese family with specific clinical manifestations of keratoconus and multiorgan involvement.MethodsA comprehensive ocular and related general examination was performed on one patient and his asymptomatic parents and brother. Pathogenic genes were tested by exome sequencing. CNV-seq was used to verify the copy number variation, and peripheral blood was cultured for karyotype analysis. The pathogenicity of the identified variant was determined subject to ACMG guidelines. The Gene Expression Omnibus (GEO) dataset of keratoconus-related genes in the NCBI database was obtained to analyze the differentially expressed genes in corneal tissues of the keratoconus group and the normal control group, and analysis of protein-protein interaction networks (PPI) was performed.ResultsProband, a 25-year-old male, had sudden loss of vision in the left eye for 1 week. Best corrected visual acuity (BCVA): 0.5 (−1.00DS/-5.00DC*29°) in the right eye, counting fingers/40 cm in the left eye. Slit-lamp microscopy of the right eye showed mild anterior protrusion of the cornea and thinning of the cone-topped cornea. The left eye showed marked thinning of the central region of the cornea, rounded edema in the form of a cone-like bulge, epithelial bullae, edema and turbidity of the stroma, and bulging of the Descemet’s membrane. Cranial magnetic resonance imaging (MRI) revealed changes in the midbrain and cerebellum, with a “molar sign” and a “bat-winged” ventriculus quartus cerebri. General check-up: 168 cm in height, decreased muscle tone in all four limbs, knee jerk elicited, negative Babinski sign, abdominal reflexes elicited, finger-to-nose test positive, intentional tremor evident in both hands, positive Romberg’s sign, instability of gait, level I intellectual disability, poor adaptive behavior, communication disorders, teeth all dentures, a peculiar face with blepharophimosis, wide inner canthus distance, mild ptosis, severe positive epicanthus, high palatal arches, exotropia, hypotrichosis of beard and face, inconspicuous prominentia laryngea, and short upper and lower limbs. Exome sequencing detected compound heterozygous frameshift variants M1:c.9279dup:p.His3094Thrfs*18 and M2:c.6515_6522del:p.Lys2172Thrfs*37 in the patient’s CPLANE1 gene and the presence of duplication-type CNV on the X chromosome. Sanger sequencing showed that the mother and father carried the M1 and M2 variants, respectively, and the younger brother carried the M2 variant, which was a novel variant. CNV-seq analysis showed the presence of a duplication-type CNV Xp22.33-Xq28 (2757837-156030895) of approximately 155 Mb on the X chromosome of the proband, which was a de novo variant and carried by neither of the parents. The two heterozygous frameshift variants and duplication-type CNV were pathogenic according to the ACMG guidelines. Differential expression analysis of keratoconus-related genes showed that CPLANE1 was upregulated in the corneal tissues of keratoconus patients compared with normal controls, and such a difference was statistically significant (p = 0.000515, <0.05). PPI analysis showed that the CPLANE1-NPHP3 complex protein acted as a bridge between cilia and extracellular matrix tissue. According to the genetic test results and clinical phenotype analysis, the family was finally diagnosed with Joubert syndrome combined with Keratoconus and Klinefelter syndrome.DiscussionIn this study, we report a proband in a Han Chinese family with both Joubert syndrome and X-linked Klinefelter syndrome as well as keratoconus, and the phenotype spectrum of CPLANE1-Joubert syndrome may be expanded accordingly. Meanwhile, the significance of exome sequencing was emphasized in aiding the clinical diagnosis of complex cases, which is difficult to make.

Advances in the use of bevacizumab for the treatment of respiratory papilloma

Respiratory papilloma is a relatively common benign tumor of the respiratory tract, and a few patients may develop malignant changes. The disease has an insidious onset and lacks specific clinical manifestations, and its manifestations are closely related to the growth mode, location and size of the tumor. It can involve multiple parts, such as the larynx, trachea, bronchus, and lung parenchyma, which cause coughing, hoarseness, dysphonia, and, in severe cases, may lead to obstruction of the respiratory tract. At present, the treatment of respiratory papilloma lacks standardization, and there is no effective method to cure the disease. Surgery remains the main treatment for alleviating patients' symptoms and preventing airway obstruction. However, due to the high recurrence rate of respiratory papilloma, multiple surgeries are often needed, which reduces the quality of life of patients and increases their disease burden and economic burden. Bevacizumab, a vascular endothelial growth factor-binding antibody inhibitor, is a promising adjuvant treatment modality that shows good potential for reducing symptoms and the frequency of surgery. This article aimed to review the efficacy and safety of bevacizumab for the treatment of respiratory papilloma and discuss the differences and efficacy of the systemic application and intralesional injection of bevacizumab for the treatment of respiratory papilloma.

Autoimmune Nodopathy: When to Suspect and How to Treat?

Autoimmune nodopathy (AN) is a rare condition marked by autoantibodies that target specific proteins located within the node of Ranvier or paranodes. This disorder is distinctly different from chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), with AN patients displaying unique clinical symptoms that include acute or subacute onset, primarily distal muscle weakness, sensory ataxia, tremors, and a significant increase in cerebrospinal fluid protein levels. Certain antibodies are linked to specific clinical manifestations; for instance, anti-contactin-1 neuropathy is often accompanied by nephrotic syndrome, whereas anti-pan-neurofascin neuropathy resembles fulminant Guillain-Barre syndrome. In contrast to CIDP patients, who usually experience substantial improvement with intravenous immunoglobulin (IVIG), those with AN may see poor or merely temporary benefits from IVIG therapy. Nonetheless, treatment with the anti-B cell therapy, rituximab, has shown promising results. These findings underscore the critical need for accurate identification of AN's clinical indicators, swift diagnosis of affected individuals, and the application of more effective, targeted treatments for this specific condition.

Molecular characterisation of lupus low disease activity state (LLDAS) and DORIS remission by whole-blood transcriptome-based pathways in a pan-European systemic lupus erythematosus cohort

ObjectivesTo unveil biological milieus underlying low disease activity (LDA) and remission versus active systemic lupus erythematosus (SLE).MethodsWe determined differentially expressed pathways (DEPs) in SLE patients from the PRECISESADS project (NTC02890121)...

СПОНТАННЫЕ РАЗРЫВЫ МОЧЕВОГО ПУЗЫРЯ

: Bladder ruptures are a serious injury to the abdomen and pelvis. The development of urinary leaks, peritonitis and septic complications cause a high mortality rate in this pathology. In the vast majority of cases, the cause of bladder rupture is trauma. Much less common are the so-called spontaneous ruptures of the bladder, in which the main cause is weakness of the muscle wall, against which a minimal increase in intravesical pressure leads to rupture of the organ according to a typical hydrodynamic mechanism. The rarity of this pathology, the variety of etiological factors, and the absence of any specific clinical manifestations in most cases lead to delayed diagnosis, which negatively affects the results of treatment. This paper summarizes the literature data and our own clinical experience in treating patients with spontaneous rupture of the bladder. The above analysis of clinical observations will allow practicing urological surgeons to be more attentive and purposeful in collecting anamnesis in patients with a clinical picture of an acute abdomen and, if there is a suspicion of spontaneous rupture of the bladder, to use a set of modern diagnostic capabilities. An accurate and timely diagnosis will allow patients to be operated on earlier, before the clinical manifestations of diffuse peritonitis develop, which will have a positive impact on the results of treatment.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Proliferation activity and hormonal status of atypical hyperplasia and endometrioid adenocarcinoma of the endometrium

Atypical hyperplasia of the endometrium is a precancerous condition for endometrioid adenocarcinoma of the endometrium, which is the largest group among malignant neoplasms of the uterine body, according to the Cancer Registry, the mortality rate from which took the 3rd place in 2021. The absence of specific clinical manifestations complicates diagnostics at the early stages of the process, which necessitates the study of histological and immunohistochemical criteria to verify the diagnosis. The aim of the study. To improve the differential diagnostic morphological and immunohistochemical criteria for the diagnosis of atypical hyperplasia and endometrioid adenocarcinoma of the endometrium, using the latest international classification data. Materials and methods. Retrospective analysis of 76 cases of postoperative material of women for the period from 2020 to 2022 with a diagnosis of “endometrioid adenocarcinoma of the endometrium” – 61 cases and “endometrial hyperplasia with atypia” – 15 included an assessment of histological, immunohistochemical features, followed by statistical processing of the obtained results. Results. The incidence of endometrioid adenocarcinoma of the endometrium and atypical endometrial hyperplasia occurs in the premenopausal and menopausal periods. The expression level of the Ki-67 marker is directly proportional to the degree of tumor malignancy (p < 0.05). Estrogen receptors decrease as the degree of tumor malignancy increases. Progesterone receptors are equally present in endometrioid adenocarcinomas and atypical endometrial hyperplasia (p < 0.05). Conclusions. The necessity of using the Ki-67 marker and determining the hormonal status in endometrioid adenocarcinomas of the endometrium and atypical hyperplasia of the endometrium is argued.

Incidentally Discovered Giant Leiomyosarcoma of Renal Vein: A Case Report

Background: Leiomyosarcoma originating from the renal vein (RVLMS) is extremely rare. Only few cases are reported in the literature. Case Report: We report here an exceptional case of a huge LMS of the right renal vein incidentally discovered, occurring in a 73-year-old female patient. Conclusions: This tumor lacks specific clinical manifestations and specific imaging features. Only pathological features make their diagnosis. Standard treatment consists of radical nephrectomy followed by chemotherapy and/or radiotherapy. The prognosis factors are not well identified. Overall prognosis of renal vein LMS is poor

Correlation between large rearrangements and patient phenotypes in NF1 deletion syndrome: an update and review

About 5–10% of neurofibromatosis type 1 (NF1) patients exhibit large genomic germline deletions that remove the NF1 gene and its flanking regions. The most frequent NF1 large deletion is 1.4 Mb, resulting from homologous recombination between two low copy repeats. This “type-1” deletion is associated with a severe clinical phenotype in NF1 patients, with several phenotypic manifestations including learning disability, a much earlier development of cutaneous neurofibromas, an increased tumour risk, and cardiovascular malformations. NF1 adjacent co-deleted genes could act as modifier loci for the specific clinical manifestations observed in deleted NF1 patients. Furthermore, other genetic modifiers (such as CNVs) not located at the NF1 locus could also modulate the phenotype observed in patients with large deletions. In this study, we analysed 22 NF1 deletion patients by genome-wide array-CGH with the aim (1) to correlate deletion length to observed phenotypic features and their severity in NF1 deletion syndrome, and (2) to identify whether the deletion phenotype could also be modulated by copy number variations elsewhere in the genome. We then review the role of co-deleted genes in the 1.4 Mb interval of type-1 deletions, and their possible implication in the main clinical features observed in this high-risk group of NF1 patients.

RNA aptamer reveals nuclear TDP-43 pathology is an early aggregation event that coincides with STMN-2 cryptic splicing and precedes clinical manifestation in ALS

TDP-43 is an aggregation-prone protein which accumulates in the hallmark pathological inclusions of amyotrophic lateral sclerosis (ALS). However, the analysis of deeply phenotyped human post-mortem samples has shown that TDP-43 aggregation, revealed by standard antibody methods, correlates poorly with symptom manifestation. Recent identification of cryptic-splicing events, such as the detection of Stathmin-2 (STMN-2) cryptic exons, are providing evidence implicating TDP-43 loss-of-function as a potential driving pathomechanism but the temporal nature of TDP-43 loss and its relation to the disease process and clinical phenotype is not known. To address these outstanding questions, we used a novel RNA aptamer, TDP-43APT, to detect TDP-43 pathology and used single molecule in situ hybridization to sensitively reveal TDP-43 loss-of-function and applied these in a deeply phenotyped human post-mortem tissue cohort. We demonstrate that TDP-43APT identifies pathological TDP-43, detecting aggregation events that cannot be detected by classical antibody stains. We show that nuclear TDP-43 pathology is an early event, occurring prior to cytoplasmic accumulation and is associated with loss-of-function measured by coincident STMN-2 cryptic splicing pathology. Crucially, we show that these pathological features of TDP-43 loss-of-function precede the clinical inflection point and are not required for region specific clinical manifestation. Furthermore, we demonstrate that gain-of-function in the form of extensive cytoplasmic accumulation, but not loss-of-function, is the primary molecular correlate of clinical manifestation. Taken together, our findings demonstrate implications for early diagnostics as the presence of STMN-2 cryptic exons and early TDP-43 aggregation events could be detected prior to symptom onset, holding promise for early intervention in ALS.

An analysis of reported cases shoulder injury related to vaccine administration of after COVID-19 vaccination.

To prevent COVID-19, the COVID-19 vaccine has been widely administered worldwide, but various complications accompany this vaccine. The aim of this study was to investigate the demographic patterns, clinical features, diagnostic findings, and treatment outcomes associated with shoulder injury related to vaccine administration (SIRVA). This study examined 22 patients with SIRVA following COVID-19 vaccination from the Web of Science (WOS) and PubMed databases. The patients were categorized based on sex, age, type of COVID-19 vaccine received, dose administered, latency of symptom onset, and the presence of specific clinical manifestations. Patients, evenly distributed by sex (12 females, 10 males), and aged 21 to 84 years (mean age 46.6), were analyzed. SIRVA cases were reported across all age groups. The Pfizer - BioNTech COVID-19 vaccine had the highest incidence (n = 8), followed by the Oxford/AstraZeneca COVID-19 vaccine (n = 4). Symptoms, primarily shoulder pain (n = 22) and shoulder mobility disorders (n = 18), occurred within three days post-vaccination. Some patients also reported shoulder swelling (n = 5) and fever (n = 2). Imaging revealed nonspecific X-ray findings, supraspinatus tendon calcification (n = 2), and shoulder edema and inflammation on MRI (n = 12). This study provides insights into the clinical aspects of SIRVA related to COVID-19 vaccination. Recognition and appropriate management of these complications are crucial for optimal patient outcomes.

Special clinical manifestations and genetic characteristics of schaaf–Yang syndrome in Russian patients

A description of the clinical and genetic characteristics of four Russian patients with Schaaf–Yang syndrome, caused by previously described and newly identified nucleotide variants in MAGEL2 gene, is presented. It was shown that the most severe clinical manifestations were found in a patient with the new identified variant c.1828C>T (p.Gln610Ter), while in a patient with a new nucleotide variant c.1609C>T (p.Gln537Ter) the manifestations of the disease were moderate. Considering the significant similarity of the clinical manifestations of Schaaf–Yang syndrome with Prader–Willi syndrome, the criteria for their differential diagnosis are outlined, the use of which will help optimize the process of molecular genetic analysis aimed at finding the etiologic factor.

Nontuberculous Mycobacterial Infections in Pediatric Solid Organ Transplant and Hematopoietic Cell Transplant Recipients.

The diagnosis of nontuberculous mycobacterial infections is challenging in pediatric solid organ transplant and hematopoietic cell transplant recipients due to the absence of specific clinical manifestations, limitations of sampling, prolonged times for culture and identification, and difficulty discerning colonization from clinical disease. Treatment is dependent on the nontuberculous mycobacterial species, disease type, and pattern of drug resistance. Treatment of nontuberculous mycobacterial infections involves prolonged durations of therapy using multiple medications, which are limited by toxicities and drug-drug interactions.

Malignant melanoma located in the ureter and gallbladder: A case report and literature review.

Melanoma is one of a common cutaneous malignancy. Currently, metastatic malignant melanoma is difficult to be diagnosed through imaging examinations. Furthermore, the incidence of metastatic melanoma affecting the gallbladder and ureter is exceptionally rare. A 54-year-old female was admitted to the hospital with a half-month history of left lower back pain. Correlative examination revealed an occupying lesion in the mid-left ureter and the neck of the gallbladder. The patient was initially diagnosed with gallbladder cancer and left ureteral carcinoma based on imaging. Following 2 operations, immunohistochemical staining confirmed the presence of metastatic melanoma involving both the gallbladder and ureter. After multidisciplinary consultation and obtaining consent from the patient and her family, the patient underwent left radical nephroureterectomy, radical cholecystectomy, laparoscopic partial hepatectomy (Hep IV, Hep V), and lymph node dissection of hepatoduodenal ligament. One month after treatment, the patient imaging showed no disease progression, and at 6 months of follow-up, the patient was still alive. It is difficult to distinguish metastatic melanoma from carcinoma in situ by imaging. In addition, metastatic malignant melanoma lacks specific clinical manifestations and is prone to misdiagnosis, which emphasizes the highly aggressive nature of malignant melanoma.

Immunotherapy treatment for sarcomatoid renal cell carcinoma: case report and literature review

Introduction: Sarcomatoid renal cell carcinoma (SRCC) is clinically rare, accounting for approximately 1.0%–1.5% of renal parenchymal tumors. Although the concept of SRCC was proposed in 1968, the molecular mechanisms and immunological characteristics of sarcomatoid changes remain unclear. In the era of targeted therapy, the overall survival (OS) of patients with SRCC is typically less than 12 months. Case presentation: This article reports a case of SRCC in an 81-year-old male. Progression-free survival (PFS) was as long as 25 months and OS was 30 months after immunotherapy and the effect was significant. This is the first report of successful use toripalimab in the treatment of SRCC. Clinical discussion: SRCC is a rare type of renal cancer with no obvious specific clinical manifestations or imaging findings, and the diagnosis of the disease is based on pathological examinations. SRCC has a high degree of malignancy, progresses rapidly, and has a poor prognosis. The effect of traditional treatment is limited, and ICI may have therapeutic potential. Conclusions: Toripalimab may be effective and further exploration is anticipated to advance a new period of SRCC.

Autoantibodies Targeting G-Protein-Coupled Receptors: Pathogenetic, Clinical and Therapeutic Implications in Systemic Sclerosis.

Systemic sclerosis (SSc) is a multifaceted connective tissue disease whose aetiology remains largely unknown. Autoimmunity is thought to play a pivotal role in the development of the disease, but the direct pathogenic role of SSc-specific autoantibodies remains to be established. The recent discovery of functional antibodies targeting G-protein-coupled receptors (GPCRs), whose presence has been demonstrated in different autoimmune conditions, has shed some light on SSc pathogenesis. These antibodies bind to GPCRs expressed on immune and non-immune cells as their endogenous ligands, exerting either a stimulatory or inhibitory effect on corresponding intracellular pathways. Growing evidence suggests that, in SSc, the presence of anti-GPCRs antibodies correlates with specific clinical manifestations. Autoantibodies targeting endothelin receptor type A (ETAR) and angiotensin type 1 receptor (AT1R) are associated with severe vasculopathic SSc-related manifestations, while anti-C-X-C motif chemokine receptors (CXCR) antibodies seem to be predictive of interstitial lung involvement; anti-muscarinic-3 acetylcholine receptor (M3R) antibodies have been found in patients with severe gastrointestinal involvement and anti-protease-activated receptor 1 (PAR1) antibodies have been detected in patients experiencing scleroderma renal crisis. This review aims to clarify the potential pathogenetic significance of GPCR-targeting autoantibodies in SSc, focusing on their associations with the different clinical manifestations of scleroderma. An extensive examination of functional autoimmunity targeting GPCRs might provide valuable insights into the underlying pathogenetic mechanisms of SSc, thus enabling the development of novel therapeutic strategies tailored to target GPCR-mediated pathways.

T-cell immune profile in blood of systemic mastocytosis: Association with disease features.

Systemic mastocytosis (SM) is a heterogeneous disease characterized by an expansion of KIT-mutated mast cells (MC). KIT-mutated MC display activated features and release MC mediators that might act on the tumour microenvironment and other immune cells. Here, we investigated the distribution of lymphocyte subsets in blood of patients with distinct subtypes of SM and determined its association with other disease features. We studied the distribution of TCD4+ and TCD4- cytotoxic cells and their subsets, as well as total NK- and B cells, in blood of 115 SM patients-38 bone marrow mastocytosis (BMM), 67 indolent SM (ISM), 10 aggressive SM (ASM)- and 83 age-matched healthy donors (HD), using spectral flow cytometry and the EuroFlow Immunomonitoring panel, and correlated it with multilineage KITD816V , the alpha-tryptasemia genotype (HαT) and the clinical manifestations of the disease. SM patients showed decreased counts (vs. HD) of TCD4- cytotoxic cells, NK cells and several functional subsets of TCD4+ cells (total Th1, Th2-effector memory, Th22-terminal effector and Th1-like Tregs), together with increased T-follicular-helper and Th1/Th17-like Treg counts, associated with different immune profiles per diagnostic subtype of SM, in multilineal versus MC-restricted KITD816V and in cases with a HαT+ versus HαT- genotype. Unique immune profiles were found among BMM and ISM patients with MC-restricted KITD816V who displayed HαT, anaphylaxis, hymenoptera venom allergy, bone disease, pruritus, flushing and GI symptoms. Our results reveal altered T- and NK-cell immune profiles in blood of SM, which vary per disease subtype, the pattern of involvement of haematopoiesis by KITD816V , the HαT genotype and specific clinical manifestations of the disease.

Clinical description of dengue and chikungunya virus infections amongst acute febrile patients in a malaria endemic area of Mfou, the Centre region of Cameroon

This study aims to determine the frequency and clinical manifestations of dengue and chikungunya viral infections in the district hospital of Mfou, Centre region of Cameroon where malaria is endemic. Blood samples were collected from suspected cases and tested for Plasmodium parasites and for the molecular detection of viral RNAs (dengue, zika and chikungunya viruses) using TRIOPLEX qPCR. A total of 108 patients were clinically suspected among which 25 % were male and 50 % were less than 15.5 years old. Of these 14.8 % (16/108) and 2.8 % (3/108) had acute dengue and chikungunya fevers respectively. Co-infection with malaria was reported in 56.3 % (9/16) of Dengue cases and 33.3 % (1/3) of chikungunya cases. Clinical profiling further revealed that nausea and vomiting show a significant difference in dengue infected individuals to those of non-infected individuals (P = 0.027). The presence of dengue fever and chikungunya fever and the absence of specific clinical manifestations highlight the need to strengthen surveillance of acute febrile infections for a better estimation of the burden of arboviruses.

The Effects of Environmental Exposure on Epigenetic Modifications in Allergic Diseases.

Allergic diseases are one of the most common chronic conditions and their prevalence is on the rise. Environmental exposure, primarily prenatal and early life influences, affect the risk for the development and specific phenotypes of allergic diseases via epigenetic mechanisms. Exposure to pollutants, microorganisms and parasites, tobacco smoke and certain aspects of diet are known to drive epigenetic changes that are essential for immune regulation (e.g., the shift toward T helper 2-Th2 cell polarization and decrease in regulatory T-cell (Treg) differentiation). DNA methylation and histone modifications can modify immune programming related to either pro-allergic interleukin 4 (IL-4), interleukin 13 (IL-13) or counter-regulatory interferon γ (IFN-γ) production. Differential expression of small non-coding RNAs has also been linked to the risk for allergic diseases and associated with air pollution. Certain exposures and associated epigenetic mechanisms play a role in the susceptibility to allergic conditions and specific clinical manifestations of the disease, while others are thought to have a protective role against the development of allergic diseases, such as maternal and early postnatal microbial diversity, maternal helminth infections and dietary supplementation with polyunsaturated fatty acids and vitamin D. Epigenetic mechanisms are also known to be involved in mediating the response to common treatment in allergic diseases, for example, changes in histone acetylation of proinflammatory genes and in the expression of certain microRNAs are associated with the response to inhaled corticosteroids in asthma. Gaining better insight into the epigenetic regulation of allergic diseases may ultimately lead to significant improvements in the management of these conditions, earlier and more precise diagnostics, optimization of current treatment regimes, and the implementation of novel therapeutic options and prevention strategies in the near future.