Potyvirus Species Research Articles

New isolate of sweet potato virus 2 from Ipomoea nil: molecular characterization, codon usage bias, and phylogenetic analysis based on complete genome

BackgroundViral diseases of sweet potatoes are causing severe crop losses worldwide. More than 30 viruses have been identified to infect sweet potatoes among which the sweet potato latent virus (SPLV), sweet potato mild speckling virus (SPMSV), sweet potato virus G (SPVG) and sweet potato virus 2 (SPV2) have been recognized as distinct species of the genus Potyvirus in the family Potyviridae. The sweet potato virus 2 (SPV2) is a primary pathogen affecting sweet potato crops.MethodsIn this study, we detected an SPV2 isolate (named SPV2-LN) in Ipomoea nil in China. The complete genomic sequence of SPV2-LN was obtained using sequencing of small RNAs, RT-PCR, and RACE amplification. The codon usage, phylogeny, recombination analysis and selective pressure analysis were assessed on the SPV2-LN genome.ResultsThe complete genome of SPV2-LN consisted of 10,606 nt (GenBank No. OR842902), encoding 3425 amino acids. There were 28 codons in the SPV2-LN genome with a relative synonymous codon usage (RSCU) value greater than 1, of which 21 end in A/U. Among the 12 proteins of SPV2, P3 and P3N-PIPO exhibited the highest variability in their amino acid sequences, while P1 was the most conserved, with an amino acid sequence identity of 87-95.3%. The phylogenetic analysis showed that 21 SPV2 isolates were clustered into four groups, and SPV2-LN was clustered together with isolate yu-17-47 (MK778808) in group IV. Recombination analysis indicated no major recombination sites in SPV2-LN. Selective pressure analysis showed dN/dS of the 12 proteins of SPV2 were less than 1, indicating that all were undergoing negative selection, except for P1N-PISPO.ConclusionThis study identified a sweet potato virus, SPV2-LN, in Ipomoea nil. Sequence identities and genome analysis showed high similarity between our isolate and a Chinese isolate, yu-17-47, isolated from sweet potato. These results will provide a theoretical basis for understanding the genetic evolution and viral spread of SPV2.

Discovery and Characterization of Two Highly Divergent Variants of a Novel Potyvirus Species Infecting Madagascar Periwinkle (Catharanthus roseus).

During the summer of 2022, a cluster of Madagascar periwinkle plants with white and mauve flowers were observed with foliar mild yellow mosaic symptoms on a private property in Harlingen, Cameron County, Texas. The symptoms were reproduced on mechanically inoculated periwinkle and Nicotiana benthamiana plants. Virions of 776 to 849 nm in length and 11.7 to 14.8 nm in width were observed in transmission electron microscopy of leaf dip preparations made from symptomatic periwinkle leaves. High-throughput sequencing (HTS) analysis of total RNA extracts from symptomatic leaves revealed the occurrence of two highly divergent variants of a novel Potyvirus species as the only virus-like sequences present in the sample. The complete genomes of both variants were independently amplified via reverse transcriptase PCR, cloned, and Sanger sequenced. The 5' and 3' of the genomes were acquired using random amplification of cDNA ends methodology. The assembled virus genomes were 9,936 and 9,944 nucleotides (nt) long, and they shared 99.9 to 100% identities with the respective HTS-derived genomes. Each genome encoded hypothetical polyprotein of 3,171 amino acids (aa) (362.6 kilodaltons [kDa]) and 3,173 aa (362.7 kDa), respectively, and they shared 77.3/84.4% nt/aa polyprotein identities, indicating that they represent highly divergent variants of the same Potyvirus species. Both genomes also shared below-species-threshold polyprotein identity levels with the most closely phylogenetically related known potyviruses, thus indicating that they belong to a novel species. The name periwinkle mild yellow mosaic virus (PwMYMV) is given to the potyvirus with complete genomes of 9,936 nt for variant 1 (PwMYMV-1) and 9,944 nt for variant 2 (PwMYMV-2). We propose that PwMYMV be assigned into the genus Potyvirus (family Potyviridae).

THE COMPLETE NUCLEOTIDE SEQUENCE OF THE GENOMIC RNA OF BEAN COMMON MOSAIC VIRUS STRAIN NL4

The complete nucleotide sequence of the genomic RNA of the NL4 strain of Bean common mosaic virus (BCMV-NL4) was determined. The viral genome is 10037 nucleotides in length, excluding the 3’ terminal poly (A) tail, and contains a single open reading frame (ORF) of 9666 nucleotides encoding a polyprotein of 3222 amino acids. The ORF is flanked by 5’ and 3’ untranslated regions (UTRs) of 133 and 235 nucleotides, respectively. Comparative analyses of the predicted BCMV-NL4 polyprotein with other species of the genus Potyvirus revealed nine cleavage sites resulting in ten functional proteins. Nucleotide and amino acid sequence identities indicated a close relationship between BCMV-NL4 and BCMV-NL1. Blast comparisons using coat protein (CP) and 3’UTR sequences showed 100% identity between BCMV-NL4 and the Mexican variant (US6) of this strain.

Peppers under Siege: Revealing the Prevalence of Viruses and Discovery of a Novel Potyvirus Species in Venezuela

Many plant virus outbreaks have been recorded in the last two decades, threatening food security around the world. During pepper production seasons in 2008, 2014, and 2022, virus outbreaks were reported from Lara (western) and Miranda (central) states in Venezuela. Three hundred seventy-three plants exhibiting virus-like symptoms were collected and tested for virus infection through reverse transcription PCR (RT-PCR). The most prevalent viruses during the 2008 surveys conducted in Lara were potato virus Y (PVY, 66.25%), cucumber mosaic virus (CMV, 57.50%), pepper mild mottle virus (PMMoV, 35%), alfalfa mosaic virus (AMV, 23.75%), and tobacco rattle virus (TRV, 17.50%). This survey revealed for the first time that pepper is a natural host of AMV and TRV in Venezuela. A further, divergent potyvirus isolate was also detected in 23.75% of pepper plants from Lara state. In 2014, a follow-up survey after virus outbreaks reported in Lara and Miranda states also detected this divergent potyvirus isolate in 21.68% of pepper plants, with tomato spotted wilt virus (TSWV) and PMMoV dominating the viral landscape (62.65 and 21.68% of tested plants, respectively). By comparison, the surveys revealed significant changes in viral community composition. The complete capsid protein (CP) sequence of the putative potyvirus was obtained from two pepper samples. According to the Potyvirus taxonomic criteria, these results suggest that the isolate represents a distinct virus species, for which we propose the name “pepper severe mottle virus” (PepSMoV). Virus outbreaks could be attributed to agricultural and environmental factors, such as climate change, the use of wastewater, the use of uncertified seeds, misuse of agricultural chemicals, transmission with food trade networks, and the development of new viral strains due to mutations and recombination and pathogen spillover. This study demonstrates the value of knowledge of the prevalence and distribution of viral species to recommend virus-resistant cultivars to replace susceptible ones, especially in virus hotspot areas.

Host-specific adaptation drove the coevolution of leek yellow stripe virus and Allium plants.

Host adaptation plays a crucial role in virus evolution and is a consequence of long-term interactions between virus and host in a complex arms race between host RNA silencing and viral RNA silencing suppressor (RSS) as counterdefense. Leek yellow stripe virus (LYSV), a potyvirus causing yield loss of garlic, infects several species of Allium plants. The unexpected discovery of an interspecific hybrid of garlic, leek, and great-headed (GH) garlic motivated us to explore the host-adaptive evolution of LYSV. Here, using Bayesian phylogenetic comparative methods and a functional assay of viral RSS activity, we show that the evolutionary context of LYSV has been shaped by the host adaptation of the virus during its coevolution with Allium plants. Our phylogenetic analysis revealed that LYSV isolates from leek and their taxonomic relatives (Allium ampeloprasum complex; AAC) formed a distinct monophyletic clade separate from garlic isolates and are likely to be uniquely adapted to AAC. Our comparative studies on viral accumulation indicated that LYSV accumulated at a low level in leek, whereas LYSVs were abundant in other Allium species such as garlic and its relatives. When RSS activity of the viral P1 and HC-Pro of leek LYSV isolate was analyzed, significant synergism in RSS activity between the two proteins was observed in leek but not in other species, suggesting that viral RSS activity may be important for the viral host-specific adaptation. We thus consider that LYSV may have undergone host-specific evolution at least in leek, which must be driven by speciation of its Allium hosts. IMPORTANCE Potyviruses are the most abundant plant RNA viruses and are extremely diversified in terms of their wide host range. Due to frequent host switching during their evolution, host-specific adaptation of potyviruses may have been shaped by numerous host factors. However, any critical determinants for viral host range remain largely unknown, possibly because of the repeated gain and loss of virus infectivity of plants. Leek yellow stripe virus (LYSV) is a species of the genus Potyvirus, which has a relatively narrow host range, generally limited to hosts in the genus Allium. Our investigations on leek and leek relatives (Allium ampeloprasum complex), which must have been generated through interspecies hybridization, revealed that LYSV accumulation remained low in leek as a result of viral host adaptation in competition with host resistance such as RNA silencing. This study presents LYSV as an ideal model to study the process of host-adaptive evolution and virus-host coevolution.

A Single Nonsynonymous Substitution in the RNA-Dependent RNA Polymerase of Potato virus Y Allows the Simultaneous Breakdown of Two Different Forms of Antiviral Resistance in Capsicum annuum.

The dominant Pvr4 gene in pepper (Capsicum annuum) confers resistance to members of six potyvirus species, all of which belong to the Potato virus Y (PVY) phylogenetic group. The corresponding avirulence factor in the PVY genome is the NIb cistron (i.e., RNA-dependent RNA polymerase). Here, we describe a new source of potyvirus resistance in the Guatemalan accession C. annuum cv. PM949. PM949 is resistant to members of at least three potyvirus species, a subset of those controlled by Pvr4. The F1 progeny between PM949 and the susceptible cultivar Yolo Wonder was susceptible to PVY, indicating that the resistance is recessive. The segregation ratio between resistant and susceptible plants observed in the F2 progeny matched preferably with resistance being determined by two unlinked recessive genes independently conferring resistance to PVY. Inoculations by grafting resulted in the selection of PVY mutants breaking PM949 resistance and, less efficiently, Pvr4-mediated resistance. The codon substitution E472K in the NIb cistron of PVY, which was shown previously to be sufficient to break Pvr4 resistance, was also sufficient to break PM949 resistance, a rare example of cross-pathogenicity effect. In contrast, the other selected NIb mutants showed specific infectivity in PM949 or Pvr4 plants. Comparison of Pvr4 and PM949 resistance, which share the same target in PVY, provides interesting insights into the determinants of resistance durability.

Complete genome sequence and genome characterization of a novel potyvirus from Lamprocapnos spectabilis.

The genome of a new potyvirus from a Lamprocapnos spectabilis plant in South Korea was sequenced by high-throughput sequencing and confirmed by Sanger sequencing. The new potyvirus was tentatively named "lamprocapnos virus A" (LaVA); its complete genome contains 9,745 nucleotides, excluding the 3'-terminal poly(A) tail. The LaVA genome structure is similar to that of members of the genus Potyvirus and contains an open reading frame encoding a large putative polyprotein of 3,120 amino acids (aa) with conserved motifs. The complete genome shared 48%-56% nucleotide sequence identity and the polyprotein shared 41%-52% aa sequence identity with those of other potyviruses. These values are below the standard thresholds for potyvirus species demarcation. Phylogenetic analysis based on polyprotein sequences showed that LaVA belongs to the genus Potyvirus. To our knowledge, this is the first report of the complete genome sequence and genome characterization of a potyvirus infecting Lamprocapnos spectabilis.

First report of Turnip mosaic virus infecting saffron in Iran.

Saffron (Crocus sativus) is widely used as an important herbal medicine crop worldwide. Iran is the largest producer and exporter of saffron in the world. Turnip mosaic virus (TuMV) is a species of the genus Potyvirus, which infects a wide range of plants species. During the autumn of 2019, saffron plants with symptoms including colour breaking of the flowers, chlorosis and mild mosaic of leaves were collected from the major saffron cultivation areas of Iran. After the isolation of total RNA from diseased samples, RT-PCR was done using TuMV-specific primers. Amplicons of two selected isolates were purified, cloned, and sequenced. BLASTn of obtained sequences indicated high similarity with TuMV sequences. To the best of our knowledge, this is the first finding of TuMV infection in the saffron plant of Iran.

The Characterization of the Tobacco-Derived Wild Tomato Mosaic Virus by Employing Its Infectious DNA Clone.

Simple SummaryWild tomato mosaic virus (WTMV, genus Potyvirus, family Potyviridae) is an emerging viral pathogen that endangers Nicotiana tabacum production. The field survey conducted in this study shows that WTMV is becoming an epidemic in China. An infectious DNA clone of the tobacco-derived WTMV is constructed. It can infect wild eggplant, black nightshade, and tobacco plants but can not infect various local pepper varieties. WTMV evolves into three groups that coincide with their original hosts, tobacco, pepper, or wild eggplant. Thus, the tobacco-derived WTMV might divergently evolves to adapt to tobacco other than peppers. We show that WTMV is compatible with the coinfection of cucumber mosaic virus (CMV) or tobacco mosaic virus (TMV) in tobacco but not other potyviruses. Specifically, WTMV can interfere with the infection of other potyvirus species in tobacco, a phenomenon known as superinfection exclusion previously observed within the same potyviral species. This study contributes essential knowledge on the evolution, infectivity, and recent epidemics of WTMV, and provides the key tool for further disease-resistance and field management studies.Viral diseases of cultivated crops are often caused by virus spillover from wild plants. Tobacco (N. tabacum) is an important economic crop grown globally. The viral pathogens of tobacco are traditional major subjects in virology studies and key considerations in tobacco breeding practices. A positive-strand RNA virus, wild tomato mosaic virus (WTMV), belonging to the genus potyvirus in the family potyviridae was recently found to infect tobacco in China. In this study, diseased tobacco leaf samples were collected in the Henan Province of China during 2020–2021. Several samples from different locations were identified as WTMV positive. An infectious DNA clone was constructed based on one of the WTMV isolates. By using this clone, we found that WTMV from tobacco could establish infections on natural reservoir hosts, demonstrating a possible route of WTMV spillover and overwintering in the tobacco field. Furthermore, the WTMV infection was found to be accompanied by other tobacco viruses in the field. The co-inoculation experiments indicate the superinfection exclusion (SIE) between WTMV and other potyvirus species that infect tobacco. Overall, our work reveals novel aspects of WTMV evolution and infection in tobacco and provides an important tool for further studies of WTMV.

First report of Apium virus Y in wild carrot (Daucus carota ssp. carota) in Spain

Apium virus Y (ApVY), a member of the genus Potyvirus, infects cultivated, weedy, and wild Apiaceae species, in which it may be asymptomatic (Eastwell et al., 2008) or cause symptoms such as leaf mosaic, interveinal chlorosis, vein clearing, deformation and/or stunting. Since its first identification in Australia where it is considered endemic (Moran et al., 2002), ApVY has also been reported in Germany, Slovenia, New Zealand and the USA (EFSA, 2022). Natural infection of ApVY has been reported in celery, coriander, dill, parsley, Ammi majus and Conium maculatum, while other Apiaceae species as well as some Chenopodiaceae, and Nicotiana benthamiana have been reported as experimental hosts (EFSA Panel on Plant Health, 2022). In June 2021, six carrot populations (five cultivated carrot fields and a wild carrot population) were sampled near Segovia, Central Spain. From each population, leaf samples were randomly collected from fifty plants, including asymptomatic and symptomatic (reddening or chlorosis), and pooled into one sample. Double-stranded RNAs were extracted from each pool and converted to complementary DNA (Marais et al., 2018) before being sequenced (2 × 125 nt paired reads; Illumina Hiseq2500), yielding between 2 and 6.5 million reads per sample. Analysis of the obtained sequence data by mapping reads on viral reference genomes using CLC Genomics Workbench v22.0 revealed a high number of reads from the wild carrot population (331,258 reads or c. 13% of the total) mapping at high stringency (>90% identity over >95% of read length) on the genomic RNA sequence of ApVY (GenBank Accession No. HM363516). De novo assembly of reads from the wild carrot population and contig BlastX annotation allowed the identification of 15 contigs of between 360 and 2,530 nt which could be scaffolded and extended by successive rounds of mapping of remaining reads into two complete, 9,916 nt-long genomic sequences of ApVY. These two sequences are 95.1% identical and share 84.8-86.2% identity with other full-length ApVY genomic sequences available in GenBank. To confirm the presence of ApVY in the sampled wild carrot population, a two-step RT-PCR assay with detection primers (ApVY_458_F: 5′ACGCCATGCATTTCAAGTGTCC3′ and ApVY_458_R: 5′ATGTGTTCGTGATCAGGGTGC3′) designed to generate a 458 nt amplicon was used on the dsRNAs extracted from the pooled sample. Sanger sequencing of the amplicon (OM801196) showed it to be identical to one of the sequences obtained by Illumina sequencing. To our knowledge, this is the first reported case of natural ApVY infection in wild carrot and the first report of the virus in Spain, enabling us to increase the information on ApVY's distribution throughout Europe and suggesting this pathogenic virus might pose a problem at some point in carrot crops. Given the mixed infection status of the pool of plants sampled in the wild carrot population as evidenced by the HTS results, it is not possible to evaluate the pathogenicity of ApVY in this host. Efforts are clearly needed to evaluate its presence and potential impact in cultivated carrot crops. This study was funded by the European Union through a Horizon 2020 Marie Skłodowska-Curie Actions Innovative Training Network (H2020 MSCA- 60 ITN) project “INEXTVIR” (GA 813542).

StREM1.3 REMORIN Protein Plays an Agonistic Role in Potyvirus Cell-to-Cell Movement in N. benthamiana.

REMORIN proteins belong to a plant-specific multigene family that localise in plasma membrane nanodomains and in plasmodesmata. We previously showed that in Nicotiana benthamiana, group 1 StREM1.3 limits the cell-to-cell spread of a potexvirus without affecting viral replication. This prompted us to check whether an effect on viral propagation could apply to potyvirus species Turnip mosaic virus (TuMV) and Potato virus A (PVA). Our results show that StREM1.3 transient or stable overexpression in transgenic lines increases potyvirus propagation, while it is slowed down in transgenic lines underexpressing endogenous NbREMs, without affecting viral replication. TuMV and PVA infection do not alter the membranous localisation of StREM1.3. Furthermore, StREM1.3-membrane anchoring is necessary for its agonist effect on potyvirus propagation. StREM1.3 phosphocode seems to lead to distinct plant responses against potexvirus and potyvirus. We also showed that StREM1.3 interacts in yeast and in planta with the key potyviral movement protein CI (cylindrical inclusion) at the level of the plasma membrane but only partially at plasmodesmata pit fields. TuMV infection also counteracts StREM1.3-induced plasmodesmata callose accumulation at plasmodesmata. Altogether, these results showed that StREM1.3 plays an agonistic role in potyvirus cell-to-cell movement in N. benthamiana.

Investigations on annual spreading of viruses infecting cucurbit crops in Uttar Pradesh State, India

During 2018 an intensive study was conducted to determine the viruses associated with cucurbitaceous crops in nine agroclimatic zones of the state of Uttar Pradesh, India. Total of 563 samples collected and analysed across 14 different cucurbitaceous crops. The results showed the dominance of Begomovirus (93%) followed by Potyvirus (46%), cucumber green mottle mosaic virus (CGMMV-39%), Polerovirus (9%), cucumber mosaic virus (CMV-2%) and Orthotospovirus (2%). Nearly 65% of samples were co-infected with more than one virus. Additionally, host range expansion of CMV, CGMMV and polerovirus was also observed on cucurbit crops. A new potyvirus species, zucchini tigre mosaic virus, earlier not documented from India has also been identified on five crops during the study. Risk map generated using ArcGIS for virus disease incidence predicted the virus severity in unexplored areas. The distribution pattern of different cucurbit viruses throughout Uttar Pradesh will help identify the hot spots for viruses and will facilitate to devise efficient and eco-friendly integrated management strategies for the mitigation of viruses infecting cucurbit crops. Molecular diversity and evolutionary relationship of the virus isolates infecting cucurbits in Uttar Pradesh with previously reported strains were understood from the phylogenetic analysis. Diverse virus infections observed in the Eastern Plain zone, Central zone and North-Eastern Plain zone indicate an alarming situation for the cultivation of cucurbits in the foreseeable future.

Detection and Molecular Characterization of Two Potyvirus Species on Cucurbits from Northwestern of Iran

Cucurbit crops belonging to the family Cucurbitaceae are one the most important horticultural crops worldwide and cultivated widely in Iran. To aim detection and phylogenetic analysis of potyvirus members, during 2015-2016, 215 leaf samples from cucumber, melon, watermelon, and squash symptomatic with deforming and reduction in leaf size, blistering, mild and severe mosaic, fruit deformation, and stunting were collected from 10 major cucurbits-growing locations in West Azerbaijan province. Following mechanical inoculation of Cucurbita pepo as an indicator plant with symptomatic cucurbit crop extracts, a variety of symptoms developed on the plants. Then, total RNA extracted from 70 symptomatic leaf samples, and partial RNA-dependent RNA polymerase (NIb) (350 bp) was amplified using universal primer pairs (NIb2F/NIb3R) by reverse transcription-polymerase chain reaction (RT-PCR). The infection by potyviruses in 38.75% of the samples was confirmed based on the result. The five PCR products belonging to different hosts at the expected size (350bp) were sequenced. One sample (Ir-Na: MH491979) was determined to be infected by the Watermelon mosaic virus (WMV) whereas four samples (Ir-Ma:MH491979, Ir-Ng:MH491980, Ir-Pi:MH491981, and Ir-Ur:MH491982) infected by Zucchini yellow mosaic virus (ZYMV). In the phylogenetic analysis based on Maximum-likelihood, three ZYMV isolates (Ir-Ng, Ir-Pi, and Ir-Ur) were placed in subgroup I whereas one isolate (Ir-Ma) was placed in subgroup II belonging to group A. Also, WMV isolate (Ir- Na) was placed in CL phylogroup.

Analysis of proteolytic processing sites in potyvirus polyproteins revealed differential amino acid preferences of NIa-Pro protease in each of seven cleavage sites.

Potyviruses encode a large polyprotein that undergoes proteolytic processing, producing 10 mature proteins: P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa-Pro, NIb-RdRp, and CP. While P1/HC-Pro and HC-Pro/P3 junctions are cleaved by P1 and HC-Pro, respectively, the remaining seven are processed by NIa-Pro. In this study, we analyzed 135 polyprotein sequences from approved potyvirus species and deduced the consensus amino acid residues at five positions (from −4 to +1, where a protease cleaves between −1 and +1) in each of nine cleavage sites. In general, the newly deduced consensus sequences were consistent with the previous ones. However, seven NIa-Pro cleavage sites showed distinct amino acid preferences despite being processed by the same protease. At position −2, histidine was the dominant amino acid residue in most cleavage sites (57.8–60.7% of analyzed sequences), except for the NIa-Pro/NIb-RdRp junction where it was absent. At position −1, glutamine was highly dominant in most sites (88.2–97.8%), except for the VPg/NIa-Pro junction where glutamic acid was found in all the analyzed proteins (100%). At position +1, serine was the most abundant residue (47.4–86.7%) in five out of seven sites, while alanine (52.6%) and glycine (82.2%) were the most abundant in the P3/6K1 and 6K2/VPg junctions, respectively. These findings suggest that each NIa-Pro cleavage site is finely tuned for differential characteristics of proteolytic reactions. The newly deduced consensus sequences may be useful resources for the development of models and methods to accurately predict potyvirus polyprotein processing sites.

When a knockout is an Achilles' heel: Resistance to one potyvirus species triggers hypersusceptibility to another one in Arabidopsis thaliana.

The translation initiation factors 4E are a small family of major susceptibility factors to potyviruses. It has been suggested that knocking out these genes could provide genetic resistance in crops when natural resistance alleles, which encode functional eIF4E proteins, are not available. Here, using the well‐characterized Arabidopsis thaliana–potyvirus pathosystem, we evaluate the resistance spectrum of plants knocked out for eIF4E1, the susceptibility factor to clover yellow vein virus (ClYVV). We show that besides resistance to ClYVV, the eIF4E1 loss of function is associated with hypersusceptibility to turnip mosaic virus (TuMV), a potyvirus known to rely on the paralog host factor eIFiso4E. On TuMV infection, plants knocked out for eIF4E1 display striking developmental defects such as early senescence and primordia development stoppage. This phenotype is coupled with a strong TuMV overaccumulation throughout the plant, while remarkably the levels of the viral target eIFiso4E remain uninfluenced. Our data suggest that this hypersusceptibility cannot be explained by virus evolution leading to a gain of TuMV aggressiveness. Furthermore, we report that a functional eIF4E1 resistance allele engineered by CRISPR/Cas9 base‐editing technology successfully circumvents the increase of TuMV susceptibility conditioned by eIF4E1 disruption. These findings in Arabidopsis add to several previous findings in crops suggesting that resistance based on knocking out eIF4E factors should be avoided in plant breeding, as it could also expose the plant to the severe threat of potyviruses able to recruit alternative eIF4E copies. At the same time, it provides a simple model that can help understanding of the homeostasis among eIF4E proteins in the plant cell and what makes them available to potyviruses.

Genetic Diversity of Potyviruses Associated with Tulip Breaking Syndrome.

Tulip breaking is economically the most important viral disease of modern-day tulip growing. It is characterized by irregular flame and feather-like patterns in the flowers and mosaic on the foliage. Thirty-two leaf samples were collected from cultivated tulip plants showing tulip breaking syndrome from Hungary in 2017 and 2018. Virus identification was performed by serological (ELISA) and molecular (RT-PCR) methods. All samples proved to be infected with a potyvirus and evidence was provided that three potyvirus species could be identified in the samples: Lily mottle virus (LMoV), Tulip breaking virus (TBV) and Rembrandt tulip-breaking virus (ReTBV). Recombination prediction accomplished with Recombination Detection Program (RDP) v4.98 revealed potential intraspecies recombination in the case of TBV and LMoV. Phylogenetic analyses of the coat protein (CP) regions proved the monophyletic origin of these viruses and verified them as three different species according to current International Committee on Taxonomy of Viruses (ICTV) species demarcation criteria. Based on these results, we analyzed taxonomic relations concerning potyviruses associated with tulip breaking syndrome. We propose the elevation of ReTBV to species level, and emergence of two new subgroups in ReTBV.

Characterization of a Strain of Malva Vein Clearing Virus in Alcea rosea via Deep Sequencing.

Malva vein clearing virus (MVCV) is a member of the Potyvirus species, and has a negative impact on the aesthetic development of Alcea rosea. It was first reported in Germany in 1957, but its complete genome sequence data are still scarce. In the present work, A. rosea leaves with vein-clearing and mosaic symptoms were sampled and analyzed with small RNA deep sequencing. By denovo assembly the raw sequences of virus-derived small interfering RNAs (vsiRs) and whole genome amplification of malva vein cleaning virus SX strain (MVCV-SX) by specific primers targeting identified contig gaps, the full-length genome sequences (9,645 nucleotides) of MVCV-SX were characterized, constituting of an open reading frame that is long enough to encode 3,096 amino acids. Phylogenetic analysis showed that MVCV-SX was clustered with euphorbia ringspot virus and yam mosaic virus. Further analyses of the vsiR profiles revealed that the most abundant MVCV-vsiRs were between 21 and 22 nucleotides in length and a strong bias was found for “A” and “U” at the 5′-terminal residue. The results of polarity assessment indicated that the amount of sense strand was almost equal to that of the antisense strand in MVCV-vsiRs, and the main hot-spot region in MVCV-SX genome was found at cylindrical inclusion. In conclusion, our findings could provide new insights into the RNA silencing-mediated host defence mechanism in A. rosea infected with MVCV-SX, and offer a basis for the prevention and treatment of this virus disease.

Sequence analyses of RT-PCR products obtained from seven infected leaf samples revealed existence of three potyvirus species in Indian narcissus (Narcissus tazetta L.).

Potyvirus species associated with yellow leaf stripe disease of Indian narcissus (Narcissus tazetta L.) var. Paperwhite has been studied by sequence analyses of ~ 1.5kb genomic fragments obtained from seven RT-PCR amplifications of infected samples. Sequence analysis revealed the occurrence of three potyvirus species: cyrtanthus elatus virus-A (CEVA: KF430815, KF430816, KM066973, KM066974); narcissus yellow stripe virus (NYSV: KM066972, JQ686724) and narcissus degeneration virus (NDV: MK572806). The existence of three potyvirus species: CEVA, NYSV and NDV are being reported in Indian narcissus.

Aphid Transmission of Potyvirus: The Largest Plant-Infecting RNA Virus Genus.

Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non-persistent, non-circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission, and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi-partite interactions through multi-omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid-transmitted potyviruses to global agriculture.

Molecular characterization of two recombinant isolates of telosma mosaic virus infecting Passiflora edulis from Fujian Province in China.

Telosma mosaic virus (TeMV) is an important plant virus causing considerable economic losses to passion fruit (Passiflora edulis) production worldwide, including China. In this study, the complete genome sequence (excluding the poly (A) tail) of two TeMV isolates, Fuzhou and Wuyishan, were determined to be 10,050 and 10,057 nucleotides, respectively. Sequence analysis indicated that Fuzhou and Wuyishan isolates share 78–98% nucleotide and 83–99% amino acid sequence identities with two TeMV isolates of Hanoi and GX, and a proposed new potyvirus, tentatively named PasFru. Phylogenetic analysis indicated that these TeMV isolates and PasFru were clustered into a monophyletic clade with high confidences. This indicated that PasFru and the four TeMV isolates should be considered as one potyvirus species. Two recombination breakpoints were identified within the CI and NIb genes of the Fuzhou isolate, and also within the P1 gene of the Wuyishan isolate. To the best of our knowledge, this is the first report of TeMV recombinants worldwide.